60985BNBNBillingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b).inbredCd36|Tnfrsf1a2301|62123710001AVN/Orlinbred60988LOU/MHistocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978).inbred60989BPStrain selected for resistance to Walker 256 tumour.inbred1598797WF.WKY-(<i>D10Got124-D10Rat187</i>)/UwmWKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL.congenic1598798BBDP/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.inbredExtinct10002BBDP/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle.inbred10003BBDR/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 1 53 days of age after the first and 67 1 10 days of age after the 9th cycle.inbred10004BC/CpbUObtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands.inbred10005BDIX/Hanunknowninbred10006BDVII/CubDruckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype.inbred10008BN/SsNHsdObtained by HSD from nucleus colony at NIHinbred10009BP/Cubinbred10010BUF/PitBuffaloinbred10012DA/PitNUnknowninbredextinct10013DON/Melbinbred10014F344/Pitinbred10015FHH/EurAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbred10018IS/Kyoishibashi ratIshibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978.inbredLive Animals; Embryo; SpermOsteosis10019LE/MolLong Evansinbred10020LEW/PitLewisinbred10021LH/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbred10025MHS/GibMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureinbred10027MNRA/NTo Harrington in 1965 at F25 (Harrington 1981).inbred10045WN/NInbred Wistar; W/NHeston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15.inbred10046WKY/OlaHsdinbred10047WTC/KyoWTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988.inbredLive Animals; Embryo; Sperm10023LOU/CHanLouvainunknowninbred10026MNR/NMaudsely non-reactiveTo N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.inbredExtinct10029MR/PitAs for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).inbred10032ODU/NOsaka Dental UniversityFrom outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982).inbredExtinct10043WF/PitWistar Furthinbred10044WIST/NhgWistarFrom outbred Wistar stock in 1967.inbredUgt1a1|Abcd23935|6924410040SR/JrSalt ResistantOriginated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b).inbredEmbryo; Sperm734528OLETF.BN-(<i>D1Rat76-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.congenic734531OLETF.F344-(<i>D1Rat306-D1Rat461</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation.congenic60986BUF/NHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.inbredExtinct60987MHS/NMilan Hypertensive StrainMilan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).inbredEmbryoAdd1|Add22041|204210028MNS/GibMilan Normotensive StrainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.inbred10031NP9From Wistarinbred10033OKA/Wslinbred10034OM/ZtmOsborne-Mendelunknowninbred10035P5Cinbred10036PVG/Pitinbred10037SD/RijFrom Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984).inbred10038SHR/OlaHsdSpontaneously Hypertensive Ratinbred10039SHRSP/RivSpontaneously Hypertensive Rat, Stroke Proneinbred10042WAG/RijKyoRij > Kyo (1979, F?, GF)inbredLive Animals; Embryo; SpermNeurobiology60996DONDonryu ratR. Sato 1950 by inbreeding Japanese albino rats.inbred60998COPCurtiss 1921 at Columbia University Institute for Cancer Research.inbred61106SHR.BN-(<i>D8Mit5-D8Mgh6</i>)/IpcvA segment of chr. 8 is transferred from the normotensive BN-<i>Lx</i>/Cub rat to the SHR/Ola.congenic628908SHR.BN-(<i>D1Mit3-Igf2</i>)/IpcvSegment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating.congenicSa|Scnn1b|Scnn1g3616|3640|3641628909SHR.BN-(<i>D13Arb5-Ren1</i>)/IpcvSegment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity.congenicRen3554629459ZUC-<i>Lepr<sup>faSteJrpz</sup></i>Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.mutant629462ZUC-<I>Lepr</I><sup>faSte</sup>This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.mutantLepr300161010SHRSPSpontaneously Hypertensive Rat, Stroke ProneThe A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rabbatu (1994).inbred61011BB/NBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).inbred10017GK/KyoSweGoto KakizakiDeveloped from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975).inbred67958ASAlbino SurgeryUniversity of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973).inbred67959AS2Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968).inbred67960AUGDerived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England.inbred67962ANOutbred Wistar Imamichi strain.inbred67965AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976.recombinant_inbred67966B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85.inbred67967B/1NNo further information.inbredExtinct67971BBZStrain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3inbred67974BDEZentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring.inbred67975BDIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbred60995DRYRecombinant inbred strain used as normotensive control in studies of hypertension.inbred60999LEWLewisDr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992)inbredFgf2|Tnfrsf1a2609|62123767957APRDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbred629463ZUC-<I>Lepr</I><sup>+Ste</sup>This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These are recessive fatty animals.mutantLepr3001629464ZUC-<I>Lepr</I><sup>fa</sup>When Lois and Theodore Zucker retired they gave the original Zucker rat colony to Dr. Roy Martin. When Dr. Martin was leaving University of Georgia he gave this colony to Dr. Johnny R. Porter at the Louisiana State University.mutant629465SHR/NCrlCrljNIH derived strain maintained at the Charles River, Japan.inbredLive Animals; EmbryoCardio Hypertension629481SHR.WKY-(<i>D1Wox33-D1Got194</i>)This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background.congenic629482WKY.SHR-(<i>D1Wox19-D1Mit2</i>)/NjsFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenic61000SHRSpontaneously Hypertensive RatOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648).inbredAgtr1b|Cd36|Ephx22071|2301|62073260990LH/MavRrrcLyon HypertensiveLyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredEmbryo; Sperm60991LELong EvansDr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984).inbred60992MNSMilan normotensive strainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974).inbred631607SS.WKY-(<i>D2N35-Mme</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jrcongenic728389WF.COP-(<i>D2Mit29-D2Rat201</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenic631601WKY.SHRSP-(<i>Asgr1-Vamp2</i>)/BbbBoth the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aokicongenic724572SS.LEW-(<i>D10Wox51-D10Rat27</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic631588SS.MNS-(<i>D10Mit11-Vamp2</i>)/McoFragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jrcongenic728391WF.COP-(<i>D2Rat253-D2Uwm17</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenic728392RHA/N-<I>di</I>Roman high avoidance-<i>di</i> mutationBrattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.congenic60997DADADeveloped from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case.inbredEdnrb|Tnfrsf1a2536|621237728393SS.LEW-(<i>D10Got125-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic60984GHUniversity of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973).inbred631600WKY.SHRSP-(<i>Mt1pa-D1Rat200</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYcongenic68097MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977).inbred68098MWMunich WistarMunich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS.inbred68099MWFFrom outbred Wistar rats selected for large numbers of superficial glomeruli.inbred68100NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990).inbred68103NERnoda epileptic ratFrom Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has.inbred68104NIG-III/HokFrom a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987).inbredLive Animals; Embryo; Sperm68106NSD/NNIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.inbredExtinct68107NZRSubline of AS2 separated at F32.inbred68109ODUSAs for ODU, but maintained at Osaka Dental University.inbred68113OXYR/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain.inbred61001NEDHInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.inbred61002BDIXDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. See entry for BDI origin.inbred61003BCHagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973.inbred61004WIST/ZihkFrom Wistar outbred stock in 1978.inbred61005OM/NOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).inbredExtinct60993FHHFawn Hooded HypertensiveAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbred67934WOKAOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.inbred67935WOKWOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.inbred67936WR Sykora, Rosice (Stark et al 1968b). No further infromation.inbred67937WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986).inbred67938Y59 Strain developed in Zagreb, Jugoslavia.inbred67939YA/NNo further information.inbredExtinct67940YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992)inbred67941Z61Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours.inbred67942ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989).inbred67943SHE/N-cpReference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94.inbred67945ISfrom a cross between a wild male and a Wistar female, with sib mating since 1968.inbred67948JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984).inbred67976BDIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbred67977BDIIIsee BDI.inbred67978BDIVsee BDI.inbred1556748F344/SnkMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japaninbred1558660SHRSP/TkyoSubstrain of SHRSP rats maintained at International Medical Center of Japan, Tokyoinbred61006PVGPVGKings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).inbred68079LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).inbred68082LUDWLudwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU.inbred68083LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover)recombinant_inbred68084M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum.inbred68085M17AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum.inbred61007WFWistar FurthJ Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995).inbred61008WAGAL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984).inbred61009AVN Unknown. Keil University from O Stark, Charles University, Prague.inbred10024M520/NTo N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49.inbredEmbryo61013E3Krvning, Gvttingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968.inbred61014OLETFOtsuka Long-Evans Tokushima fattyDeveloped by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1983.inbred61015LN/MavRrrclyon normotensive(taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredEmbryo; Sperm61096SHR/NCrukSpontaneously Hypertensive RatNIH derived strain maintained at the Charles River, United Kingdom.inbred61098BXH/IpcvThese recombinant inbred strains are derived from the (BN-<i>Lx</i>/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republicrecombinant_inbred61100SHR/OlaStrain originated from an inbred SHR strain from Harlan UK Ltd.inbred61103WKYThis strain was maintained at Medical College of Ohio, Toledo, OhioinbredCd36|Nos32301|318661104LEW/NCrlSubstrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34.inbred61105WKY/NHsdThese animals were bought from Harlan Indianapolis, Indiana U.S.A.inbred6111213MThis is a Leprfa/Leprfa substrain derived from the Zucker rat.inbred61113BN-<I>Lx</I>These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.mutant68122RCS/NDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.inbredExtinct728195SHR/N-<i>cp</i>Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.congenicEmbryo68123RHA/NRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.inbredExtinct68124RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991).inbred68187WKHT/NFrom a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).inbredExtinct68188WKS National Institute of Genetics, Mishima, Japan.inbred68189HTX/HcjD. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30.inbred728200ACI/N-<I>di</I>Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41.congenic728358SBThis outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear.outbred728383UPL/CasUpjohn Pharmaceuticals LimitedIn 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating.inbred728384SS.LEW-(<i>D10Rat24-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic724575SS.LEW-(<i>D10Rat17-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic728385WF.COP-(<i>D2Rat2-D2M13Mit286</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenic728386SS.LEW-(<i>D10Rat119-D10Rat133</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic728387WF.COP-(<i>D2Mit29-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenic728388SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic10000ACI/NA X C 9935, IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR)inbredEmbryoTnfrsf1a62123770424AGANakic, Zagreb (Stark et al 1968b). Used for immunological studies.inbred70425AGUSGerm-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26.inbred70426ALB/NAlbanyWolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer.inbred70427AMTorres, Rio de Janeiro, from outbred stock.inbred70428AMDILTorres, Rio de Janeiro, from outbred stockinbred68028DSS/3NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct68125RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991).inbred68126RLA/NBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains.inbred68127RP Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991).inbred68128S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating.inbred68129SBHSabra hypertensiveSabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics).inbred68130SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984).inbred68131SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360)inbred68133SDJ/HokTakeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966.inbredEmbryo; SpermSlc2a2370568071LER/NOriginally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.inbredExtinct68072LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1inbred68042GEPR Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a).inbred68044GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973).inbred68046HCSHarvard to Liverpool, UK in 1960.inbred68047HMTOutbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor".inbred68048HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus.inbred68049HXB-1-43/IpcvSet of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs.recombinant_inbred68050IIMSet of nine strains bred as parallel strains from a single outbred colony in 1948. All strains were selected for large body weight and high fertility. One strain designated IIM\'a7 becomes obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987).inbred68051INR/NHarrington 1962 from a stock selected by CS Hall for low open field defaecation.inbredExtinct68052IRHarrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981).inbred68057K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973).inbred68058KGH/PitNKunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).inbredExtinct68059KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980).inbred68060KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977)inbred68061KYN/HokMakino, Hokkaido University 1960 from stock the carrying theinbredEmbryo; Sperm68062LA/Nfrom a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).inbredExtinct68063LA/N-<i>cp</i>from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).congenic68065LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993)inbred68067LEJ/HokHok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication).inbredLive Animals; Embryo; Sperm68066LEC Misima, Japan 1956 from a cross between a wild rat and Castle's black rat. To Hok in 1975 at F32 (Sasaki, personal communication).inbred68068LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980).inbredCkb235768069LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).inbred68070LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)inbred68114OXYS/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats.inbred68115P77PMCWistar rats from Beijing Medical College in 1977.inbred68116PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction.inbred68117PETH/NRoyal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS.inbred68073LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japaninbred68077LL/MavRrrcLyon hypotensiveLyon Low-Tensive. See LHinbredEmbryo; Sperm68086M520Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992).inbred68087MAXXFrom a cross of BNxLEW with subsequent inbreeding.inbred68088MFDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbred68091MLCSMilan low-calpastatin strainFrom a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity.recombinant_inbred68185WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA.inbred68186WKHA/NFrom a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.inbredExtinct61119WKY/NCrlCrljOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974.inbredLive Animals; Embryo61097WKY/NCrukNIH derived strain maintained at the Charles River, United Kingdom.inbred61117BN-<i>Lx</i>/CubBrown Norway with polydactyly-luxateArose in a colony of random bred Wistar-derived rats.mutant61118BUF/MnaStrain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.inbredLive Animals; Embryo; SpermCancer; UrologyBsis222161498BN/NHsdMcwiInbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115)inbredLive Animals; Cryopreserved61517FHL/EurFawn Hooded Low blood pressureAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damageinbred68036FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see FHH and FHL, below), which may have different characteristics.inbredRab38<sup>ru</sup>160031168038FHLsee FHH.inbred68039FHR An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbred68040FNLFice Normolipidemic strain. Developed as a control strain for FCH (see FCH).inbred68041G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977)inbred67993BIL/2University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbred68118PKDPKDOutbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991.inbred68119PSDO/NReserved symbol for strain in development now at F6 (NIH 1989).inbredExtinct68121RMuhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R.inbred68000BIRMBsame as BIRMA.inbred68001BLK/NThis strain has an agouti mutationinbredAsip200368007BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions.inbred68008BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966).inbred68011CNo further information.inbred68012CAP Polish Academy of Sciences, Krakow (Stark et al 1968a).inbred68013CAR/NHunt-Hoppert caries resistant; CA/RHunt 1937, developed for resistance to dental caries (Hunt et al 1955).inbred68014CASHunt 1937, developed for high incidence of dental caries.inbred68015CBHWoodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded).inbred68018CPB-WEWistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands.inbred68019CRDHCohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995).inbred68020CWSR Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open.inbred68022DBNo further information.inbred68023DEBR Dr. Roy F. Oliver, Dept. of Biological Sciences, University of Dundee. A possible animal model for human alopecia areata, with hair loss associated with marked peri-and intra-bulbar lymphocytic infiltrate (Michie et al 1991, Sainsbury et al, 1991, Oliver et al, 1991).inbred68026DSS/1NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct68027DSS/2NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct629513SS-Chr 4<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629514SS-Chr 6<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Sperm629515SS-Chr 7<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629516SS-Chr 8<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629517SS-Chr Y<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629518SS-Chr 9<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629519SS.BN-(<i>D13Mgh13-D13Mit4</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedcongenic629520FHH-Chr 1<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressedconsomicLive Animals; Sperm629521SS-Chr 11<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm69638BN/KaBrown Norway Katholiek (kininogen or kinin deficient)Kitasato University, Kanagawa, Japan.inbred70410AAAlko-acceptingWistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure.inbred70411ANAAlko-nonacceptingWistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure.inbred70413WBBinbred68029DXE -1-?Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover)recombinant_inbred68031ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).inbred68032EXBHHannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990)inbred68034F6RMutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985).inbred68035FCHFice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol.inbred68134SDNKSprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan.inbred68136SELDunning 1948. Probably extinct.inbred68140SPRD/HsdOriginated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony.outbred68143TAOutbred Wistar Imamichi.inbred68144TEOutbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987).inbred68145TFFrom outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988).inbred68146THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990).inbred68147THE/UtpTsukuba high-emotional ratWistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE).inbredEmbryo; SpermBehavior68148TLE/UtpTsukuba low-emotional ratWistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE).inbredEmbryoBehavior68149TMTester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication).inbred68150TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68151TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68152TO/HokTokyo ratA breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994).inbredEmbryo; Sperm68154TOM Toma Institute, Japan (Ikadai, personal communication, 1991)inbred68155TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).inbred68156TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68157TS3/NHarrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbredExtinct68158TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991).inbred68160TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991)inbred68161TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985).inbred728135SS.LEW-(<I>D5Uwm14-D5Uwm31</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenic631275WKY/CfdWKY/CfdSubstrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA)inbred728137SS.LEW-(<I>D10Rat141-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenic728138SS.MNS-(<I>Mme-Gca</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitivecongenicAtp1a12167629501SD-Tg(Ren2)27This is a hypertensive rat strain, the mouse Ren2 renin gene along with its 5and 3 flanking sequence is microinjected into fertilized eggs from Hannover Sprague-Dawley (SD) background.transgenicAgtr1b|Ace2071|2493629502SHR.BN-(<i>Il6-Npy</i>)This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotescongenic629503SHR.BN-(<i>D19Rat57-D19Mit7</i>)/IpcvThe segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating.congenicAgt20692299122F344-Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantTasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>229910170429AOFrom ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995).inbred70440BIRMAAM Mandl 1952 from Albino rats purchased from Birmingham market.inbred68074LETOA rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan.inbred70446LH/LacLiverpool Hooded"Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981).inbred70447MNRMaudsely non-reactivePL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982).inbred70448MNRASubstrain of MNR. To Harrington in 1965 at F25 (Harrington 1981).inbred70449MR/NMaudsely reactiveOrigin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).inbred70450NBRPoiley 1966 from heterogeneous stockinbred70451OKAFrom faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days.inbred68162TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991)inbred68163U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990).inbred68164UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.inbred68165UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.inbred68166W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977).inbred68167W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany.inbred68168WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983.inbred68169WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977).inbred68171WBB/1NNo further informationinbredExtinct68172WBB/2NNo further information.inbredExtinct68173WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived.inbred68174WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot.inbred68175WDFIkeda et al (1981) by backcrossing the fatty gene (\i fa\i0 ) to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus.inbred68176WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbred68177WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbred68178WELSOutbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984)inbred68180WINWI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986).inbred68183WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992)inbred68184WKAH/HokWistar-King Aptekman HokkaidoKing 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA.inbredEmbryo724570LEW/RkbThe LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany.inbred69369SSRapp from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in dientifying the loci responsible for salt-induced hypertension.inbred69643F344/DuCrlCrljThis strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976.inbredLive AnimalsNeurobiology; Cardio Hypertension67981BDVsee BDIinbred67983BDVIsee BDI.inbred67984BDVIISee BDI, Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976)inbred67986BDVIIIsee BDI.inbred67987BDXsee BDIinbredLypd36905367988BEGfrom a cross between SC and TE.inbred67989BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973.inbred67990BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992)inbred67991BIL/1University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbred631592WKY.SHR-(<i>D1Rat236-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>D1Wox19-D1Mit2</i>) to WKYcongenic631593LEW/RjStrain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).inbred631596LEW.1AV1.DA-(<i>D10Rat92-D10Wox17</i>)/UbcCongenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2.congenic631597LEW.1AV1.DA-(<i>D10Wox17-D10Rat135</i>)/UbcCongenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2congenic631598LEW.1AV1.DA-(<i>D10Got154-D10Rat135</i>)/UbcCongenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2congenic631599SHRSP/IzmStrain has been maintained at Kyoto University.inbredLiving AnimalsCardio Hypertension; Neurobiology631602BN/ElhThese rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony.inbred631603WKY/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.inbred631604SHR/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.inbred631605SS.LEW-(<i>D10Arb9-D10Got101</i>)/JrCongenic strain originated from an inbred SS/Jr strain.congenic631606SS.MNS-(<i>D10Rat13-D10Mit11</i>)/JrCongenic strain originated from an inbred SS/Jr strain.congenic631610SS.LEW-(<i>D1Rat39-D1Rat131</i>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.congenic631691SHRSP/A3IzmSubstrain originates from the SHRSP/Izm strain.inbred631693WKY.SHRSP-(<i>Shbg-Atp1b2</i>)/BbbThis strain has the blood pressure locus from chr 10congenic631696SHR/FubRkbStrain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin.inbred631699BB.SHR-(<i>D6Rat184-D6Rat101</i>)/KCongenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females.congenic631703SS.LEW-(<i>D10Rat207-D10Mgh1</i>)/AydCongenic strain originated from an inbred SS straincongenic631844HAD1high-alcohol-drinkingThese high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.inbred631845LAD1low-alcohol-drinkingThese low-alcohol-drinking were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.inbred631847F344.GK-(<i>D1Mit7-D1Mgh25</i>)/SweCongenic strain originated from an inbred F344 straincongenic728190RCS-<I>rdy-c</I>Albino retinal dystrophyThis congenic strain is obtained from pink-eyed, tan-hooded RCS ratscongenic728191LOU/CNTo N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)inbredExtinct728192RCS-rdy-pThis congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks.congenic728193N:SDSprague-DawleyTo N 1945 from Sprague Dawley, Inc. Colony closed since then.outbredExtinct629522SS-Chr 20<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629523SS-Chr 13<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Embryo; Sperm629524SS-Chr 16<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Sperm629525SS-Chr 18<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm61499SS/JrHsdMcwiInbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115).inbredLive Animals; Cryopreserved629509FHH/EurMcwiAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbredLive Animals; Cryopreserved629510SS.BN-(<i>D12Arb13-D12Rat79</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedcongenicLive Animals629511SS-Chr 2<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm629512FHH-Chr 12<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressedconsomicSperm728155BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/1RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenic737858DA.PVG.1AV1-(<i>D4Rat155-Spr</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenic737859DA.PVG.1AV1-(<i>D4Mgh17-D4Rat56</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenic737862SHRSP.WKY-(<i>D2Rat14-D2Mit5</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.congenic737863SHRSP.WKY-(<i>D2Wox9-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSPcongenicGstm12755737864SS.SR-(<i>D13Mit9-D13Mit1</i>)/JrCongenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain.congenic737866WKY.SHRSP-(<I>D2Rat14-D2Mit5</I>)A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKYcongenic737867SS.SR-(<I>D13N1-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient straincongenic737868SS.SR-(<I>Syt2-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient straincongenic737869OLETF.BN-(<I>D1Rat461-D1Rat459</I>)/GotFemale OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study.congenic737873DA.E3-(<i>D6Wox5-D6Rat90</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenic737889LEW/IpcvThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlandsinbred737891Crl:SDSprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory.outbred737893F344/ZtmSubstrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannoverinbred737895WKY/ZtmSubstrain of WKY rats maintained by Dr. H.J. Hedrich, Hannoverinbred737896BN/MaasSubstrain of BN rats, maintained by Dr. Alex Maas, The Netherlandsinbred737901LH/ZtuA substrain of LHinbred737907SS.SR-<i>Inha</i>/JrA chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient straincongenic737911BUF/ZtmSubstrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germanyinbred737912SS/JrIpcvstrain originated from Dr. John P. Rapp, Medical College of Ohio, USAinbred737913E3/ZtmSubstrain of E3, from Dr. H.J. Hedrich, Hannover, Germanyinbred737917WF/MolSubstrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmarkinbred737918BN/OrlSubstrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, Franceinbred634367BN/CrlCrlj1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced.inbredLive Animals; EmbryoOphthalmology; Immunology634374E3/ZtmRhdE3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.inbred634376LEA/NcuThese rats were established from a closed colony of Long-Evans.inbred634377BN/SeaBN/SeaThis inbred strain was obtained from Sea life Supplyinbred10022LN/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbred724569MWF/FubRkbMunich Wistar FromterThe MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm).inbred724571MITE/MnaThis strain was established from captured Japanese wild rats.inbred724573SS/JrMcoDahl salt-sensitive (SS/Jr) ratsIn the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet.inbred724576KDP/TkyKomeda diabetes-prone ratThis is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross.inbredLive Animals; EmbryoDiabetes Obesity; ImmunologyCblb620535728133BN-<I>RT1<SUP>n</SUP></I>/RjThis coisogenic strain was produced by selecting BN rats with the <I>RT1<SUP>n</SUP></I> allele.coisogenic728134SS.LEW-(<I>D1Rat35-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenic728148SS.LEW-(<I>D16Uia2-D16Rat12</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenic728151UPL/NccThe UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony.inbred728152SS.LEW-(<I>D1Rat196-D1Mgh7</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenic728153SS.LEW-(<I>D1Rat196-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenic628486NER/KyoNoda epileptic rat, GMSOriginated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan.inbredLive Animals; Embryo; SpermNeurobiology628525Ni/HinFound in the Sprague-Dawley in Japan. In these the Tsc2 gene is not mutated.inbred628907SHR.BN-RT1<sup>n</sup>This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR.congenic629484LEW-<i>tl</i>The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N.congenicCsf1621063629485LE/StmThe LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.inbredLiving Animals; SpermDiabetes Obesity; Cancer629486PVG/OlaHsdblack hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992inbred629487SHR.WKY-(<i>D1Wox19-D1Wox34</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRcongenic629488SI-Tg(Ednrb)1Ywatransgenic spotting lethalA 5.8 kb fragment of the dopamine-beta-hydroxylase (DbH) promoter used directs Endrb expression in the transgenic Sl/+ animals.transgenic629489Eker-Tg(Tsc2)5HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.transgenicTsc23908629490DA.F344-Aia1/1genomic segments with region of interest from chr 20 were inserted to DA straincongenic629491DA.F344-Aia1/2genomic segments with region of interest from chr 4 were inserted to DA straincongenic629492SlNatural mutation in the progeny of a Wistar-Imamichi female and a wild rat.mutantEdnrb2536629493DA.F344-Aia1/3genomic segments with region of interest from chr 4 were inserted to DA straincongenic629494DA.F344-Aia1/4genomic segments with region of interest from chr 10 were inserted to DA straincongenic629495WKY.SHRSP-(<i>Mt1pa-D1Rat57</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYcongenic629496W-<I>Aspa</I><sup>tmKyo</sup>Strain originated spontaneously in July 1985 from a colony of W/Crj rats.mutantAspa621693629497SDT/CrljJclSD rats were purchased from Charles River Japan and then bred at Torii Pharmaceutical company Japan. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997.inbred629499BXS/IpcvThese recombinant inbred strains are obtained by crossing normotensive BN-<i>Lx</i>/Cub with hypertensive SHR/Ola progenitor strains.recombinant_inbred629500LEXF/StmRecombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating.recombinant_inbred631163LE/BluGillThis inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock.inbred631182DA/BklArbNThis is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.inbredExtinct631220SS.LEW-(<i>D10Mco1-D10Mco31</i>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenic629504WKY.SHR-(<i>D1Mit3-D1Rat57</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenic629505SS.MNS-(<i>D10Mit11-D10M11Mit119</i>)/Mcofragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jrcongenic629506LEW-<i>tl</i>.BN-(<i>D2Arb16-D2Wox8</i>)LEW.<i>tl</i> carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2.congenicCsf1621063728162SS.LEW-(<I>D1Mco87-D1Rat71</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.congenic728163SS.LEW-(<I>D1Uia2-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenic728165SS.LEW-(<I>D1Rat196-D1Mco36</I>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.congenic728166WKY.SHRSP-(<I>D1Rat112-D1Wox29</I>)/IzmA segment from SHRSP/Izm was transferred on a WKY/Izm backgroundcongenic728167SS.LEW-(<I>Nos2-D10M11Mit119</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenic728168WOKThe inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germanyinbred728170SS.MNS-(<I>Mme-D2Mit14</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S straincongenicAtp1a12167728171LEW-<I>RT1<SUP>1</SUP></I>/RjThis coisogenic strain was produced by selecting LEW rats with the <I>RT1<SUP>1</SUP></I> allele.coisogenic728172SS.MNS-(<I>D2Mit6-Adh1</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNScongenicAgtr1b|Atp1a12071|2167728183WF/NTo N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia.inbred728185N:NIHDeveloped in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony.outbredExtinct728186LEW/SsNTo N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.inbredExtinct728189SHR/N-<I>di</I>Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.congenic70416ACHCurtiss and Dunning 1926 at Columbia University Institute for Cancer Research.inbred70417A28807/NCurtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982).inbredExtinct70418A35322Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990.inbred70419A7322Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus.inbred70420A990Curtiss 1921 at Columbia University Institute for Cancer Research.inbred70421AAWAtomic Energy Commission, Melbourne (Adams et al 1984).inbred70422ABHYamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan.inbred70423ACPDunning to National Cancer Institute 1967 at F54.inbred625624Eker-Tsc2/HinEker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.mutantTsc23908625659DRH/SeacEstablished by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3inbredLive Animals; Embryo; SpermCancer628372ACI.FHH-(<i>D1Mit34-D1Rat156</i>)The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI.congenic631278SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background.congenicGstm1|Vcam1|S1pr12755|3952|61958631285IER/IhrA mutant rat strain which is a useful model for human cataract.inbredLiving AnimalsNeurobiology; Ophthalmology631161DXE3/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.recombinant_inbred1357172WF.BBDR-(<i>D4Arb29-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1357173SS.MNS-(<i>Vamp2-D10M11Mit84</i>)/McoThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenic70452OMOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).outbred68137SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile.inbredAdrbk1|Adrbk22062|206370453SRRapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen.inbred1299874OLETF.F344-(<i>D1Rat166-D1Rat90</i>)/TjFemale OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol.congenicEmbryoDiabetes Obesity1299875DA.F344-(<i>D7Rat22-D7Mit2</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies1299876SS.LEW-(<I>D5Rat54-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenic631590SHR.WKY-(<i>D1Wox34-Sah</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRcongenic1299877DA.F344-(<I>D10Rat204-D10Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenic1299878DA.F344-(<I>D4Arb30-D4Arb4</I>)/ArbThe DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawleycongenic1299879SS.SR-(<I>D7Mco7-D7Wox19</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic1299880F344.DA-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenic631589SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRcongenic1299881SS.LEW-(<I>D5Wox3-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenic1300432HAA/FDSCHatano High AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation.inbredEmbryo; SpermBehavior734758DA/HamDark-agoutiOriginal DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).inbred734759SHRSP/GcrcSpontaneously hypertensive rat, stroke proneSHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHinbred631573SBN/YglSabra hypertension resistantBred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.inbred734760WKY/GcrcWistar-KyotoWKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHinbred734761WF/KgaWistar-FurthObtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan).inbred631280WKY.SHRSP-(<I>D2Mit5-D2Mgh12</I>)/GcrcCongenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenic631572SBH/YglSabra hypertension proneBred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.inbred70454WKY/NNational Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain.inbredEmbryo70455WKYO/KyoInbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991).inbredEmbryo; Sperm70456WMWistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Misima in 1951.inbred70457WMSMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWFinbred70459ZDFVancouver diabetic fatty Zucker"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b).inbred70508SDSprague-DawleyThis strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain probably Wistar) and subsequently to his white female offsprings for 7 generations. All the current colonies are from this original stock.outbredAqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f12141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|72889270509F344/NRrrcCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.inbredSpermCdkn2a|Gfap|Tnfrsf1a2323|2679|621237728139WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>)/BbbThis double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(<I>Shbg-Atp1b2</I>) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(<I>Shbg-Atp1b2</I>) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLscongenic728140SS.LEW-(<I>D10Rat11-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenic728142BN.SHR-(<i>Il6-Cd36</i>)/CubThis congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR.congenic728143SS.LEW-(<I>D1Mco38-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenic728144BN.PD-(<I>D8Rat39-D8Rat35</I>)/CubThis congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM.congenic728145SS.LEW-(<I>D5Rat130-D5Rat108</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenic728146F344.BN-(<I>D3Mgh13-D3Mgh7</I>)/DlwThis congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USAcongenic631276WKHA/CfdWKHA/CfdOriginated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)inbred728147BN.PD-(<I>D8Rat39-D8Rat35</I>),SHR-(<I>D4Mgh2-Cd36</I>),SHR-(<I>D20Wox3-D20Mgh5</I>)/CubThis is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM.congenic1302676NER/Slcnoda epileptic ratStrain is from Japan SLC, Inc. Shizuoka, Japan.mutantLiving AnimalsNeurobiology737905LEW/MaasStrain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers.inbred1302677NIG-III/TjStrain is from the University of Tokushima, Japan.inbredEmbryo1302678NAR/Slcnon albumin ratStrain originated from Japan SLC, Inc, Shizuoka, Japan.mutantLiving AnimalsHematology737921BDIV/lfzSubstrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971)inbred737924WAG/RijSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979inbred737925BN/GroSubstrain of BN, from Billingham and Silvers 1958, to U of Groningeninbred737870DA.E3-(<i>D20Wox3-D20Mgh4</i>)/RhdA fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA.congenic737871DA.E3-(<i>D12Got46-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenic737872DA.E3-(<i>D4Mit16-D4Mgh11</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenic737927ALC/ColleSubstrain of ALCinbred737931GC/Kuninbred737933SD/ASprague-Dawley stock initiated by R. Dawley in 1925inbred737934BN/RijKunSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic Universityinbred737935LEW/NhgSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germanyinbred737937SDH/Ztuunknowninbred737939BBWB/Molunknowninbred737940PAR/Wslunknowninbred737861DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenic737944BN/RijNSubstrain of BN, from Billingham and Silvers 1958, from Harlan RijnswijkinbredExtinct737949A2/Colleunknowninbred737950DA/ZtmSubstrain of DA/OlaHsd, to Hannover after 1965inbred737951CAP/Kuvunknowninbred737952ACI/Ztmunknowninbred737955Hooded/Colleunknowninbred737857DA.PVG.1AV1-(<i>D4Rat155-D4Rat84</i>)Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenic737959RNU/Molunknowninbred737964BN/OlaHsdSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolisinbred737966LEW/KuvSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germanyinbred737969NAR/SaUnon-albumin ratSubstrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrechtinbred737970AMORAT/Wslunknowninbred737972BN/CrlSilvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976.inbred738120LEW-Tg(HLA-B*2705m1,B2M)133-1TrgThis strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating.transgenicEmbryo; Sperm728156SS.LEW-(<I>D5Mco34-D5Mco10</I>)/JrSS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenic728157SS.LEW-(<I>D5Rat130-D5Mit19</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS straincongenic728158SS.LEW-(<I>D5Uia4-D5Mco10</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS straincongenic728159SS.LEW-(<I>D1Mco36-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.congenic728161PD/CubpolydactylousStrain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome.inbred728194SHR/NTo N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.inbredExtinct728197RCS-rdy-+This congenic strain is obtained from pink-eyed, tan-hooded RCS ratscongenic61115BN/SsNTo N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.inbred728198BHE/NBureau of Home EconomicsTo N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.inbred631576LEW/CrlCrljDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34.inbredLive Animals; EmbryoImmunology; Osteosis728394SS.LEW-(<i>D10Rat55-D10Rat13</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic631694WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)/BbbThis single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)congenic728395SS.LEW-(<i>D10Rat55-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic724577SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic728396SS.LEW-(<i>D10Mco15-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic731186SHR/FubSpontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germanyinbred731191SHRSP.WKY-(<i>D2Rat14-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.congenic731193DA.PVG-(<i>D4Rat141-D4Mgh11</i>)PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies.congenic731194SS.LEW-(<i>D3Chm64-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Aydcongenic631281WKY.SHRSP-(<I>Fst-Pklr</I>)/GcrcCongenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenic1299870SS.LEW-(<I>D5Uia8-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenic1299871DA.F344-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenic1299872DA.F344-(<I>D8Arb15-D8Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenic629548SHR.BN-(<i>D1Mit3-Igf2</i>)/1lpcvSHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv.congenic629578SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generationscongenic631158DXE1/ZtmDXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.recombinant_inbred631160DXE2/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han ratsrecombinant_inbred631695SS/JrRkbThis inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlininbred631846F344.GK-(<i>D1Mgh10-D1Rat90</i>)/SweCongenic strain originated from an inbred F344/Mcwi straincongenic631574Wild/KWild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.wild631700BB.SHR-(<i>Gnal-D18Mit9</i>)/KDiabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long.congenic631294F344.GK-(<I>D1Arb42a-D1Rat90</I>)/SweThis congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 backgroundcongenic631587SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicAce2493731188LAD2low-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.inbred634380Palcohol-preferringThese were developed at Indiana University for high-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.inbredNpy3197634381NPalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.inbredNpy3197631697BBDP/HriThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977.inbred631594BN/RjStrain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).inbred1302669HAAHatano High AvoidanceStrain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan.inbred1302691ALB/HokAlbanyAlbany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok)inbredLive Animals; EmbryoDentistry1302692WKY.SHRSP-(<I>D1Wox18-D1Rat44</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302693KZ-<I>Lepr</I><sup>faTky</sup>A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980.segregating_inbredLive Animals; Embryo; SpermDiabetes Obesity; MetabolismLepr30011302694WKA/SeacWistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979inbredLive Animals; Embryo; SpermImmunology1302696FH/HamSlcfawn hooded ratStrain originated at Japan SLC, Inc., Shizuoka , Japan.mutantLiving AnimalsCardio Hypertension1302697KND/Tkykomeda non-diabetic ratKomeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls.inbredLive Animals; EmbryoDiabetes Obesity1302698SDR/SlcSpontaneous dwarf ratStrain is from Japan SLC, Inc., Shizuoka, Japan.mutantEmbryo; SpermMetabolism1302699LEXF8D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer728187ACI/N-jStrain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.congenicExtinct737892ACI/SegHsdThis substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc.inbred731185MWF/FubMunich Wistar FromterMunich Wistar Fromter rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germanyinbred737897ACI/KunSubstrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlandsinbred1331814BN.GK-(<i>D8Got302-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic634373DA/ZtmRhdDA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.inbred1331815LEW/MolLEW/MolThis inbred strain originated from a LEW strain bred at the Mollegaard Breeding Center Ltd., DenmarkinbredNcf161307737899BN/CubRecombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlandsinbred1331816DA.ACI-(<i>D10Rat2-D10Rat29</i>)/Kini(DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA.congenicSpermNeurobiology; Immunology1331817BN.LEW-(<i>D10Rat32-D10Mgh4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenic737909R/ASubstrain of R, from Wistar stock in 1947, to The Netherlands Cancer Instituteinbred737910ARISTORAT/WslSubstrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgiuminbred737922LEW/SsNHsdSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to National Institutes of Healthinbred737926F344/NCrlDerived from NIH stock in 1992 by SASCO. To Charles River in 1996.inbred1300433LAA/FDSCHatano Low AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation.inbredEmbryo; SpermBehavior738122SD-Tg(GFP)1BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals.transgenicEmbryo; Sperm1299873SS.LEW-(<I>D5Mco34-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenic1304487BBDR/WorThese are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM.inbred737886BDX/CubRecombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlandsinbred1331811LEW.BN-(<i>D10Rat32-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic1331812LEW.BN-(<i>D10Rat83-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic631595LEW.1AV1.DA-(<i>D10Rat92-D10Rat135</i>)/UbcLEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain.congenic737904U/ASubstrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Instituteinbred737902BDIX/OrlSubstrain of BDIX, now maintained in Orleans, Franceinbred737908WF/NHsdSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley.inbred634363LEW/NIcoCrlfA substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.inbred737947BDII/ZtmSubstrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971)inbred737953LEW/GutSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germanyinbred737958CHOC/Cubunknowninbred1331813BN.GK-(<i>D8Rat29-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic634364SHR/NIcoCrlfA substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.inbred1302795HTGPrague hypertriglyceridemicThese were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding.inbred1558662SHR/TkyoSubstrain of SHR rats maintained at International Medical Center of Japan, Tokyoinbred737962SPRD/ZtmSubstrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976inbred1331832BN.LEW-(<i>D10Rat72-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenic1302620SHR/Kyospontaneously hypertension ratOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).mutantLive Animals; Embryo; SpermCardio Hypertension1302621LEXF10A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302700HOB/Snkhobble ratHOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13.mutantEmbryo; SpermNeurobiologyUnc5c7351091302701LEW/SsNSlcStrain is from Japan SLC, Inc.,Shizuoka, Japan.inbredLiving AnimalsImmunology634372GHSSD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain.inbred1302703WKY.SHRSP-(<I>D1Wox29-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension634369WBN/KobSlcwistar bonn/koboriThis strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1.inbredLiving AnimalsDiabetes Obesity; Ophthalmology1302670ACI/NSlcStrain is from Japan SLC, Inc., Shizuoka, Japan.inbredLiving Animals1302671WM/TjStrain is from the University of Tokushima, Japan.inbredEmbryo; Sperm1302672W/KyoHok>Hkm>KyoinbredLive Animals; Embryo; Sperm1302673FXLE15/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302674VF/Kyovacuole formation ratDerived by a spontanious mutation from TRM (F26). Trm deletion was subsequently replaced by inbreeeding.mutantEmbryo; SpermNeurobiology1302675WKY.SHRSP-(<I>D1Smu13-D1Smu11</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302653LEXF8A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302726ZI/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo.mutantLive Animals; Embryo; SpermNeurobiologyAtrn690631302727SHRSR/TaStrain is from Takeda Chemical Industries, Ltd., Osaka, Japan.mutantEmbryo; SpermCardio Hypertension1302728MES/SlcMatsumoto Eosinophilia ShinshuDerived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999)mutantLiving AnimalsHematology634366SR/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.inbred1302729LEA/TjFound in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989inbredLive Animals; EmbryoCancer734480SS.LEW-(<i>D10Mit10-D10Mgh1</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenic734481SS.LEW-(<i>D1Mco2-D1Mco35</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background.congenicSa3616734482SS.LEW-(<i>D1Rat45-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.congenicSa3616734483SS.LEW-(<i>D1Rat42-D1Wox10</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.congenic734526OLETF/GotOtsuka Long Evans TokushimaLong Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating.inbred734527OLETF.F344-(<i>D1Rat169-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.congenic1300439SD-Tg(GFP)2BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21.transgenicLive Animals; Embryo; Sperm1302654F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred.congenicEmbryoDiabetes Obesity631577SHR/IzmStrain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).inbredLiving AnimalsCardio Hypertension1302655TO/HkmStrain originated from the Graduate School of Medicine, Hokkaido University, Japan.inbredEmbryo1302656LEA/HokLong Evans AgoutiLong Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes). Kobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982.inbredEmbryo1302657DOP/Nemdilute-opisthotonus (dop)Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established.segregating_inbredEmbryo; SpermNeurobiologyMyo5a31431302658LEJ/HkmStrain originated at the Graduate School of Medicine, Hokkaido University, Japan.inbredLive Animals1302659CXH5/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredEmbryoMetabolism; Immunology1302660RCS/Kyoroyal college of surgeons ratFrom Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998.mutantLive Animals; Embryo; SpermOphthalmologyMertk692831302661F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred.congenicEmbryoDiabetes Obesity1302662CXH2/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredEmbryoMetabolism; Immunology1302664WNA/NshmNagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal ResearchinbredEmbryo; Sperm1302665FXLE13/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302666LEXF1C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302668IS-<I>Tlk</I>/Kyotail anomaly lethal kyotoSpontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto)coisogenicEmbryo; SpermOsteosis61114DA/BklCommercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls.inbred631585SS.LEW-(<I>D16Mit2-D16Rat12</I>)/AydThis congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr backgroundcongenic631219SDT/JclEstablished from an outbred colony of Sprague-Dawley in Torii Pharmaceutical Co. Ltd.This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating.inbred61107BB/OKBioBreeding ratThis colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada.inbredSpermDiabetes Obesity; ImmunologyAsns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk52162|2280|2332|2481|2794|3082|3726|3807|69430|70514631283DA.F344-(<I>D10Arb21-D10Arb22</I>)/ArbThis congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.congenic631848SHR/OlaIpcvThese are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years.inbred631282DA.F344-(<I>D10Arb20-D10Arb22</I>)/ArbThis speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.congenic634359WF.WKY-(<i>D5Pas1-D5Uwm37</i>)/UwmWKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region.congenic631579LEW/OlaHsdObtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands.inbred1302679TRMR/Kyotremor resistantTremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982.segregating_inbredAspa6216931302680SHR/TaStrain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan.mutantEmbryo; SpermCardio Hypertension1302681WKY.SHRSP-(<I>D1Smu11-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302683FXLE22/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1357183SS.MNS-(<i>D10Mco10-Aldoc</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenic1302684F344/NHokDwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animalsinbred1302685F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment.congenicEmbryoDiabetes Obesity1302686F344/StmDerived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating.inbredLive Animals; Embryo; SpermDiabetes Obesity; Cancer1302687WKAH/HkmSlcWistar King A, HokkaidoStrain originated from Japan SLC, Inc., Shizuoka, Japan.inbredLiving Animals1302688ACI/NMnaThis strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan.inbredLive Animals; Embryo; Sperm634365SS/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.inbred1302689WKY.SHRSP-(<I>Ntrk3-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302377SPRD-<i>Anks6</i>/RrrcFrom outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002.mutantEmbryo; SpermAnks63334631591WKY.SHR-(<i>D1Rat56-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>DWox19-D1Mit2</i>) to WKYcongenic1299868SS.SR-(<I>D7Uia1-D7Mco7</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic1299869SS.SR-(<I>Cyp11b1</I>)/JrCongenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient straincongenic1357191CDS/YglCohen diabetic-sensitive ratCohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.inbred1357192WF.BBDR-(<i>D4Got39-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1357193WF.BBDR-(<i>D4Got51-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic737960Hsd:WIWistarThese are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan.outbred1303393LEC/NcuThese rats were established from a closed colony of Long-Evans.inbred737968BN/GutSubstrain of BN, from Billingham and Silvers 1958inbred737971SHRSP/Rivmunknowninbred737888LEW/NHsdCpbThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlandsinbred631286WKY/IzmWistar-KyotoWKY strain from the Izumo colonyinbredLiving Animals631279SHRSP.WKY-(<I>D2Rat13-D2Mit5</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenic737658PVG.1AV1Piebald-Viral-GlaxoOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germanycongenic737690F344/CrliThese animals were from Charles River Italia, Calco, LC, Italyinbred737691BN/CrliThese animals were from Charles River Italia, Calco, LC, Italyinbred737703LEW-Tg(HLA-B*0702,B2M)120-4TrgLewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity.transgenicEmbryo; Sperm734471SS.LEW-(<i>D1Mgh7-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background.congenic734472SS.LEW-(<i>D1Mco2-D1Wox6</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background.congenic734473SS.LEW-(<i>D17Mco3-D17Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenic734474SS.LEW-(<i>D5Mit9-D5Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenic734475DA/OlaHsdOdell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965.inbred734476Crl:CD(SD)Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system.outbred734478F344/DuCrlThis colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960.inbred734479SS.LEW-(<i>D1Mco2-D1Rat49</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background.congenic737865WKY.SHRSP-(<i>D2Rat14-D2Mgh12</i>)A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY.congenic631578SHR.BN-(<I>D2Rat171-D2Arb24</I>)/IpcvThis congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv backgroundcongenic731187HAD2high-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.inbred1302601FXLE23/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302603FXLE25/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302604LEXF4/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302605LEXF2A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1302606SHRSP/TaThis strain originated from Takeda Chemical Industries, Ltd., JapanmutantEmbryo; SpermCardio Hypertension1302608CXH6/TjStrain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japanrecombinant_inbredEmbryoMetabolism; Immunology1302610KMI/Tkyminiature rat ishikawaMiniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College.segregating_inbredLive Animals; Embryo; SpermOsteosisPrkg234011302611FXLE24/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302612LEXF10C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302372SDDIO/RrrcThis strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet.inbredEmbryo; Sperm1302373SDDR/RrrcThis strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet.inbredEmbryo; Sperm1302613BN/fMaiHokKyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21inbredLive Animals; Embryo1302614WKY/NMnaInbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain.inbredLive Animals; Embryo; Sperm1302615FXLE14/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302616LEXF10B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302617LEXF6B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302618LEXF9/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredLive Animals; EmbryoDiabetes Obesity; Cancer1302619FXLE16/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1358304SD-Tg(S334ter)5LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenic1358305SD-Tg(S334ter)7LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenic1358306SD-Tg(S334ter)9LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenic1547865FHH-Chr 3<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 3 introgressed.consomicLive Animals; Embryo; Sperm1547866F344/JclInbred strain originated from F344inbred1547867FHH-Chr 4<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 4 introgressed.consomicSperm1547868FHH-Chr 2<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 2 introgressed.consomicSperm1547869ACI/EurAugust x Copenhagen IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIHinbred1547870FHH-Chr 14<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 14 introgressed.consomicLive Animals1547871ACI.FHH-(<i>D1Rat324-D1Rat156</i>)/EurCongenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains.congenic1547872FHH-Chr X<sup>BN</sup>/McwiFHH-Chr X<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome X introgressed.consomicSperm1547873FHH-Chr 15<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 15 introgressed.consomicSperm1547874FHH-Chr Y<sup>BN</sup>/McwiFHH-Chr Y<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome Y introgressed.consomicSperm737920BH/ZtmSubstrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973inbred61116SHRSP/A3Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness.inbred1331826LEW.BN-(<i>D10Mgh7-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic61099HXB/IpcvDerived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published.recombinant_inbred1331827DA.ACI-(<i>D10Rat10-D10Rat142</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenic1331828DA.ACI-(<i>D10Rat12-D10Rat144</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenic737930LEW/ZtmLEW/ZtmThis inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, GermanyinbredNcf161307634382SHR.BN-(<i>D5Wox12-D5Wox20</i>)/IpcvThis congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv backgroundcongenic1302622WF/KopInbred originated from Kagoshima University, Japan.inbredLive Animals; Embryo; SpermCancer1302623TM/Kyotester moriyama ratTester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 .mutantLive Animals; Embryo; SpermHematologyRab38<sup>ru</sup>16003111302624RICO/NgsStrain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan.inbredEmbryo; SpermCardio Hypertension; Ophthalmology1302626BN.UPL-(<I>D2Rat134-D2Rat2</I>)/CasStrain originated from Hiroshima University, JapancongenicSpermOphthalmology1302627F344/NSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.inbredLiving Animals1302629WKY.SHRSP-(<I>D1Rat49-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302630F344.OLETF-(<I>D10Wox7-D10Wox6</I>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.congenicEmbryoDiabetes Obesity1302631BN/SsNSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.inbredSpermImmunology1302632WKY.SHRSP-(<I>D1Smu11-D1Arb21</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302633FXLE20/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302634BB/WorTkyBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983.inbredEmbryoDiabetes Obesity; Immunology1302635F344.OLETF-(<i>D12Rat8-D12Rat16</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1302636WKY.SHRSP-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm backgroundcongenicEmbryoCardio Hypertension1302637LAAHatano Low AvoidanceStrain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japaninbred1302638LEXF11/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302639KHR/Kyokaken hairless ratKaken hairless rat were detected by Kimura from GunnmutantLive Animals; Embryo; SpermDermatologyOca223184121302640ACI/TjStrain originated from The University of Tokushima, Tokushima, Japan.inbredEmbryo1302641LEXF1A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302642LEA/HkmStrain originated at the University of Tokushima, Japan.inbredLive Animals; Embryo1302643ACI/NKyoaugust copenhagen irishNIH (1988, F143) > Kyo (F43)inbredLive Animals; Embryo; SpermReproduction1302644CXA5/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredEmbryoMetabolism; Immunology1302645DMY/Kyodemyelination ratFrom a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996).mutantLive Animals; Embryo; SpermNeurobiology1302646LEXF2C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302647F344.OLETF-(<i>D5Rat166-D5Rat90</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1302648LEC/HokLong Evans CinnamonKobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F20mutantEmbryoCancer; ImmunologyAtp7b21801302649LEXF7B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302650F344.OLETF-(<i>D9Mgh8-D9Rat15</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1302651CXA1/TjStrain originated from the The University of Tokushima, Japan.recombinant_inbredEmbryoMetabolism; Immunology1302652LEXF7A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer10016GH/OmrGenetically HypertensiveThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations.inbred1357417SD-Tg(Npy)400Mcwi14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene.transgenic1358112WKY/NCrlOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11inbred1358918W-<i>Plp1</i><sup>mdNya</sup>W-<i>Plp1</i><sup>md</sup>Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders.mutantPlp133541358919F344/SeacInbred strain originated from F344 ratsinbred737948BDE/ZtmSubstrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color.inbred1331833DA.ACI-(<i>D10Rat15-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenic1331834BN.LEW-(<i>D10Rat100-D10Rat126</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenic737954AS/Ztmunknowninbred738038HEPhigh ethanol preferringHigh ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USAinbred1331836WKY/EerWKY/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indianainbred1354669BN/OrlIcoCrlfStrain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991.inbred1354670F344/IcoCrlfThese are inbred rats that were bought from Charles River, Les Oncins near Lyon, France.inbred1357174BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwThe lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breedingcongenic1357175F344.DR-(<i>D4Mit6-D4Mit24</i>)-Tg(Gimap5)McwiWild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(<i>D4Mit6-D4Mit24</i>)transgenic1357176WF.BBDR-(<i>D4Arb29-D4Rat96</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1357177F344.DR(DP)-(<i>D4Mit6-D4Mit24</i>)/RhwThe lymphopenia locus from BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding.congenicEmbryo1357178CDCohen diabetic ratOriginally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism.inbred1357179SS.WKY-(<i>D2N35-Mme</i>),MNS-(<i>D10Mit11-D10M11Mit119</i>)/McoSS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F<sub>1</sub> were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister matingcongenic1558661WKY/TkyoSubstrain of WKY rats maintained at International Medical Center of Japan, Tokyoinbred731189SHRSP.WKY-(<i>Klk1-D1Rat116</i>)/IzmA segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method.congenic1357180SS.LEW-(<I>D8Chm14-D8Rat16</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canadacongenic1357181CDR/YglCohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.inbred1357182Eker-Tg(Tsc2)28HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.transgenicTsc23908631586SS.MNS-(<I>D10Mco14-D10Mit11</I>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenic1357184Crl:ZUC-<I>Lepr</I><sup>fa</sup>Zucker ratsThe obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company.outbred1357185RHA.Gunn-<i>Ugt1a1</i><sup>j</sup>/NRHA/N rats were crossed with Gunn rats. F<sub>1</sub> hybrids were intercrossed for 12 cycles while selecting for jaundice loci.congenic1357186Gunn-<i>Ugt1a1</i><sup>jBluHsd</sup>Gunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.mutant1357187WF.BBDR-(<i>D4Rat16-D4Got39</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1357189SS.LEW-(<I>D8Rat56-D8Rat51</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canadacongenic1357190SS.MNS-(<I>Adh1-D2Mit5</I>)/McoThis congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr backgroundcongenic1331818LEW.BN-(<i>D10Rat43-D10Mco4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic737932LEW/CrlLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34.inbred737936SR/JrIpcvSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962)inbred737941LEP/CubSubstrain of LEP, from Charles University cross of outbred animalsinbred737942LE/ZtmSubstrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973inbred737943R/AEurRijSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986inbred737961SR/JrMolSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaardinbred737965AGUS/OlaHsdSubstrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968inbred1331819F344/EerF344/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indianainbred1331820LEW.BN-(<i>D10Got9-D10Rat2</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic737885RHA/KunRoman high avoidanceRoman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlandsinbred737898WOKA/KSubstrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germanyinbred1331821LEW.BN-(<i>D10Wox26-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic737903Hsd:SDSprague DawleyOriginated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratoriesâ¿¿ colonies are direct descendants of this original colony.outbred1331822DA.ACI-(<i>D10Rat2-D10Rat6</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenic1331823LEW.BN-(<i>D10Rat43-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic737906MWF/HsdMunich Wistar FromterSubstrain of Munich Wistar stock, inbred by Harlan Sprague DawleyinbredEliminated1331824DA.ACI-(<i>D10Rat219-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenic737914SDL/IpcvSubstrain of SDLinbred631571SS.LEW-(<i>D1Uia8-D1Mco38</i>)/JrSegment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenic61110SHR/MolSpontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes.inbred737919LEW/HanSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germanyinbred1357994SHR/NCrlTo Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.inbredLive Animals1302359SD/HsdFcenThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.outbred1302360W/HsdFcenThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.outbred1302416ACI.DA-(<i>D10Rat2-D10Rat19</i>)/ArbA fragment from DA/OlaHsd rats is transferred to ACI/SegHsd.congenic1302597LEXF7C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer634370F344.GK-(<i>D1Mgh10-D1Rat119</i>)/SweGK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain.congenic1302598FXLE26/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLiving Animals: EmbryoDiabetes Obesity; Cancer1302599WKY/TaThis strain originated from Takeda Chemical Industries, Ltd., JapaninbredEmbryo; Sperm1302600HTX/Kyohydrocephalus texas1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.mutantLive Animals; Embryo; SpermNeurobiology1357978SS.MNS-(<i>D2Mit6-D2Rat303</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenic1357979SS.MNS-(<i>Mme-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenic634743BILUniversity of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbred1357980BB.SHR-(<i>D4Got41-Tacr1</i>)/KCongenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997.congenicSpermDiabetes Obesity; Metabolism731192SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Aydcongenic10030NEDH/KInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.inbred1357981SS.LEW-(<i>D3Mco21-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Aydcongenic1357982SS.LEW-(<i>D3Rat52-D3Chm63</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Aydcongenic1357983SS.LEW-(<i>D1Mco75-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenic1357984SS.MNS-(<i>D2Mit6-D2Rat166</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenic1357985LOU/Insoriginated from Universite Catholique de Louvain.inbred1357986SS.LEW-(<i>D1Uia8-D1Rat211</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenic1357987SS.LEW-(<i>D1Uia8-D1Rat18</i>)/McoA 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenic731195DA.E3-(<i>D14Wox8-D14Rat64</i>)/RhdThe fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain.congenic1357988SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydA segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic731190SS.LEW-(<i>D1Rat211-D1Rat18</i>)/McoA segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenic1358174SS-Chr 19<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 19 introgressed.consomicSperm1358632MR/HarMaudsely reactiveOriginally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.inbred1559046SHR-Chr Y<sup>W</sup>/KConsomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996.consomic1559047SHRSP/EzoSubstrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, JapaninbredLive Animals; Embryo; SpermNeurobiology; Cardio Hypertension1559048SHR.ODS-<i>Gulo<sup>od</sup></i>/ShiA congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous oens were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995.congenicEmbryo; SpermCardio Hypertension; OsteosisGulo6207011578697BN.LEW-(<i>D10Rat32-D10Rat31</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Rat32-D10Rat221</i>)/Ciml backcrossed to BN/Rj.congenic1578698LAS2Low Alcohol Sensitive strain 2Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbredinbredEmbryo; Sperm1578699BGanemic BelgradeThese are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY.inbredEmbyro; Sperm1578700HAS1High Alcohol Sensitive strain 1Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbredinbredEmbryo; Sperm1578701HAS2High Alcohol Sensitive strain 2Selectively bred for high ethanol sensitivity for 24 generations, then inbred.inbredEmbryo; Sperm1578702LEW.BN-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578703SLA/BruRrrcSyracuse Low AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats.inbredEmbryo; Sperm1357194WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1358298SD-Tg(P23H)1LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.transgenic1358299SD-Tg(P23H)2LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.transgenic1358300SD-Tg(P23H)3LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.transgenic1358302SD-Tg(S334ter)3LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenic1358303SD-Tg(S334ter)4LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenic1566448FHH-Chr 9<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 9 introgressed.consomicSperm2303784SHR-Chr 4<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRconsomicEmbryoDiabetes Obesity; Cardio Hypertension1566453SD-Tg(HIV-LacZ)AngRrrcFertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid.transgenicEmbryo; Sperm1566454BDIV/ZteBDIV/Ztederived from Berlin-Druckrey strain BDIVinbred1566455HTX/HcjRrrcAvailable at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30.inbredEmbryo; Sperm1566456BDIX/Ztederived from Berlin-Druckrey strain BDIXinbred1566457SPRDSprague-DawleyFrom outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990).inbred1566458F344-Tg(ROSA26-hPAP)EpsRrrcF344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP).transgenicSperm1566459F344-Tg(ROSA26-EGFP)EpsF344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP).transgenic1566460SD-Tg(ICAM2-DAF)AngRrrcEmbryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter.transgenicEmbryo; Sperm1578692BN.LEW-(<i>D10Rat32-D10Rat116</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml backcrossed to BN/Rj.congenic1578693LEW.BN-(<i>D10Mco17-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578694ATAlcohol-TolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.inbredEmbryo; Sperm1578695SHA/BruRrrcSyracuse High AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats.inbredEmbryo; Sperm1302921F344-Tg(DTR)C354WighDTR cDNA was inserted at the 3' of the 2.5 kb human podocin promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs.transgenic737957WOKW/KSubstrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991inbredDiabetes Obesity; Metabolism10041SS/JrSalt SensitiveStrain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982)inbredEmbryo; SpermHmox128061359008F344.HTX-(<i>D11Rat4-D11Arb4</i>)(<i>D17Rat23-D17Rat154</i>)/HcjDouble congenic strain originated from a cross between single congenic strains F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj and F344.HTX-(<i>D17Rat23-D17Rat154</i>)/Hcj.congenic1358633MNRA/HarOriginally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.inbred1358989WKY.SHR-(<I>D2Rat174-D2Rat28</I>),(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenic1358990DA.F344-(<i>D10Mit9-D10Rat24</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/Hsdcongenic1358991F344.HTX-(<i>D11Rat4-D11Arb4</i>)/HcjCongenic strain originated from F344/NHsd parental strain bred to HTX/Hcjcongenic1358992SHR.WKY-(<I>D2Rat40-D2Rat50</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markerscongenic1358993WKY.SHR-(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenic1358994SHR.WKY-(<I>D2Rat161-D2Rat241</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) congenic strain to the parental strain SHR/NCrlcongenic1358995F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.congenicEmbryoDiabetes Obesity1358996SHR.WKY-(<I>D2Rat10-D2Mgh13</I>)This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl backgroundcongenic1358997WKY.SHR-(<I>D2Rat241-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenic1358998BUF/NHsdHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan.inbred1358999WKY.SHR-(<I>D2Rat174-D2Rat28</i>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenic1359000DA.F344-(<i>D10Arb27-D10Rat6</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/Hsdcongenic1302663F344.OLETF-(<i>D11Rat4-D11Rat1</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1566445ACI.BN-(<I>D5Mgh17-D5Rat205</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicExtinct1566447GK/MolTacGoto-KakizakiOriginating at Tohoku University, Sendai, Japan in 1975, the Goto-Kakizaki rat was obtained by Aarhus University Hospital, Denmark in 1994. Received from Aarhus by M&B A/S in 1997.inbred1302708FXLE17/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302709WKY/HcmStrain is from the Hyogo College of Medicine, Japan.inbredEmbryo; SpermCardio Hypertension1302710LEXF2B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302711EHC/SeacIsolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993inbred1302712ZIMY/KyoZitter Masao YamadaZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada)mutantEmbryo; SpermNeurobiologyAtrn690631302715WKY.SHRSP-(<I>D1Wox18-D1Wox29</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302716OM/NSlcOsborne-Mendel ratThe Instutite of Medical Science, The University of Tokyo to Slc (1985)inbredLiving Animals1302717ACI/NHokNIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135inbredEmbryoCardio Hypertension61109F344/NHsdF344/NHsdStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.inbred1302718HWY/Slchairless wistar yagiStrain is from Japan SLC, Inc., Shizuoka, Japan.mutantLiving AnimalsDermatology1302719DON/KyoDonryu ratJapanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2inbredLive Animals; Embryo; Sperm1302720CXH10/TjStrain is from the University of Tokushima, Japan.recombinant_inbredEmbryoMetabolism; Immunology1302721LEC/TjFound in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989mutantEmbryoCancerAtp7b21801302722PVG/SeacPiebald Virol GlaxoStrain is from Seac Yoshitomi, LTD., Fukuoka, Japan.inbredLive Animals; Embryo; SpermImmunology1302723LEXF5/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302724SHR/HcmStrain is from the Hyogo College of Medicine, Japan.mutantEmbryoCardio Hypertension1357345DA/KDark Agouti/KarlsburgDark agouti rats which were bred adn housed in Dept. of Laboratory Animal Science, Karlsburg, Germanyinbred1357346BB.SHR-(<i>D4Mit6-Spr</i>)/KBB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected.congenicNpy|Spr3197|37531358158FHH-Chr 16<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 16 introgressed.consomicSperm1358159FHH-Chr 6<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 6 introgressed.consomicSperm1358160SS.BN-(<i>D8Rat163-D8Rat81</i>)/McwiA SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81.congenic728199RHARoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965).congenic1358161SS.LEW-(<i>D16Rat38-D16Chm66</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenic1358162SS-Chr 12<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 12 introgressed.consomicLive Animals1358163SS-Chr 15<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 15 introgressed.consomicLive Animals; Embryo; Sperm1358164FHH-Chr 17<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 17 introgressed.consomicSperm1358165SS.MNS-(<i>D2Chm51-D2Rat341</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain.congenic1358166SS.LEW-(<i>D16Mit3-D16Rat112</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenic1358167SS.MNS-(<i>D2Wox27-Adh1</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenic1358168SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenic1358169SS.MNS-(<i>D2Chm25-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Chm90-D2Wox37</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenic1358170FHH-Chr 5<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 5 introgressed.consomicSperm1358171SS-Chr 17<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 17 introgressed.consomicSperm1358172SS.MNS-(<i>D2Chm25-Fgg</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenic1358173FHH-Chr 11<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 11 introgressed.consomicSperm1357974BB.SHR-(<i>D4Got41-Gimap5</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.congenic1357975SS.LEW-(<i>D1Mco4-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenic1357976BB.SHR-(<i>D4Got41-D4Rat171</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.congenic1358921WF.DA-(<i>D19Mit1-D19Mit6</i>)/KopCongenic strain originated from a parental DA/Slc strain.congenicEmbryoCancerNqo125031358922BB.WOKW-(<i>D4Got41-Fabp1</i>)/KCongenic strain originated from a BB/OK parental strain.congenic1358923LE-<i>Mbp</i><sup>md</sup>10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.mutantMbp30541359001WKY.SHR-(<I>D2Rat42-D2Rat139</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markerscongenic631582SS.WKY-(<i>Mme-D2Wox18</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jrcongenic1549808SS.LEW-(<i>Prlr-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental straincongenic1549809BN/KtsSlcKitasato University School of Medicine to Slc (2002)inbredLiving AnimalsImmunology1549810AI/Msikamelogenesis imperfecta ratThis strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc.mutantEmbryo; SpermDentistry1549811ACI/NJclACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan.inbred1549813F344.ACI-<i>Lmx1a<sup>qc</sup></i>/KyoCongenic strain created by backcrosses between ACI/Pas and F344/NSlc strains.congenicEmbryo; SpermLmx1a13047841559039ODS/JclOsteogenic disorder ShionogiThe osteogenic disorder Shionogi (ODS) rat is a mutant Wistar rat that is subject to scurvy, because it lacks L-gulono-gamma-lactone oxidase, a key enzyme in L-ascorbic acid biosynthesis.mutant1559040MD/Tamamyelin deficient ratX-linked mutant of the Wistar rat.mutantLiving AnimalsNeurobiology; Development1302628ACIS/HokSpontaneous mutation from ACI/Hok in 1981.coisogenicLive Animals; Embryo; Sperm1559041SHRSP/NgskSubstrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980.inbredLive Animals; Embryo; SpermNeurobiology; Cardio Hypertension; Osteosis1559042SHR/NigOriginated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976.inbredEmbryo; SpermCardio Hypertension; Pharmacology1559043MV/Opumyelin vacuolation ratThe myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999.mutantEmbryo; SpermNeurobiologyAtrn690631559044SS.SR-(<i>D3Mco19-D3Mco5</i>)/JrA region of chr 3 which contains the Edn3 gene was introgressed into the SS ratscongenicEdn325341559045LEW/CrlcLEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canadainbred737938AUG/OlaHsdSubstrain of AUG, derived from US August substrains in 1951inbred737945BN/HanSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973.inbred737946WAG/OlaHsdSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawleyinbred1331829BN.LEW-(<i>D9Got8-D9Got200</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenic737956WF/Gutsubstrain of Wistar Furth stock, from J Furth in 1945inbred737963LEW/CubSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Pragueinbred737967BS/ZtmSubstrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988inbred1331830F344.BN-(<i>D5Rat1-D5Mit5</i>)/DlwThis congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USAcongenic1298093LEW/NHsdObtained from Harlan-Sprague Dawley (Indianapolis, Indiana) at 35-45 days of age.inbred737887AO/OlaHsdThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The NetherlandsinbredCryopreserved737894LEW/OrlSubstrain of Lewis rats, maintained in Orleans, Franceinbred737900WF/ZtmRecombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germanyinbred737915R/AWaSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986inbred737916DZB/GroSubstrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningeninbred1331831LEW.BN-(<i>D10Rat173-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenic737923SHR/MaasSubstrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlandsinbred737928BN/NHsdCpbSubstrain of BN, from Billingham and Silvers 1958inbred737929Crl:WIWistar ratsTo Scientific Products Farm, Ltd.[predecessor of Charles River Unitedoutbred631698BN/MolThis strain is maintained at the Mollegaard breeding center.inbred1302704WKY.SHRSP-(<I>D1Wox29-D1Rat199</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302705WKY.SHRSP-(<I>D1Wox29-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicEmbryoCardio Hypertension1302706F344.OLETF-(<i>D5Rat32-D5Rat26</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1302707LEXF3/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredEmbryoDiabetes Obesity; Cancer1357977SS.LEW-(<i>D1Mco8-D1Rat213</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenic1358179FHH-Chr 13<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 13 introgressed.consomicSperm1358180FHH-Chr 19<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 19 introgressed.consomicSperm1358258RCS/LavRrrcroyal college of surgeons ratDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London.inbredEmbryo; Sperm1358259RCS-<i>p</i><sup>+</sup>/LavRrrcDeveloped by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain.congenicEmbryo; Sperm1358277RCS-<I>rdy</I><sup>+</sup>/LavRrrcDeveloped by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated.congenicEmbryo; Sperm1358278RCS-<i>rdy</I><sup>+</sup><I> p</I><sup>+</sup>/LavRrrcDeveloped by crossing a pink-eyed control(RCS-rdy<sup>+</sup>/Lav x black-eyed dystrophic(RCS-p<sup>+</sup>/Lav) The F12 progeny was backcrossed to RCS-rdy<sup>+</sup>/Lav.congenicEmbryo; Sperm1547875ACI.FHH-(<i>D17Rat117-D17Arb5</i>)(<i>D17Rat180-D17Rat51</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenic1547876FHH-Chr 10<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 10 introgressed.consomicSperm1549794SS.LEW-(<i>D2Rat199-D2Mco17</i>)/AydCongenic strain was created from a SS/Jr parental straincongenic1549795SS.LEW-(<i>D2Rat199-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental straincongenic1549796BN/2HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F16coisogenicLive Animals; Embryo1358114SS-Chr 5<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Sperm1359002NTac:WKYThe Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony.outbred1359003LEW/JrThis strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA.inbred1359004DA.F344-(<i>D10Mit9-D10Rat11</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/Hsdcongenic1359005SHR.WKY-(<I>D2Rat15-D2Rat50</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) to parental strain SHR/NCrlcongenic1359006WKY.SHR-(<I>D2Rat27-D2Rat243</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenic1359007WKY.SHR-(<I>D2Rat174-D2Rat62</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenic728184SHRSP/A3NTo N in 1975 from Yamori at F36. SHR was isolated from Wis- tar-Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517)inbredExtinct1599674BBDP.WF-(<i>D8Rat59-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1599675BBDP.WF-(<i>D13Rat124-D13Mgh5</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicPtprc34511599755F344.BN-(<i>D16Mit5-D16Rat75</i>)BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segmentcongenic1599756BN-<i>Has2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHas2<i><sup>m1Mcwi</i></sup>15995661599757BN-<i>Adora2a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantAdora2a<i><sup>m2Mcwi</i></sup>15995611599758SS-<i>Sod3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermSod3<i><sup>m1Mcwi</i></sup>15995671599759GRY/Idrgroggy ratGroggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003.inbredLive Animals; Embryo; SpermNeurobiology1579690FHH-<i>Slc27a5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSlc27a5<i><sup>m1Mcwi</i></sup>15787991579691SS.SHR-(<i>D11Mgh3-D11Rat31</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenic1302667F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1554301WKHA/BordStrain was originated from WHHA/Edh at the University of Vermont College of Medicineinbred1554302HOB-<I>Unc5c</I><sup>+Snk</sup>hobble ratHomozygous hobble rats that were taken from the inbred hobble rat colony.mutantUnc5c7351091554303CVD/OpuCerebellar vermis defect ratOriginated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates.mutantUnc5c7351091359009WKY.SHR-(<I>D2Rat174-D2Rat185</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markerscongenic1359010WF.BBDR-ART2<SUP>a</SUP>/WorWistar FurthCongenic strain created by backcrossing WF strain to BBDR strain which are RT1 <SUP>u/u</SUP> , ART2<SUP>a</SUP>.congenic1549797BUF.ACI-(<i>D16Rat31-D16Arb1</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr16 was developed by speed congenic method.congenic1549798BB.PVG-<i>RT1</i><sup>u/a</sup>/TkyA congenic strain with the genetic background of the BB/WorTky strain (RT1.B<sup>u</sup>,D<sup>u</sup> ) onto which the MHC locus of PVG.R23 strain (RT1.B<a>,D<a>) has been transferred.congenicEmbryoDiabetes Obesity; Immunology1549799BB.SHR-<i>(D6Rat184-D6Rat3)</i>/KCongenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000.congenicSpermMetabolism1549800BN/KunKtsSlcKitasato University School of Medicine to Slc (2001)mutantLiving AnimalsMetabolism1549801BN/SeacSeac Yoshitomi, LTD, Fukuoka, JapaninbredSpermBehavior; Ophthalmology1549802BN/1HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F15coisogenicLive Animals; Embryo; Sperm1549803ACI-<i>Lyst</i><sup>bg-Kyo</sup>/KyoSpontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999.coisogenicEmbryo; SpermHematology1549804BUF/NacJclCLEA Japan, Inc., Tokyo Japaninbred1549805BUF.Cg-<i>Foxn1</i><sup>rnu</sup>/MnaBUF/Mna, NN1H-Rnu/RnucongenicEmbryo; SpermUrology1549806BUF.ACI-(<i>D3Rat56-D3Rat83</i>)/NccThis strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient straincongenicEmbryo; SpermCancer631583SS.WKY-(<i>D2Mgh8-D2Mgh9</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jrcongenic1357953WAG/RijHfrSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Harlan France.inbred1357954F344/NHfrStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France.inbred1357955WF/NHfrWistar-FurthSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France.inbred1357957LEW/HanHfrSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany. Supplied by Harlan, France.inbred1357958BN/RijHfrSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France.inbred1357959FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/McwiThe Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH.congenicLive AnimalsCtsc|Grm5|Nox4|Rab38|Tyr2445|2746|620600|628752|1589755631581LEW.1FOriginally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1<sup>f</sup> haplotype into the LEW stockinbred1357960LE/CpbHfrSubstrain of LE which was bred at Harlan CPB now at Harlan France.inbred61111DA/Slcdark agoutiThese were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983.inbredLiving Animals1358150SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenic1358151FHH-Chr 8<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 8 introgressed.consomicSperm1358152SS-Chr 14<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 14 introgressed.consomicSperm1358153COP/CrCrlInbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998.inbred1358154SS-Chr 3<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 3 introgressed.consomicLive Animals; Sperm1358155SS.LEW-(<i>D10Rat119-D10Mgh1</i>)(<i>D16Rat21-D16Rat112</i>)/AydThis double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (<i>D10Rat119-D10Mgh1</i>)and (<i>D16Rat21-D16Rat112</i>) from the LEW straincongenic1358156SS.MNS-(<i>D2Rat183-D2Chm113</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenic1358157FHH-Chr 7<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 7 introgressed.consomicSperm1579708FHH-<i>Des<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantDes<i><sup>m1Mcwi</i></sup>15788011579709Wild/McwiWildThese rats were caught wild in Milwaukee, used for experiments and then sacrificed.wild1579710GK/FarGoto-KakizakiGenerated by selective brother x sister breding of 18 non-diabetic Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japaninbred1579711FHH-<i>Adipoq<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermAdipoq<i><sup>m1Mcwi</i></sup>15787871579712FHH-<i>Klf6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantKlf6<i><sup>m1Mcwi</i></sup>15787891578696LAS1Low Alcohol Sensitive strain 1Selectively bred for 24 generations for low sensitivity to ethanol then inbred.inbredEmbryo; Sperm1579677FHH-<i>Madd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantMadd<i><sup>m1Mcwi</i></sup>15787961579678ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenicLive Animals; Sperm1579680Wild/TkuWildThese rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed.wild1579681BN-<i>Birc3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantBirc3<i><sup>m1Mcwi</i></sup>15787881579682FHH-<i>Tlr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermTlr4<i><sup>m1Mcwi</i></sup>15787851579683FHH-<i>Ghsr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermGhsr<i><sup>m1Mcwi</i></sup>15787941579684FHH-<i>Slc8a2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermSlc8a2<i><sup>m1Mcwi</i></sup>15787861579685FHH-<i>Tgfbr2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermTgfbr2<i><sup>m2Mcwi</i></sup>15787821579686GH/OmrMcwiThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then.inbredLive Animals; Embryo1579687FHH-<i>Proc<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermProc<i><sup>m1Mcwi</i></sup>15787901302625F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1302607FXLE21/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1559030LEC-Tg(ATP7B)TohmA 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA.transgenicEmbryo; SpermCancer1302695SER/Kyospontaneously epileptic ratSpontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Acsegregating_inbredLive Animals; Embryo; SpermNeurobiologyAtrn|Aspa69063|621693724574SHR/NHsdSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN)inbred1559031NE/MaveThe control strain of GAERS, free of any spontaneous spike and wave discharges.inbredLive Animals; Embryo; SpermNeurobiology1559032SS.LEW-(<I>D17Rat65-D17Chm2</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenic1559033SS.LEW-(<I>D17Rat65-Prl</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient straincongenic1559034SS.LEW-(<I>D17Chm14-D17Rat97</I>)/AydThis congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenic1302702TRM/Kyotremor ratTremor Rat 1980 was found in a colony of outbred Wistar/Kyo while establishing inbred strains from Wistar/Kyo by spontanious mutation. After F18, a control line WTC was separated.segregating_inbredLive Animals; Embryo; SpermNeurobiologyAspa6216931559035SS.LEW-(<I>D17Chm14-D17Rat181</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient straincongenic1559036LEW/JmsLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.inbredEmbryo; Sperm1559037SS.LEW-(<I>D17Chm9-D17Rat97</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenic1578704WLPWarsaw Low PreferingThese were bred from albino stock of Wistar rats as lines that had low ethanol preference.inbred1578705LEW.BN-(<i>D10Arb4-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578706LEW.BN-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1302602FXLE12/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302682FXLE18/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1302690FXLE19/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredEmbryoDiabetes Obesity; Cancer1578708LEW.BN-(<i>D10Mgh7-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578709IAincisor absentThese rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption.inbredEmbryo; Sperm1578710LEW.1AR1-<I>iddm</I>/Ztmarose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup>) in the intra-MHC recombinant inbred strain LEW.1AR1 ; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain sincecoisogenic1578711LEW.BN-(<i>D10Mco17-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578712BN.LEW-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578713BN/Ztmsubstrain of BNinbred1578714BN.LEW-(<i>D10Mco17-D10Rat80</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenic1578715ANTAlcohol-NontolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.inbredEmbryo; SpermGabra6618611578716LEW.1AR1/ZtmLewis strain containing MHC haplotype <i>RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup></i>congenic1578717WHPWarsaw High PreferingThese were bred from albino stock of Wistar rats as lines that had ethanol preference.inbred1579688BN-<i>Tgfbr2<sup>m1</i>Mcwi</sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantTgfbr2<i><sup>m1Mcwi</i></sup>15788001579689FHH-<i>F10<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermF10<i><sup>m1Mcwi</i></sup>15787831581639HAn/Humdhigh autotomy newMales and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbred1581640HA/Humdhigh autotomyHigh Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbred10011COP/OlaHsdThese are derived from the original colony which was developed by Dr. W.F. Dunning.inbred1357195SS.MNS-(<i>Aldoc-D10Mco1</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicNos231851357196WF.BBDR-(<i>D4Arb29-D4Rat265</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenic1358175FHH-Chr 20<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 20 introgressed.consomicSperm1358176FHH-Chr 18<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 18 introgressed.consomicSperm1358177SS.MNS-(<i>D2Chm25-D2Mit14</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenic1566434NTac:SHRTaconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony.outbred1358178SS-Chr 10<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 10 introgressed.consomicSperm737657LEW.1AV1Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1<sup>av1</sup> haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.congenicExtinct728196RHA/N-<i>j</i>Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.congenicExtinct1598799ACI.FHH-(<i>D1Rat384-D1Rat452</i>)(<i>D17Rat61-D1Arb5</i>)(<i>D17Rat51</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain.congenic1598800ACI.FHH-(<i>D1Rat384-D1Rat156</i>)/EurCongenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain.congenic1598801ACI.FHH-(<i>D1Mit18-D1Mit8</i>)(<i>D14Mit11-D14Hmgc14b</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.congenic1598802BBDR/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generationinbredExtinct1598803BBNB/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.inbredExtinct1598804WKY.GHS-(<i>D1Rat32-D1Mit32</i>)GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTLcongenic1600337F344.GK-(<i>D1Mgh14-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenic1580542PCK/CrljCrl-<i>Pkhd1<sup>pck</i></sup>/CrlThis model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Katsuyama and associates in 2000. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). To Charles River in 2006.coisogenic1581616DA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenic1581617SD-Tg(Ubc-eGFP/ Dazl-shRNA)16-13GarThis transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)transgenic1581618SHRSP/BbbThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by srict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany.inbred1599767SS-<i>Htr1a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHtr1a<i><sup>m2Mcwi</i></sup>15995621599768SS-<i>Klf4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantKlf4<i><sup>m1Mcwi</i></sup>15995691599769COP.DA-(<I>D3Rat233-D3Mgh14</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.congenic1600338SHR.F344-(<i>D12Mgh5-D12Mgh6</i>)/SnkSegment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic techniquecongenic1600339BN.GK-(<i>D1Wox18-D1Got254</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic1600340DA/BklArbNsiOriginally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI.inbredEmbryo; Sperm1600341LEW-Tg(Ren2)27This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl ratstransgenic1600342F344.GK-(<i>D1Got250-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenic1600343SHRSP.WKY-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategycongenicEmbryoCardio Hypertension1600344F344.GK-(<i>D1Rat175-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenic1581641WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic1581642FHH-<i>Ccr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantCcr4<i><sup>m1Mcwi</i></sup>15814921581643LAn/Humdlow autotomy newMales and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbred1581644FHH-<i>Htr1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermHtr1a<i><sup>m1Mcwi</i></sup>15814961581645LL/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain.inbred1579898SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenic1579899SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.congenic1579900SS.SR-(<i>D9Rat89-Resp18</i>)/McoCongenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) straincongenicResp1835551579901SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenic1579902SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.congenic1579903SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.congenic1579904SS.SR-(<i>D9Mgh11-D9Mco33</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenic1579905SS.SR-(<i>D9Rat89-D9Mco27</i>)/McoCongenic strain derived from parental strains SS and SR.congenic1579906FHH-<i>Adipoq<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermAdipoq<i><sup>m3Mcwi</i></sup>15798871579907SS.LEW-(<i>D10Chm128-D10Chm169</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenic1579908SS.SR-(<i>D9Mco95-Resp18</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenic1579909FHH-<i>Fgl2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantFgl2<i><sup>m1Mcwi</i></sup>15798851579910FHH-<i>Ccr2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermCcr2<i><sup>m1Mcwi</i></sup>15798881579911SS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiSS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background.congenic1579912FHH-<i>F10<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermF10<i><sup>m2Mcwi</i></sup>15798861581619BN.PD-(<i>D8Rat39-D8Rat35</i>),SHR-(<i>D2Mit4-D2Rat28</i>),SHR-(<i>D2Rat103-D2Rat107</i>)/CubThis triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-<i>Lx</i>.congenic1581620SS.SR-(<i>D9Mco61-D9Mco27</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenic1581621DA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenic1581622SD-Tg(Ubc-eGFP/ Dazl-shRNA)17-9GarRrrcDazl shRNA (17-9)This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)transgenicEmbryo1581623LA/Humdlow autotomyLow Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbred1581624FHH-<i>Lipe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantLipe<i><sup>m1Mcwi</i></sup>15814951581625BN-<i>Hand1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHand1<i><sup>m1Mcwi</i></sup>15814931581626FHL/EurMcwiFawn Hooded Low blood pressureThe low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage.inbred1581627WF.WKY-(<i>D5Uwm66-D5Uwm67</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic1581628DA.ACI-(<i>D15Rat6-D15Rat13</i>)/KiniDA.ACI-(<i>D15Rat 6-D15Rat13</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenic1581629WF.WKY-(<i>D5Wox8-D5Uwm62</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic1581630WF.WKY-(<i>D5Uwm63-D5Uwm64</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic1579894SS.LEW-(<i>D10Rat204-D10Rat9</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.congenic1579895FHH-<i>Bdkrb2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantBdkrb2<i><sup>m1Mcwi</i></sup>15798891579896SS.LEW-(<i>D2Rat18-D2Chm277</i>)/AydCongenic strain was created from a SS/Jr parental straincongenic1579897SS.SR-(<i>D9Rat69-D9Mco14</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenic1566437SS-Chr X<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicSperm1566438DA/MolTacDeveloped at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004.inbred1566439F344/NTacAxenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH.inbred1566440NTac:SDTaconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies.outbred1566443LEW/MolTacLewisScripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived.inbred1566444MolTac:SDThe SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993.outbred1579692FHH-<i>Lcat<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermLcat<i><sup>m1Mcwi</i></sup>15787931579693T2DN/McwiGenerated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained.inbred1579694FHH-<i>Egln3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermEgln3<i><sup>m1Mcwi</i></sup>15787811579695ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenic1579696SS.SHR-(<i>D6Wox13-D6Rat84</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenic1579697SS.SHR-(<i>D13Rat63-D13Mit1</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenic1579698FHH-<i>Adra1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermAdra1a<i><sup>m1Mcwi</i></sup>15787921579699WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdWKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdThis congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain backgroundcongenic1579700ACI.FHH-(<i>D1Rat475-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)/EurDouble congenic strain from backcross of ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur and ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur.congenic1579701BN-<i>Nos1<sup>m1</i>Mcwi</sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantNos1<i><sup>m1Mcwi</i></sup>15787951579702SS.SHR-(<i>D9Wox16-D9Rat64</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenic1579703SS.SHR-(<i>D2Rat61-D2Mco18</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenic1579704FHH-<i>Agtr1b<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantExtinctAgtr1b<i><sup>m1Mcwi</i></sup>15787841579705FHH-<i>Nr0b2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermNr0b2<i><sup>m1Mcwi</i></sup>15787981579706FHH-<i>Nr4a1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermNr4a1<i><sup>m1Mcwi</i></sup>15787911579707FHH-<i>Adipoq<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermAdipoq<i><sup>m2Mcwi</i></sup>15787971582195FHH.FHH.1<sup>BN</sup>-(<i>D1Rat173F6B-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenic1582196FHH.FHH.1<sup>BN</sup>-(<i>D1Rat234-D1Rat265</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenic728188LOU/MNTo N in 1975 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. (045)inbredExtinct1581631WF.WKY-(<i>D5Uwm61-D5Uwm37</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic1581632WF.WKY-(<i>D5Uwm65-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37).congenic1581633DA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenic1581634BN-<i>Adora2a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantAdora2a<i><sup>m1Mcwi</i></sup>15814761581635WKY/BbbThis WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany.inbred1581636BN-<i>Cebpe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantCebpe<i><sup>m1Mcwi</i></sup>15814941581637FHH-<i>Has1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHas1<i><sup>m1Mcwi</i></sup>15814771581638DA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenic1599760SPRD.WKY-(<i>D18Wox8-D18Rat44</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenic1599761BN-<i>Lcat<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantLcat<i><sup>m2Mcwi</i></sup>15995701599762SS-<i>Bdkrb2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantBdkrb2<i><sup>m2Mcwi</i></sup>15995681599763SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenic1599764COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.congenic1599765SS-<i>Klf4<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantKlf4<i><sup>m2Mcwi</i></sup>15995591599766SS-<i>Hps6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHps6<i><sup>m1Mcwi</i></sup>15995641554304GAERS/MaveGenetic Absence Epilepsy Rats from Strasbourg30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.inbredEmbryo; SpermNeurobiology1554305DA-Tg(CAG-lacZ)30JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.transgenicEmbryoDevelopment1554306GK/SlcGoto Kakizaki RatSpontaneous mutant GK rat which were obtained from Japan SLC, Inc.mutantLiving AnimalsDiabetes Obesity1554307W-Tg(LAC3)YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase.transgenic1302713F344.OLETF-(<i>D8Rat58-D8Mgh17</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenic1554308Gunn-<i>Ugt1a1<sup>j</i></sup>/SlcGunnSegregated inbred Gunn rat which were obtained from Japan SLC, Inc.segregating_inbredLiving AnimalsNeurobiology; Metabolism1302714KZC/TkyKomeda Zucker Creeping ratKomeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983.segregating_inbredEmbryo; SpermNeurobiologyReln35531554309W-Tg(CAG-GFP)184YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator.transgenicEmbryo; SpermDevelopment1554310DA-Tg(CAG-lacZ)19JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.transgenicEmbryo; SpermDevelopment1566430SimTac:LETaconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock.outbred1566431BN/MolTacThe BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003.inbred1566432WKY/NMolTacWistar KyotoThe inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit.inbred1566433HanTac:WHIn 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000.outbred1641876BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1641877NP.P-(<i>D4Rat119-D4Rat55</i>)/IusmMale P and female NP rats were backcrossed to get F1 animals which were further backcrossed to NP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenicAkr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap12092|3197|3729|68368|735049|1307836|1308501|1310949|13114181641878WF.BBDR-(<i>Clcn1-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenic1641879SS-Chr 19<sup>SHR</sup>/RkbSS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomic1641880SD-<i>Brca1<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screenedmutantEmbryo; SpermBrca1|Brca1<i><sup>m1Uwm</i></sup>2218|7282981642017BBDR/WorBrmThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.inbred1642018BBDP/WorBrmThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.inbred1642269SS-<i>Birc3<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantBirc3<i><sup>m2Mcwi</i></sup>16421781642270BN-Lcat<i><sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantExtinct; SpermLcat<i><sup>m3Mcwi</i></sup>16421751642271SS-<i>Klf4<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermKlf4<i><sup>m3Mcwi</i></sup>16421791642272SS.LEW-(<i>D10Mco84-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642273SS-<i>Thbd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantThbd<i><sup>m1Mcwi</i></sup>16421821642274SS-<i>Has1<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHas1<i><sup>m2Mcwi</i></sup>16421711642275SS.LEW-(<i>D10Rat29-D10Mco88</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642989SS-Tg(CAG-eGFP)1McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicSperm1643007DA.ACI-(<i>D12Wox12-D12Rat53</i>)/ArbACI/SegHsd and DA/OlaHsd were crossed to get F<sub>2</sub> animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsdcongenic1642971SS.LEW-(<i>D10Mco84-D10Mco129</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642972SS.LEW-(<i>D10Mco84-D10Mco143</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1643010F344.OLETF-(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tjdouble congenic strain generated by intercrossing F344.OLETF-(<i>D7Rat18-D7Mit2</i>)/Tj and F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj and F<sub>2</sub> rats screened for homozygositycongenic1642990SD-Tg(CAG-eGFP)63McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.transgenic1642991SS-Tg(CAG-eGFP)18McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1642992SS-Tg(CAG-eGFP)28McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1642993SD-Tg(CAG-eGFP)97McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.transgenic1642994SS-Tg(CAG-eGFP)43McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1642995SS-Tg(CAG-eGFP)10McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1642996SS-Tg(CAG-eGFP)2McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1626210BN-<i>Lipe<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantLipe<i><sup>m2Mcwi</i></sup>16421691641849SS.LEW-(<i>D10Mit1-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641850SHR.WKY-(<i>D1Got158-D1Got161</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regioncongenicSpon16199181641851SHR.PD-(<I>D8Rat42-D8Arb23</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-<i>Lx</i> straincongenicZbtb167279211641852WF.BBDR-(<i>D4Got48-D4Got43</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenic1641853SS.LEW-(<i>D10Mco38-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641854HAS.LAS-(<i>D5Rat70-D5Rat37</i>)F1 generation males were backcrossed to HAS females and the offsprings were genotypedcongenic1641855BBDP.WF-(<i>D8Rat73-D8Rat20</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1641856P.NP-(<i>D4Rat119-D4Rat55</i>)/IusmP and NP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenic1641857BBDP.WF-(<i>D8Rat16-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1641858SHR.WKY-(<i>D1Rat420-D1Rat278</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regioncongenic1641859SS.MNS-(<i>D10Bra1-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641860SS.MNS-(<i>D10Mco62-D10Mit1</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641861HAS.LAS-(<i>D2Rat38-D2Rat69</i>)F1 generation males were backcrossed to HAS females and the offsprings were genotypedcongenic1641862F344-<i>Apc<sup>Pirc</i>Uwm</sup>Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screenedmutant1642276SS-<i>Kcna5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermKcna5<i><sup>m1Mcwi</i></sup>16421771642277SS-<i>Cpt2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermCpt2<i><sup>m1Mcwi</i></sup>16421741642278SS-<i>Ghsr<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantGhsr<i><sup>m2Mcwi</i></sup>16421801642279SS.LEW-(<i>D10Arb9-D10Rat161</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642281SS-<i>Podxl<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantPodxl<i><sup>m1Mcwi</i></sup>16421761642282SS-<i>Cacna1g<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantCacna1g<i><sup>m1Mcwi</i></sup>16421681642283SS.LEW-(<i>D10Rat29-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642284SS-<i>Fgl2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantFgl2<i><sup>m2Mcwi</i></sup>16421811642285SS.LEW-(<i>D10Arb9-D10Rat57</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642287SS.LEW-(<i>D10Arb9-D10Mco84</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642288SS.LEW-(<i>D10Mco89-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1579913SS.LEW-(<i>D10Chm224-D10Chm222</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenic1579914SS.LEW-(<i>D10Mco30-D10Got92</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenic1582184SR/JrHsdDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.inbred1582185SS.SR-(<i>D3Mco36-D3Got166</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic1582186FHH.FHH.1<sup>BN</sup>-(<i>D1Rat183-D1Rat76</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenic1582187SS.SR-(<i>D3Mco24-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic1582188SS.SR-(<i>D3Mco36-D3Mco46</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicSperm1582189SS.SR-(<i>D3Mco39-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic1582190SS/JrHsdDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.inbred1582191FHH.FHH.1<sup>BN</sup>-(<i>D1Rat287-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenic1582192SS.SR-(<i>D3Mco36-D3Got159</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic1582193FHH.FHH.1<sup>BN</sup>-(<i>D1Mgh13-D1Rat89</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenic1582194SS.SR-(<i>D3Mco78-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic1600345F344.GK-(<i>D1Rat83-D1Rat376</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenic1600346F344.GK-(<i>D1Swe4-D1Rat85</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenic1600490SS-Chr 1<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Embryo; Sperm1625284Wild1/HubrThis rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolationwild2291840F344-<i>RGD1311344<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantExtinctRGD1311344<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup>22918391641831MWF-Chr 6<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomic1642036SHR/OlaIpcv-mt<sup>BN/Crl</sup>Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic backgroundconplastic1642289SS-<i>Serpina5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSerpina5<i><sup>m1Mcwi</i></sup>16421671642362SS-<i>Has1<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantHas1<i><sup>m3Mcwi</i></sup>16423591642363BN-<i>Fgl2<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantFgl2<i><sup>m3Mcwi</i></sup>16423551642364SS-<i>Ghsr<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermGhsr<i><sup>m3Mcwi</i></sup>16423571642365SS-<i>Fgl2<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermFgl2<i><sup>m4Mcwi</i></sup>16423541642366SS-<i>Lcat<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantLcat<i><sup>m4Mcwi</i></sup>16423581642367BN-<i>Ccr2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantCcr2<i><sup>m2Mcwi</i></sup>16423561642439SS-<i>Lcat<sup>m5Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSpermLcat<i><sup>m5Mcwi</i></sup>16424381642689BN.OLETF-(<i>D1Rat169-D1Rat90</i>)/GotOLETF/Got females were crossed with BN/Crlj to produce F<sub>1</sub> which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotypedcongenicPrlhr710371642690LA/NJcr-<i>cp</i>JCR:LA-corpulent ratOriginated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta.congenic1642968SS.LEW-(<i>D10Mco84-D10Rat58</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642969SS.LEW-(<i>D10Mco84-D10Mco134</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1642970SS.LEW-(<i>D10Mco113-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1626207BN-<i>Adora2a<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantAdora2a<i><sup>m3Mcwi</i></sup>16420701626213BN-<i>Oxtr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantOxtr<i><sup>m1Mcwi</i></sup>16421731626214BN-<i>Slc27a5<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantSlc27a5<i><sup>m2Mcwi</i></sup>16421701641863SHR.PD-(<I>D8Mgh9-D8Rat149</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv.congenicZbtb167279211641864WF/CrCrliJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute.inbred1641865SD-<i>Brca2<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screenedmutantEmbryo; SpermBrca2|Brca2<i><sup>m1Uwm</i></sup>2219|7283261641866SS.LEW-(<i>D10Mit10-D10Rat24</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641867P/Iusmalcohol-preferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.inbredSnca37291641868WF.BBDR-(<i>D4Rat93-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenicTcrb38341641869SS.MNS-(<i>D10Mco31-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641870BBDP.WF-(<i>D8Rat73-D8Rat121</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1641871SS.MNS-(<i>D10Mco62-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641872SS.LEW-(<i>D10Mco38-D10Mco41</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic1641873NP/Iusmalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.inbredSnca37291641874BBDP.WF-(<i>D8Rat73-D8Rat90</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenic1641875SHR-Chr Y<sup>BN</sup>/CubBN-<i>Lx</i>/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generationsconsomic2289917SS.MNS-(<i>D10Mco70-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2290056F344-<i>Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermElmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup>22900552290057F344-Tg(T2/Bart3)1CebThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.transgenicSperm2290064F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermTrpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup>22900602290065F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup>22900592290066F344-<i>Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantNell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup>22900612290067F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup>22900622290273SHRSP.WKY-<i>(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSPcongenicEmbryo; SpermDiabetes Obesity; Cardio Hypertension2290274SHRSP.WKY-<i>(D15Rat2-D15Rat94)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2290275SHRSP.WKY-<i>(D3Tkyo7-D3Rat1)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicSpermDiabetes Obesity; Cardio Hypertension2290276SHRSP.WKY-<i>(D3Mgh16-D3Mgh15)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2290277SHRSP.WKY-<i>(D3Rat227-D3Rat166)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicSpermDiabetes Obesity; Cardio Hypertension2290278SR/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki JapaninbredEmbryo; SpermCardio Hypertension2290279SHRSP.WKY-<i>(D15Rat68-D15Rat106)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2290280SHRSP.WKY-<i>(D3Mgh16-D3Rat110)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicSpermDiabetes Obesity; Cardio Hypertension2290281SHRSP.WKY-<i>(D3Rat227-D3Rat1)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2290282SHRSP.WKY-<i>(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSPcongenicEmbryo; SpermDiabetes Obesity; Cardio Hypertension2290311SD-Tg(SOD1*G93A)26DwcSD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationtransgenic2289913SS.MNS-(<i>D10Rat13-D10Rat12</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2290100F344-<i>Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantEntpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup>22900862290101F344-<i>CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup>22900922290102F344-<i>Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantKlhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup>22900852290103F344-<i>Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermNrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup>22900902290104F344-<i>Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup>22900882290105F344-<i>Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup>22900972290106F344-<i>BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup>22900702290107F344-<i>Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup>22900952290108F344-<i>LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup>22900892290109F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup>22900872290110F344-<i>Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup>22900962290111F344-<i>Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup>22900932290112F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup>22900942290113F344-<i>Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermFam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup>22900982290114F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSlc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup>22900912290171F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantLOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup>22901192290078F344-<i>Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermMyo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup>22900682290079F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup>22900692290080F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup>22900742290081F344-<i>BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermBI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup>22900722290082F344-<i>Fam5c<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermFam5c<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup>22900712290083F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSlc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup>22900732290186SD-Tg(SOD1*G93A)39SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationtransgenic2290187SD-Tg(SOD1*H46R)4SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutationtransgenic2290135F344-<i>Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermChsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup>22901232290136F344-<i>Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSlc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup>22901272290137F344-<i>BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermBF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup>22901262290138F344-<i>Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantExtinctGlis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup>22901282290139F344-<i>AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantAW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup>22901222290140F344-<i>BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup>22901152290141F344-<i>Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermAbat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup>22901212290142F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantLOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup>22901182290143F344-<i>Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermNapb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup>22901162290144F344-<i>Lphn3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLphn3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup>22901292290145F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantBI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup>22901202290146F344-<i>Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPlce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup>22901252290147F344-<i>Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup>22901242290148F344-<i>Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantExtinctMap2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup>22901172290159F344-<i>Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup>22901502290160F344-<i>Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup>22901542290161F344-<i>Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantExtinctTmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup>22901562290162F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermInpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup>22901491642997SS-Tg(CAG-eGFP)23McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenic1643001FH/UncFawn-hoodedA substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hillinbred1643002SHR.WKY-(<i>D1Rat420-D1Got161</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRcongenicSpon16199182290163F344-Tg(T2/Bart3)2CebThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.transgenic2290164F344-<i>Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSyne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup>22901532290165F344-<i>Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermNtm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup>22901572290166F344-<i>Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPlcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup>22901552290167F344-<i>Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantDlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup>22901522290168F344-<i>Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantExtinctPde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup>22901512290169F344-Tg(PGK2-SB11)CebSB11 cDNA linked to human PGK2 promoter was used.transgenic2290170F344-<i>Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermCd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup>22901582290272SS/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki JapaninbredEmbryo; SpermCardio Hypertension2290298SHR-Tg(Thy1-MAPT)318SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391transgenic2290299SHR-Tg(Thy1-MAPT)72SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391transgenic2290386SD-Tg(Wld<sup>s</sup>)23ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changestransgenic2290387SD-Tg(UbC-APPswe)6590SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutationtransgenic2290391SD-Tg(Wld<sup>s</sup>)79ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changestransgenic2290429SS-Tg(ApoC3-CETP)53OpazSS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promotertransgenicEmbryo; Sperm2292168ISIAHInherited stress-induced arterial hypertensionSelected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stressinbred2292384SS.LEW-(<i>D10Chm167-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.congenic2292385SS.LEW-(<i>D10Mco30-D10Got107</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenic2292386SS.LEW-(<i>D10Chm155-D10Chm127</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenic2292387SS.LEW-(<i>D10Chm224-D10Chm259</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenic2292388SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.congenic2292389SS.LEW-(<i>D10Chm10-D10Chm14</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat13-D10Rat11</i>)/Ayd.congenic2292390SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenic2292451F344-<i>Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermStxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup>22924502292452F344-<i>Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSyndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup>22924492292453F344-<i>BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermBE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup>22924482292454F344-<i>RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantRGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup>22924472292459WF.LEW-<i>RVFV</i>Congenic Wistar Furth strain carrying genetic resistant to rift valley fever virus from the resistant Lewis rat straincongenicEmbryo; Sperm2292564ACI.COP-(<i>D6Rat80-D6Rat146</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenic2293354LEW.WKY-(<i>D16Rat88-D16Rat40</i>)/Tjasegment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsdcongenic2293355WKY.LEW-(<i>D16Rat88-D16Rat40</i>)/Tja22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrlcongenic2293729SHR-<i>Gja8</i><sup>m1Cub</sup>This strain is derived from SHR where a mutation is observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7QmutantGja86288902293761LH-Chr 17<sup>BN</sup>/MavChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomic2293770SHHF/BbbInitial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breedinginbred2293832LOU.BN-(<i>D6Rat128-D6Rat115</i>)/Inssegment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercrosscongenic2298494Kini:DA,PVG-G10Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG.1AV1 females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesadvanced_intercross_line2298498W/GaoxGenerated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine Universityinbred2298772WF<sup>fzHsd</sup>Fuzzy ratSparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987)mutantEmbryo; Sperm2292565ACI.COP-(<i>D3Mgh16-D3Rat119</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenic2292566ACI.COP-(<i>D3Rat130-D3Rat114</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenic2292567ACI.COP-(<i>D10Mgh20-D10Rat4</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenic2292647SS.LEW-(<I>D1Mco36-D1Rat106</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292648SS.LEW-(<I>D1Mco36-D1Mco77</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292649SS.LEW-(<I>D1Mco36-D1Rat131</I>)/1McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292650SS.LEW-(<I>D1Mco36-D1Rat131</I>)/2McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292651SS.LEW-(<I>D1Mco99-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292652SS.LEW-(<I>D1Mco85-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2292653SS.LEW-(<i>D1Mco36-D1Mco101</i>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2293012ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5<i>)/Sunn2 BBDP regions were introgressed into the ACI/SegHsd backgroundcongenic2293120LOU.BN-(<i>D10Mgh1-D10Mgh14</i>)/Inssegment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOUcongenicAce24932293143SS.BN-(<i>D13Rat20-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicRen35542292526SS-Tg(R-alpha1NK)48OpazSS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5transgenicEmbryo; Sperm2292527SS-Tg(RA1V9)64OpazDahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal.transgenicEmbryo; Sperm2292528F344-Tg(APPswe)OpazF344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promotertransgenicEmbryo; Sperm2292529LEW-Tg(Gt(ROSA)26Sor-luc)11JmskLEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI sitetransgenicSpermDevelopment2292530SD-Tg(Pou5f1-Dsred)This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells.transgenicEmbryo; Sperm2292531SD-Tg(Pou5f1-EGFP)This transgenic strain carries a random insertion of a construct containing mousetransgenicEmbryo; Sperm2292532F344-Tg(betaCTF-l45F)F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid proteintransgenicEmbryo; Sperm2293144SS.BN-(<i>D13Rat91-D13Rat179</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2293145SS.BN-(<i>D13Rat123-D13Rat101</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicRen35542293146SS.BN-(<i>D13Rat20-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2289819SS.MNS-(<i>D10Mco62-D10Got99</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289820SS.MNS-(<i>D10Mco30-D10Got91</i>)/1McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289821SS.MNS-(<i>D10Mco30-D10Got91</i>)/3McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289822SS.MNS-(<i>D10Mco30-D10Got112</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289823SS.MNS-(<i>D10Mco62-D10Mco30</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289824SS.MNS-(<i>D10Mco30-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289825SS.MNS-(<i>D10Rat24-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289826SS.MNS-(<i>D10Mco30-D10Got91</i>)/2McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289827SS.MNS-(<i>D10Mco30-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2289916SS.MNS-(<i>D10Mco15-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2301367SHRSP.WKY-(<I>D2Mit5-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenic2301368SHRSP.WKY-(<I>D2Wox15-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenic2301369SHRSP.WKY-(<I>D2Rat132-D2Rat53</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenic2301370SHRSP.WKY-(<I>D2Wox9-D2Rat231</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenic2301371SHRSP.WKY-(<I>D2Mit21-D2Rat157</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicGstm1|Vcam1|S1pr12755|3952|619582301700F344-<i>Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSpata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup>23016972301701F344-<i>Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPtpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup>23016982301702F344-<i>Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup>23016962301989BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenic2302132SHRSP-Tg(Tagln-ACE2)6918BdrTrangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryostransgenicTagln|ACE23723|13471742302651F344-<i>Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermKlra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup>23026382302652F344-<i>Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup>23026442302653F344-<i>Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermMov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup>23026472302654F344-<i>Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermCsmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup>23026372302655F344-<i>Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermTmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup>23026462302656F344-<i>Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCasp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup>23026422302657F344-<i>Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermOrc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup>23026482302658F344-<i>Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermBbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup>23026402301079F344-<i>Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup>23010782301080F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup>23010762301081F344-<i>Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermMmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup>23010772301937BN.GH-(<i>D18Rat41-D18Mgh4</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenic2301938BN.GH-(<i>D6Mit12-D6Rat15</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenic2301939BN.GH-(<i>D2Rat22-D2Mgh11</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenic2302080Rhd:F344,GK-G21GK/Swe and F344/Swe were bred to create F<sub>1</sub> generation, couples of F<sub>1</sub> with GK/Swe and F344/Swe females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding random couples which were intercrossed to get further generationsadvanced_intercross_line2302081DA.E3-(<i>D11Got79-D11Wox5</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markerscongenic2302082DA.E3-(<i>D11Got79-D11Rat50</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markerscongenic2302141F344-Tg(Cyp1a1-Ren2)10JmulGenerated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expressiontransgenicCyp1a1|Ren22458|16223752302659F344-<i>Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSnx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup>23026362302660F344-<i>Pvrl1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPvrl1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup>23026392302661F344-<i>Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermGramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup>23026352302662F344-<i>Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSlc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup>23026432303006SS.BN-(<i>D13Rat101-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303007SS.BN-(<i>D13Rat127-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2299123F344-<i>AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantAW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup>22991082299124F344-<i>Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermUbqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup>22991092299125F344-<i>Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermCcdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup>22991132299126F344-<i>Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermKcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup>22991002299127F344-<i>Fam176a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantFam176a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup>22990942299128F344-<i>Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup>22991032299129F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantLrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup>22991072299130F344-<i>Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermAda<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup>22990932299131F344-<i>Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermGrk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup>22991152299132F344-<i>Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup>22991162299133F344-<i>Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup>22990982299134F344-<i>Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPpapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup>22991052299135F344-<i>Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermMgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup>22991062299136F344-<i>Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSnph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup>22991172299137F344-<i>Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermErbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup>22991102299138F344-<i>Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermNrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup>22991182299139F344-<i>Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantDnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup>22991142299140F344-<i>Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermDcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup>22989382299141F344-<i>Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantPpp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup>22991042299142F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantInpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup>22990952299143F344-<i>Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermKif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup>22991112299144F344-<i>Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermTrdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup>22990992299145F344-<i>Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantRprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup>22990962299146F344-<i>Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantPtpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup>22990972299147F344-<i>Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPrr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup>22991122299148F344-<i>Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermImmp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup>22991022300215SHR.BN-(<i>D10Mgh3-D10Rat85</i>)/IpcvCongenic substrain derived from SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcvcongenic2300216SHR-Tg(PEPCK-SREBF1)1IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signaltransgenicSREBF1694732300217SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv backgroundcongenic2301330KHDevelped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahomainbred2302108SHRSP.WKY-(<I>D1Mgh5-D1Wox29</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicEmbryoCardio Hypertension2302109SHRSP.WKY-(<I>D1Mgh5-D1Rat44</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicEmbryoCardio Hypertension2302110SHRSP.WKY-(<I>Apbb1-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicEmbryoCardio Hypertension2302148SHR-Tg(Ef1a-Cd36)10IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicCd3623012302149SHR-Tg(Ef1a-Cd36)19IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicCd3623012302150SHR-Tg(Ef1a-Cd36)93IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicCd3623012302151SHR-Tg(Ef1a-Cd36)106IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicCd3623012300018SHRSP.ZUC-(<i>D5Rat4-D5Rat36</i>)/IzmDmcrSelective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/IzmcongenicLive AnimalsDiabetes Obesity; Cardio Hypertension2302067F344/DuCrlSweSubstrain of Fischer rats maintained at Malmo, Swedeninbred2302279F344.SDT-(<i>D3Wox9-D3Arb20</i>)/KbeFemale F344/NSlc were crossed with male SDT/CrljJcl, then female F<sub>1</sub> were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markerscongenic2302387DA.ACI-(<i>D2Mit12-D2Mgh29</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsicongenicSpermarthritis/autoimmunity studies2302666Scr:sPSardinian alcohol-preferring ratssP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding.outbred2302984SS.BN-(<i>D13Rat151-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302985SS.BN-(<i>D13Rat111-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302987SS.BN-(<i>D13Rat7-D13Rat60</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302989SS.BN-(<i>D13Rat57-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303009SS.BN-(<i>D13Rat183-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303010SS.BN-(<i>D13Got51-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303011SS.BN-(<i>D13Got51-D13Rat57</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303099F344-<i>Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermKcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup>23030952303100F344-<i>Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSlc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup>23030972303101F344-<i>Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermKcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup>23030942303102F344-<i>Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermDnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup>23030982303103F344-<i>Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup>23030962300195EHC.BN-(<i>D14Rat43-D14Rat132</i>)/KyuEHC/Seac and BN/Seac were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenicscongenic2302106SHRSP.WKY-(<I>D1Rat44-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicEmbryoCardio Hypertension2302994SS.BN-(<i>D13Rat127-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302996SS.BN-(<i>D13Rat7-D13Rat88</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302997SS.BN-(<i>D13Rat91-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2302999SS.BN-(<i>D13Rat178-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303001SS.BN-(<i>D13Rat111-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303002SS.BN-(<i>D13Rat123-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303003SS.BN-(<i>D13Rat7-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303004SS.BN-(<i>D13Rat115-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303005SS.BN-(<i>D13Rat127-D13Rat77</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303008SS.BN-(<i>D13Rat61-D13GRat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic2303116SPRD.WKY-(<i>D10Rat91-D10Rat135</i>)/IbmmSPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenic2313209WF.ART2/Wordeveloped at the Universtiy of Massachusetts, Medical Schoolcongenic2313231LEWBNF1/CrlThis hybrid rat is a cross between a LEW female and a BN male rat.hybrid2301246SS.LEW-(<i>D3Rat61-D3Wox1</i>)/AydA segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic2301247SS.LEW-(<i>D16Got3-D16Rat112</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Mit2-D16Chm23</i>)/Aydcongenic2301248SS.LEW-(<i>D3Got33-D3Chm68</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Aydcongenic2301249SS.LEW-(<i>D18Rat30-D18Chm29</i>)/AydA segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenic2301315LE/OrlLong-Evans/CryptorchidObtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, Delawareinbred2301381SS.LEW-(<I>D18Chm41-D18Rat92</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301382SS.LEW-(<I>D18Chm91-D18Rat67</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301383SS.LEW-(<I>D18Chm31-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301384SS.LEW-(<I>D18Chm41-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301385SS.LEW-(<I>D18Rat29-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301386SS.LEW-(<I>D18Rat61-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301387SS.LEW-(<I>D18Rat67-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301388SS.LEW-(<I>D18Chm56-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic2301986BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenic2301987BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)/Mcwidesired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh backgroundcongenic2301988BN.GH-(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenic2302649F344-<i>Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermNsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup>23026452302650F344-<i>Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermEnox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup>23026412303761SD-Tg(CAG-EGFP)4OsbGreen ratThis transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc.transgenicLiving Animals2304041SD-Tg(CAG-Rgn)SlcTransgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and Rgn genetransgenicLiving AnimalsOsteosisRgn35602304063KDP-Tg(H2Kd-Cblb)2NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304064KDP-Tg(H2Kd-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304065KDP-Tg(INS-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304066KDP-Tg(CAG-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicCblb6205352304093SHRSP.WKY-(<i>D1Rat106-D1Arb21</i>)/IzmDeveloped by the depositorcongenicEmbryoCardio Hypertension2304094SHRSP.WKY-(<i>D1Smu12-D1Rat44</i>)/IzmThis is a congenic strain developed by the depositor.congenicCardio Hypertension2304095W-Tg(Plcb2-WGA,-EGFP)F1AbekThis is a transgenic strain developed by the depositor.transgenicEmbryo2304096SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/1IzmDeveloped by the depositorcongenicEmbryoCardio Hypertension2304097SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/2IzmThis is a congenic strain developed by the depositor.congenicEmbryoCardio Hypertension2304098SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/IzmDeveloped by the depositorcongenicEmbryoCardio Hypertension2304099SHRSP.WKY-(<i>D1Smu12-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicEmbryoCardio Hypertension2304100SHRSP.WKY-(<i>D1Rat39-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicEmbryoCardio Hypertension2304101SHRSP.WKY-(<i>D1Rat43-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicEmbryoCardio Hypertension2304102SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmThis is a congenic strain developed by the depositor.congenicEmbryoCardio Hypertension2304241F344-Tg(CXCR4)1HikTransgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj.transgenicEmbryo; SpermInfectiousCXCR47321762303739RDW/UmeSlcFrom Tohoku University to Slc (1999)mutantLiving AnimalsMetabolism2304200W-Tg(CAG-ABO*A)32JmskThis transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicEmbryoHematologyGbgt16286092304201F344-<i>Galntl6<sup>Tn(sb-T2/Bart3)2.311McwiRrrc</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermGalntl6<sup>Tn(sb-T2/Bart3)2.311Mcwi</sup>23041942304202F344-<i>RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup>23041932304203W-Tg(CAG-DsRed2/GFP)1JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.transgenicEmbryoDevelopment2304204W-Tg(CAG-ABO*B)13JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicEmbryoHematologyGbgt16286092304205W-Tg(Alb-DsRed2)34JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.transgenicEmbryo; SpermDevelopment2304206W-Tg(CAG-DsRed2/GFP)15JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.transgenicEmbryo; SpermDevelopment2304207F344-<i>Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup>23041962304208F344-<i>Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup>23041972304209F344-<i>Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantRorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup>23041992304210W-Tg(Alb-DsRed2)42JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.transgenicEmbryo; SpermDevelopment2304211W-Tg(CAG-cre)81JmskThis strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School.transgenicEmbryoDevelopment2304212F344-<i>RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup>23041982304213F344-<i>Leprel2<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLeprel2<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup>23041952304214W-Tg(CAG-ABO*B)2JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicEmbryoHematologyGbgt16286092304215F344-Tg(XPO1)1HikF344/DuCrj Tg rat inoculated with human crm1 genome (BAC)transgenicEmbryo; SpermCancer; Infectious2303640WAG/RijCmcrSubstrain of WAG/Rij, separated from the Rijswijk colony in about 1975, now maintained at Medical College of Wisconsininbred2303785SHRSP-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2304074WKY.BUF-<i>Tsr1d</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred.congenicEmbryoCancer2304075ACI.BUF-<i>Pur1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred.congenicEmbryoUrology2304076WKY.BUF-<i>Ten1 Ten2</i>/MnaThis double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) and Ten2 (on chr. 13) has been transferred.congenicEmbryoCancer2304077WKY.BUF-<i>Pur1s</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.congenicEmbryoUrology2304078ACI.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.congenicEmbryo2304079WKY.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.congenicEmbryo2304080ACI.BUF-<i>Aftm1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.congenicEmbryo; Sperm2304081WKY.BUF-<i>Pur1w</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.congenicEmbryoUrology2304082WKY.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.congenicEmbryoUrology2304083ACI.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.congenicEmbryo2304221WTC-<i>swh</i>/KyoThe rat showed abnormal hair texture and mammary gland hypoplasia was occurred in the WTC.ZI-<i>Atrn<sup>zi</sup></i> colony at the National Cancer Center Research Institute in 1998. After elimination of <i>zi</i> allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002.mutantLive Animals; Embryo; SpermDermatology2304222WIAR/IarWistar-ImamichiStrain developed by the depositorinbredEmbryo; SpermMetabolism; Development2303779OLETF-Chr 14<sup>F344</sup>/TjChromosome 14 from F344 is introgressed in OLETF backgroundconsomicEmbryoDiabetes Obesity2303971OLETF.F344-(<i>D7Mgh16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303972BN-Chr 13<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressedconsomic2303973OLETF.F344-(<i>D10Wox7-D10Wox6</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303976F344-<i>Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermCyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup>23039742303977F344-<i>Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermAno3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup>23039752304016BUF.ACI-(<i>D4Rat192-D4Rat66</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.congenicEmbryo; SpermCancer2304017F344.CVD-<i>Unc5c<sup>cvd</sup></i>/KyoSpontanious mutation from LEW inbred at Osaka Prefecture University in 1992. A congenic strain was produced by backcrosses to F344/NSlc strain at Kyoto University.congenicEmbryo; SpermNeurobiology2304018BUF.ACI-(<i>D4Rat226-D4Rat109</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.congenicEmbryo; SpermCancer2304019BUF.ACI-(<i>D15Rat68-D15Rat29</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method.congenicEmbryo; SpermCancer2304020ACI.BUF-(<i>D15Rat97-D15Rat29</i>)/NccThis congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method.congenicEmbryo; SpermCancer2304045F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304046F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D7Rat16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304047F344.ZUC-<i>Lepr<sup>fa</sup></i>/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating.congenicEmbryo; SpermDiabetes ObesityLepr30012304050F344.OLETF-(<i>D14Rat23-D14Rat55</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303148SS.SHR-(<i>D9Wox16-D9Rat76</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2303149SS.SHR-(<i>D9Wox16-D9Mco73</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region.congenic2303150SS.SHR-(<i>D9Mco74-D9Rat64</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2303151SS.SHR-(<i>D9Wox16-D9Mco77</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2303152SS.SHR-(<i>D9Mco72-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2303153SS.SHR-(<i>D9Rat7-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2303154SS.SHR-(<i>D9Wox16-D9Mco85</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2304051F344.OLETF-(<i>D14Rat8-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304052F344.OLETF-(<i>D14Rat55-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304053F344.OLETF-(<i>D14Rat23-D14Rat5</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304054F344.OLETF-(<i>D14Rat23-D14Rat10</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304055F344.OLETF-(<i>D14Wox1-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304056F344.OLETF-(<i>D14Rat23-D14Wox14</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304057F344.OLETF-(<i>D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303117SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)(<i>D18Rat102-D18Rat44</i>)/IbmmDouble congenic strain generated by intercrossing SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm and SPRD.WKY-(<i>D18Rat102-D18Rat44</i>)/Ibmm; F<sub>1</sub> animals were intercrossed and F<sub>2</sub> screened for heterozygousity by markerscongenic2303504LEW/JmsNgscongenital hydrocephalus ratLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.inbredLive Animals; Embryo; SpermNeurobiology; Ophthalmology2303978F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304058F344.OLETF-(<i>D14Rat143-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304059F344.OLETF-(<i>D14Rat5-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304060F344.OLETF-(<i>D14Wox14-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304061F344.OLETF-(<i>D14Rat23</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304104W-Tg(Plcb2-WGA,-EGFP)M1AbekThis is a transgenic strain developed by the depositor.transgenicEmbryo2304120SHRSP/2TaKyo > Ta (1972)inbredEmbryo; SpermCardio Hypertension2304121DA.WF-(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicEmbryoCancer2304122DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicEmbryoCancer2304123DA.WF-(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicEmbryoCancer2304124DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicEmbryoCancer2304125DRH.F344-(<i>D1Mgh8-D1Mgh12</i>)/Shigmdesired fragment from F344 was introgressed into DRH backgroundcongenicEmbryo; SpermDiabetes Obesity; Cancer2303610SD/HsdCwrderived from SD/Hsd by cousin-cousin mating for more than 20 generationsinbred2303611BN/HsdMcwiCwrderived from BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister matinginbred2303979F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303986WKAH.LEC-<i>Atp7b<sup>hts</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.congenicEmbryo; SpermCancer2303987F344.OLETF-(<i>D17Mgh4-Edn1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303988F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303989F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303990F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303991F344.OLETF-(<i>D7Rat31-D7Rat35</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303992F344.OLETF-(<i>D5Mgh29-D5Mgh22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303993OLETF.F344-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303994F344.OLETF-(<i>D5Mgh4-D5Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303995F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303996F344.Cg-<i>Foxn1<sup>rnu</sup></i>/KyoThis congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University.congenicLive Animals; Embryo; SpermImmunology; CancerFoxn139702303792WTC.ZI-<i>Atrn<sup>zi</sup></i>/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto UniversitycongenicLive Animals; Embryo; SpermNeurobiology2303793WTC.DMY-<i>dmy</i>/KyoCongenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto UniversitycongenicLive Animals; Embryo; SpermNeurobiology2303997F344.OLETF-(<i>D7Mgh8-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2303998WKAH.LEC-<i>Ptprk<sup>thid</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.congenicEmbryoCancer2303999F344.OLETF-(<i>D14Rat8-D14Rat26</i>)(<i>D14Rat18-D14Rat22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304000F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304001F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304002F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304003F344.OLETF-(<i>D16Rat19-D16Rat13</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304004F344.OLETF-(<i>D7Mit2-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicEmbryoDiabetes Obesity2304037DDI/Ddiadokkyo diabetes insipidus ratStrain developed at Dokkyo University, School of Medicine, Tochigi, JapaninbredEmbryo; SpermMetabolism; Urology2304038OP/JttOpacitasMaintained in sib mating between opacitas rats (heterozygoutes) and normal rats.mutantEmbryo; SpermOphthalmology2304039WIC-Tg<i><sup>rdw</i>Kts</sup>Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.mutantEmbryo; SpermMetabolism2304040F344.OP-<i>Op</i>/JttOpacitas rats (heterozygtes) are backcorssed with F344/DuCrj.congenicSpermOphthalmology2307077HXB4/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307078HXB27/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307079HXB3/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307080HXB20/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307081HXB31/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307082HXB18/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307083HXB10/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307084HXB24/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307085HXB17/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307086HXB7/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307087SHR.BN-(<i>D18Rat32-D18Rat12</i>)/IpcvA segment of chr 18 from BN was introgressed into the SHR backgroundcongenic2307088HXB22/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307089HXB29/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307090SHR.BN10/IpcvA segment of chr 10 from BN was introgressed into the SHR backgroundcongenic2307091HXB13/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307092HXB14/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307093HXB23/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307094HXB1/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307095HXB15/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307096HXB2/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307097HXB21/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307098HXB25/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2307099HXB5/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbred2313588SD-Tg(Ins2-IAPP)SoelCrl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promotertransgenic2308816Crl:WI(Han)Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL. Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system.outbred2306717BBDP/WorSunnThese originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada.inbred2306823SS.SR-(<i>D3Arb14-D3Mco36</i>)(<i>D7Mco19-D7Mco7</i>)/McoSS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco were crossed with SS.SR-(<i>D7Mco19-D7Mco7</i>)/Jr and then F<sub>1</sub> rats were backcrossed with SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bredcongenic2307156DA/ZtmKiniSubstrain of DA, to Hannover after 1965, now at Stockholm, Sweden.inbred2307157PVG.1AV1/KiniOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden.congenic2314009NMcwi:HSHeterogeneous stock25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generation; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. We use a rotational delay of 1, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc.outbred2312504Crlj:WIWistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981)outbred2313922F344.LEW-(<i>D10Rat142-D10Rat15</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markerscongenic2313923LEW.F344-(<i>D10Rat99-D10Rat11</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markerscongenic2313924LEW-Chr Y<sup>F344</sup>/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markersconsomic2308851Crl:OP(CD)Obese Prone RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD).outbred2308852Crl:LELong-Evans RatsOriginated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978.outbred2308853Crl:OR(CD)Obese Resistant RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets.outbred2314375LE.AR-<i>Ednrb<sup>Sl</i></sup>/OkkmAR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).congenicEmbryoInternal OrganEdnrb25362314376KFRS4/KyoA male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac.mutantLive AnimalsOphthalmology; Dermatology2314377KFRS3B/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding.mutantSpermOphthalmology; Dermatology2314378AR-<i>Ednrb<sup>Sl</i>Okkm</sup>Aganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR)mutantEmbryoInternal OrganEdnrb25362314379KFRS6/KyoA male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo.mutantLive AnimalsDermatology2314380SD-Tg(CAG-lacZ)541HtsuDeveloped by the depositortransgenicSperm2314381KFRS5A/KyoA male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo.mutantSpermDermatology2314382SD-Tg(CAG-HRAS*G12V)250HtsuThis transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promotertransgenicSpermCancerHRAS7308812314383KFRS3A/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.mutantSpermOphthalmology; Dermatology2305987F344.OLETF-(<i>D7Mgh16-D7Wox46</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305988(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2305989(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Z-Lepr<sup><i>fa</i></sup>/Tj</i>)F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2305990F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305991(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj X F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2305992F344.OLETF-(<i>D7Mit16-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305993F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305994F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/1TjDeveloped by the DEPOSITORcongenicDiabetes Obesity2305995F344.OLETF-(<i>D7Got130-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305996F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305997(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/2Tj x F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2305998F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D8Rat54-D8Mgh17</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305999F344.OLETF-(<i>D7Mgh16-D7Rat70</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306000F344.OLETF-(<i>D7Rat70-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306001F344.OLETF-(<i>D7Rat176-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306041F344-<i>Scn1a<sup>m2Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Scn1a gene.mutantSpermNeurobiologyScn1a693642306042F344-<i>Scn1a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Scn1a gene.mutantLive Animals; SpermNeurobiologyScn1a693642306043SHR/4DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressureinbredLive AnimalsCardio HypertensionCd3623012306044SHRSP/3DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A4 lineinbredLive AnimalsCardio HypertensionCd3623012306045SHR/2DmcrDeveloped by the DEPOSITOR, one of the SHR substrains from B2 lineinbredLive AnimalsCardio HypertensionCd3623012306046W-Tg(CAG-EGFP)3YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.transgenicLive Animals; Embryo2306047W-Tg(Gnrh1-EGFP)NphyThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence.transgenicLive Animals; Embryo; SpermGnrh127202306048SHR/3DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressureinbredLive AnimalsCardio HypertensionCd3623012306049SHRSP/4DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosisinbredLive AnimalsCardio HypertensionCd3623012306050SHRSP/5DmcrDeveloped by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosisinbredLive AnimalsCardio HypertensionCd3623012306051SHRSP/2DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A1sb lineinbredLive AnimalsCardio HypertensionCd3623012306002F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/1TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306003F344.OLETF-(<i>D7Wox46-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306004F344.OLETF-(<i>D7Mgh16-D7Mit16</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2312498WAG/RijCrlWAG RatsA.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993.inbred2312499Crl:NIH-<i>Foxn1</i><sup>rnu</sup>Nude RatsThe NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs.outbred2312644DA.WOKW-(<i>D3Mit10-D3Rat189</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundcongenic2312645DA.WOKW-(<i>D16Rat88-D16Wox7</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K backgroundcongenic2312646DA.WOKW-(<i>D5Mgh6-D5Mit5</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K backgroundcongenic2312647DA.WOKW-(<i>D3Mgh5-D3Rat1</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundcongenic2312648DA.WOKW-(<i>D10Mgh2-D10Rat4</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K backgroundcongenic2314414LEW-Tg(FH1t(Insr)UTG)87HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promotertransgenicInsr29172314415LEW-Tg(FH1t(Insr)UTG)4HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promotertransgenicInsr29172306070WIC-Tg(Wap-GH1)1MniDeveloped by the DEPOSITORtransgenicSpermDiabetes Obesity; Metabolism2306071F344-Tg(CAG-EGFP)NccoTransgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection methodtransgenicLive Animals; Embryo; SpermDiabetes Obesity; Cancer; Metabolism2306072ACI.F344-(<i>D16Nkg74</i>)/NkgA sub congenic strain of ACI/N.F344-(<i>D16Rat12-D16Mco2</i>)/NkgcongenicEmbryo; SpermCancer2306073WIC-Tg(Wap-GH1)2MniDeveloped by the DEPOSITORtransgenicSpermDiabetes Obesity; Metabolism2306076ACI.F344-(<i>D16Nkg9-D16Nkg38</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals.congenicEmbryo; SpermCancer2306077ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating.congenicEmbryo; SpermCancer2306078KFRS4A/KyoDeveloped by the DEPOSITORmutantSpermNeurobiology; Behavior2306079ACI.F344-(<i>D16Nkg87-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals.congenicEmbryo; SpermCancer2312577SHR.BN-(<i>D18Rat99-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenic2312578SHR.BN-(<i>D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenic2312579SHR.BN-(<i>D18Rat40-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenic2312580SHR.BN-(<i>D18Rat113-D18Rat82</i>)/IpcvSHR/OlaIpcv were crossed with BN/Crl, F<sub>1</sub> animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotescongenic2305939SHRSP.WKY-(<i>D9Mit6-D9Rat83</i>)/TkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2305940SHRSP-Chr 7<sup>WKY</sup>/TkyoChromosome 7 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305941SHR-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHRconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305942SHR-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305943SHRSP-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305944SHRSP-Chr 4<sup>WKY</sup>/TkyoChromosome 4 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305945SHRSP-Chr 13<sup>WKY</sup>/TkyoChromosome 13 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305946SHR-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHRconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305947SHR-Chr 19<sup>WKY</sup>/TkyoChromosome 19 from WKY is introgressed into the genomic background of SHRconsomicEmbryoDiabetes Obesity; Cardio Hypertension2305948SHRSP.WKY-(<i>D8Rat77-D8Rat16</i>)(<i>D8Tkyo10</i>)/TkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2305949SHRSP-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHRSPconsomicEmbryoDiabetes Obesity; Cardio Hypertension2306013F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306014F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306015F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306016F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306017(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2306018F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306019F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2307159SHRSR.SHRSP-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2312609MWF-Chr 8<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossingconsomic2314368F344-<i>Trdk</i>/KyoTremor dominant KyotoMutant rat that showed tremor was found in the G1 rats that established by ENU mutagenesis (phenotype driven).mutantSpermNeurobiology2306089ACI.BUF-(<i>D7Wox16-D7Rat69</i>)/MnaThe thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing.congenicSpermCancer2306020(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2306021SHR-Chr 2<sup>WKY</sup>/TkyoDeveloped by the DEPOSITORconsomicEmbryoDiabetes Obesity; Cardio Hypertension2306022KCI/KyoRats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003.mutantSpermNeurobiologyPcdh1515909692306023F344-Tg(CCNT1)1HikDeveloped by the DEPOSITORtransgenicSpermInfectiousCCNT113224572306024FOK/NcuFuruyama ratThese are resistant to hot environment.inbredEmbryo; Sperm2306025WMN/NrsDeveloped by the DEPOSITORinbredLive Animals; EmbryoCancer; Metabolism2306026F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306027WM/NrsDeveloped by the DEPOSITORinbredLive Animals; EmbryoCancer; Metabolism2306028F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306029(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITORcongenicEmbryoDiabetes Obesity2306030F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306085TCR/IbuToyoda Circling RatA male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007.mutantSpermNeurobiology; Behavior2306098ACI.F344-(<i>D16Nkg30-D16Mgh6</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.congenicSperm2306099SHR.WKY-(<i>D15Tkyo3-D15Rat68</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306100SHR.WKY-(<i>D3Tkyo7-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306101LEC.BN-(<i>D4Mgh16-D4Rat233</i>)/HkvDeveloped by the DEPOSITORcongenicSperm2306102BN.LEC-(<i>D4Rat128-D4Rat106</i>)/HkvDeveloped by the DEPOSITORcongenicSperm2305966SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305967SHR.SHRSP-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305968SHRSP.WKY-(<i>D1Wox18-D1Rat39</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305969SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305970DA-Tg(Alb-TTR*V30M)7JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.transgenicEmbryoDevelopment2305971SHRSP.SHR-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305972WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305973SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305974WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)/IzmDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2305975SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity2305976DA-Tg(Alb-TTR*V30M)9JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.transgenicEmbryoDevelopment2305977ACI.F344-(<i>D16Rat12-D16Mco2</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals.congenicEmbryo; SpermCancer2305978LEW-Tg(Gt(ROSA)26Sor-DsRed*)7JmskThis strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School.transgenicEmbryoDevelopment2305979WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2306103SHRSP/SumsDeveloped by the DEPOSITORinbredEmbryo2306104BN.LEC-(<i>D4Rat184-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicSperm2306105BN.LEC-(<i>D4Rat128-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicSperm2306106CLX/TaCircling behavior linked to the X-chromosome (CLX)Developed by the DEPOSITORmutantEmbryoBehavior2306815SS.SR-(<I>D7Rat67-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenic2306816SS.SR-(<I>D7Mco19-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenic2306817SS.SR-(<I>D7Uia1-D7Mco19</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenic2306818SS.SR-(<I>D7Rat131-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenic2306819SS.SR-(<I>D7Uia1-D7Rat131</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenic2306820SS.SR-(<i>D3Arb14-D3Mco36</i>)/McoSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenic2313734SD-Tg(Insr-shRNA)29BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promotertransgenic2313735SD-Tg(Insr-shRNA)14BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promotertransgenic2314904WAG-F8<i><sup>m1Ycb</i></sup>Natural mutation found in the WAG/RijYcbmutantF8<i><sup>m1Ycb</i></sup>23149032306033SHR.Cg-<i>Lepr<sup>cp</sup></i>/NDmcrNonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999.congenicLive AnimalsDiabetes Obesity; Cardio Hypertension2306034NER.F344-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Rat100-D5Rat234</i>)/KyoDeveloped by the DEPOSITORcongenicSpermNeurobiology2306035F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)/KyoThis double congenic strain was established by crossing F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo and F344.NER-(<i>D5Mgh4-D5Rat36</i>)/KyocongenicLive AnimalsNeurobiology2306036F344-<i>Apc<sup>m1</i>Kyo</sup>F344/NSlc rats that have an induced mutation in the Apc gene; Established by ENU mutagenesis (gene-driven).mutantLive Animals; SpermCancerApc21232306037F344-Tg(CD4)1HikDeveloped by the DEPOSITORtransgenicSpermInfectious2306107SD-Tg(Sp6)58TjThe transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.transgenicSpermDentistry; DevelopmentSp613067682306108SHR.WKY-(<i>D3Mit9-D3Wox16</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306109SHR.WKY-(<i>D3Mgh6-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306110IER/SumsDeveloped by the DEPOSITORinbredEmbryoNeurobiology2306111LEC.BN-(<i>D4Mgh16-D4Rat233</i>)(<i>D4Rat271-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicSperm2306112ZDF-<i>Lepr<sup>fa</i>CrlCrlj</sup>Developed by the DEPOSITORmutantLive Animals; EmbryoDiabetes ObesityLepr30012306113SD-Tg(Sp6)6TjDeveloped by the DEPOSITORtransgenicSpermDentistry; DevelopmentSp613067682306114SHR.WKY-(<i>D3Mgh16-D3Rat110</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306115SHR.WKY-(<i>D3Mgh16-D3Rat166</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306116SD-Tg(Sp6)5TjThe transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.transgenicSpermDentistry; DevelopmentSp613067682306117ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.congenicSperm2306118SHR.WKY-(<i>D15Rat95-D15Rat106</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2307441F344-<i>Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermCyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup>23074402307442F344-<i>Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRobo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup>23074392306119F344-Tg(CD4,CCNT1)1HikDeveloped by the DEPOSITORtransgenicSpermInfectious2306120SHR.WKY-(<i>D4Wox27-D4Rat15</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicSpermDiabetes Obesity; Cardio Hypertension2306784Kini:DA,PVG-G12Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1<sup>a</sup> MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG/OlaHsd females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesadvanced_intercross_line2306874F344-<i>Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermIntu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup>23068732306875F344-<i>Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantFaslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup>23068722306961RLA/VerhRoman low avoidanceBignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgiuminbred2306962RHA/VerhRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgiuminbred2307160SHRSR.SHRSP-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2312466Crl:LISLister Hooded RatThese rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance.outbred2312518Crlj:ZUC-<i>Lepr</i><sup>fa</sup>Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000)outbred2313181LEW.1WR1/WorBrmObtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc.congenic2313232WFF344F1/CrlThis hybrid rat is a cross between a WF female and a F344 male rat.hybrid2314530SS.SHR-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their female F<sub>1</sub> were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markerscongenic2314531SHR.SS-(<i>D13Rat1-D13Mgh6</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markerscongenic2314532SHR.SS-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markerscongenic2307317MHSMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureoutbred2307318BDIX/Ifzderived from Berlin-Druckrey strain BDIXinbred2307319MNS/NMilan normotensive strainWistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.inbredEmbryo2311082SS-Chr 13<sup>BN</sup>/McwiCrlDeveloped at the Medical College of Wisconsin. To Charles River in 2003.consomic2307115BXH5/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307116PXO3-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307117PXO5-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307118PXO9/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307119PXO7-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307120PXO7-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307121BXH2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307122PXO8-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307123BXH13/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307124BXH10/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307125PXO6-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307126BXH8/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307127BXH11/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307128PXO5-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307129BXH9/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307130PXO6-3/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307131PXO8-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307132PXO10/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307133BXH12-2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307134BXH3/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307135PXO4/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307136BXH6/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307137PXO6-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307138PXO1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307139BXH12-1/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbred2307355PXO3-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307155SHR/1NCrlTo Charles River from NIH in 1973 at F32.inbred2314934WST.F344-<i>Ker</i>/KyoWistar/ST-BooThis congenic strain was established by backcrossing F344-<i>Ker</i>/Kyo (NBRP No.0458) onto Slc:WSTcongenicSperm2314935WST.F344-<i>Kmch</i>/KyoWistar/ST-KomachiThis congenic strain was established by backcrossing F344-<i>Kmch</i>/Kyo (NBRP No.0458) onto Slc:WST.congenicSperm2314936WI-Tg(WSCD2)TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSperm2314937F344.OLETF-(<i>D5Mgh20-D5Mgh22</i>)/TjDeveloped by the depositorcongenicEmbryoDiabetes Obesity2304242WTC-Kcnq1<i><sup>dfk</i>Kyo</sup>Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-<i>Kcnq1<sup>dfk</sup></i>/Kyo rat is a mutant for circling behavior. although the Atrn<sup>zi</sup> allele of WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic rats was eliminated, the circling behavior remained.mutantSpermOtorhinology; Internal OrganKcnq16215032307356PXO2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbred2307357BDV/ZtmDeveloped from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles.inbred2307358LUDW/OlaHsdLudwigWistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979.inbredCryopreserved2307359BUF/SimRijHsdDeveloped by Heston in 1946 from a Buffaloinbred2307360DA.BI.RT1i-(<i>D20Rat42-D20Rat31</i>)/RhdRT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han.congenic2314861WAG/RijYcbSubstrain of WAG/Rij; from Netherlands to Yale University.inbred2314928Slc:WSTInstitute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain.outbred2313693SHR-Tg(PEPCK-SREBF1)2IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signaltransgenic2306709BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/3RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenic2306710F344-<i>Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermLmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup>23067012306711F344-<i>FM117003<sup>Tn(sb-T2/Bart3)2.321McwiRrrc</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermFM117003<sup>Tn(sb-T2/Bart3)2.321Mcwi</sup>23067032306712BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/2RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenic2307166SHRSP.SHRSR-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2307167SHRSP.SHRSR-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2307168SHRSR/BbbSpontaneously Hypertensive Rat, Stroke ResistantThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany.inbred2307169SHRSP.SHRSR-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2308885GK/CskCrljCrlThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006.inbred2308886SS/HsdMcwiCrlInbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001.inbred2312352LEW.1NThese congenic rats carry the RTl<sup>n</sup> haplotype on the LEW strain genetic background.congenic2314477LEW-<i>RT1<sup>DA</i></sup>/RrrcSprague-Dawley RT1<sup>u</sup> haplotype backcrossed onto Lewis inbred strain.congenicEmbryo; Sperm2314478LEW-<i>RT1.B<sup>m1Trg</i></sup>/RrrcRT1.BENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain.mutantEmbryo; Sperm2314492SBN.SBH-(<i>D1Rat148-D1Rat89</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Yglcongenic2314493SBH.SBN-(<i>D1Mgh2-D1Rat74</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314494SBH.SBN-(<i>D1Rat137-D1Rat123</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314495SBN.SBH-(<i>D1Rat27-D1Mit7</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Yglcongenic2314496SBH.SBN-(<i>D1Mgh2-D1Mgh11</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314497SBN.SBH-(<i>D1Rat101-D1Rat74</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Yglcongenic2314498SBH.SBN-(<i>D1Rat137-D1Rat83</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314499SBN.SBH-(<i>D1Mgh17-D1Mgh14</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Yglcongenic2314500SBH.SBN-(<i>D1Mgh2-D1Rat101</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314501SBH.SBN-(<i>D1Wox11-D1Rat137</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Yglcongenic2314339F344-<i>Inadl<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermInadl<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup>23143352314340F344-<i>Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantAcoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup>23143372314341F344-<i>Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantAuts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup>23143382314342F344-<i>Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantPalld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup>23143362306276F344-<i>Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermExoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup>23062732306277F344-<i>Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermGng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup>23062742306278F344-AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermAW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>23062722306279F344-<i>Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermDiaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup>23062752314161F344-<i>Kuru1</i>/KyoKuru1A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantSperm2314162F344-<i>Oune</i>/KyoOuneA mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantLive Animals; Sperm2314163F344-<i>Adms</i>/KyoADMS (autosomal dominant myokymia and seizures) ratThis strain was established by phenotype-driven ENU mutagenesis.mutantLive Animals; Sperm2314164F344-<i>Kuru2</i>/KyoKuru2A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantSperm2314165ACI-<i>Chib</i>/KyoChibiThis strain was established by phenotype-driven ENU mutagenesis.mutantSpermDermatology2314166F344-<i>Tbr2</i>/KyoTsubura2A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantSperm2314167F344-<i>Kmch</i>/KyoKomachiThis strain was established by phenotype-driven ENU mutagenesis.mutantLive Animals; Sperm2314168F344-<i>Tbr1</i>/KyoTsubura1A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantSperm2314169WTC.F344-<i>Scn1a<sup>m1Kyo</sup></i>/KyoThis congenic strain was established by backcrossing F344-<i>Scn1a<sup>m1Kyo</sup></i> onto WTC/Kyo.congenicLive Animals; Sperm2314170F344-<i>Egr<sup>m1Kyo</i></sup>EGR (Excessive Grooming Rat), Kaikai, Kyo1897This strain was established by phenotype-driven ENU mutagenesis.mutantSperm2314360ACI.F344-(<i>D16Mit5-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals.congenicSpermCancer2314361W-Tg(Slc32a1-YFP*)1YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.transgenicLive Animals; SpermNeurobiology; Development2314362F344-<i>Hrdk</i>/KyoHairless dominant KyotoHairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven).mutantSperm2314363W-Tg(Slc32a1-YFP*)2YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.transgenicLive Animals; SpermNeurobiology; Development2311070BUF/CrCrlHeston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbred2311071ZDF-<i>Lepr<sup>fa</sup></i>/CrlA mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001.coisogenic2311072FHH/EurMcwiCrlAn outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001.inbred2311073NBL/CrCrlBogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998.inbred2311074BDIX/CrCrlDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbred2314027SDT.ZDF-<i>Lepr<sup>fa</sup></i>/JttSDT fatty<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic methodcongenic2306532BBDR.F344-(<i>D4Rat27-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenic2306533BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/2RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhwcongenic2306534BBDR.F344-(<i>D4Rat102-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhwcongenic2306535BBDR.F344-(<i>D4Rat253-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhwcongenic2306536BBDR.F344-(<i>D4Arb11-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing male BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw and female BBDR/Rhwcongenic2306537BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/1RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhwcongenic2306538BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutationcongenic2306539BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/3RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenic2306540BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenic2306541BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedcongenic2306542BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenic2306543BBDR.F344-(<i>D4Got59-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedcongenic2304277SHRSP.WKY-(<i>D1Rat36-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304278DA-Tg(Alb-HSVtk)5JmskThis strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in this transgenic rats causes hepatitis.transgenicEmbryoDevelopment2304279W-Tg(MT2A-Myc)1YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).transgenicEmbryoReproduction; DevelopmentMyc31302304280SHR/ShiDeveloped by the DEPOSITORinbredEmbryo; SpermCardio Hypertension2304281SERC/KyoDeveloped by the DEPOSITORmutantSpermNeurobiology2304282IEW/Ihrmutant of Ihara epileptic rat.inbredLive Animals; EmbryoNeurobiology; Ophthalmology2304283SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304284SHRSP.WKY-(<i>D1Mgh5-D1Rat116</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304285BDIX/NemOdaDeveloped by the DEPOSITORinbredCancer2304286DMYC/KyoDeveloped by the DEPOSITORcoisogenicSperm2304287ACI.F344-(<i>D16Rat17-D16Rat15</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain.congenicEmbryoCancer2304288ACI.BUF-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITORcongenicCancer2304289SHRSP.WKY-(<i>D1Mgh5-D1Rat349</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304290BUF.ACI-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITORcongenicCancer2304291LEW-Tg(CAG-EGFP)1YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.transgenicLive Animals; Embryo; SpermDevelopment2304292LEW-Tg(Gt(ROSA)26Sor-luc)21JmskThis strain expresses luciferase ubiquitously driven by the gene trap ROSA 26 promoter established at Jichi Medical School.transgenicEmbryoDevelopment2304293F344.LEC-<i>xhs1</i>/1NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assaycongenicSperm2304294MPOD/KyoMyeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait.mutantEmbryo; SpermCancer; Immunology2304295SHRSP.WKY-(<i>Igf1r-D1Rat36</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2305934F344-<i>Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermSpta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup>23059322305935F344-<i>Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermRtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup>23059332306090EXHC/TaExogenously hypercholesterolemic ratDeveloped by the DEPOSITORinbredLive AnimalsMetabolism2306544BBDR.F344-(<i>D4Rat26-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenic2312511WF/IcoCrlWistar RatsFurth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970.inbred2312512ZSF1-<i>Lepr<sup>fa</sup></i> <i>Lepr<sup>cp</sup></i>/CrlThis hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis.hybrid2312513Crlj:DONDr. Sato(1952) to Nippon Rat to CRLJ(1990)outbred2312514Crlj:LECHokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991).outbred2313342BN-Chr 17<sup>LH</sup>/MavChr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomic2313343LH-Chr 13<sup>BN</sup>/MavChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomic2314224F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/2TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.congenicEmbryoDiabetes Obesity2314225F344-Chr 15<sup>OLETF</sup>/TjDeveloped by the depositorconsomicEmbryoDiabetes Obesity2314226WI-Tg(WSCD2)3TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSpermWSCD216057102314227WI-Tg(WSCD2)4TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSpermWSCD216057102314228WI-Tg(WSCD2)5TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSpermWSCD216057102314229F344.OLETF-(<i>D7Uwm22-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity2314230F344-<i>Hr<sup>Krh</i></sup>/KyoHairless Kyoto, HanakoA mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantSpermDermatology; Urology2304296KB/OdaMaintained by crossing heterozygotes of the albino locus (segregating inbred strain).segregating_inbredEmbryo2304297TM.KDP-<i>Cblb</i>/NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).congenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304298SD-Tg(Tuba1a-EYFP)OknThis strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter.transgenic2304299LEW-Tg(Alb-GFP)6JmskThis strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School.transgenicEmbryoDevelopment2304300W-Tg(S100b-EGFP)ScellDeveloped by microinjecting the transgene into Wistar ratstransgenicEmbryo; SpermNeurobiology; Metabolism2304301SHRSP.WKY-(<i>Slco3a1-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304302SHRSP.WKY-(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304303W-Tg(MT2A-Myc)2YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).transgenicEmbryoReproduction; DevelopmentMyc31302304304SHRSP.WKY-(<i>D1Rat209-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304305DOB/OdaThis strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000.inbredLive Animals; Embryo2304306BUF.ACI-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITORcongenicCancer2304307ACI.BUF-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITORcongenicCancer2304308ICR/IhrA new strain of rat with an inherited cataractinbredLive AnimalsNeurobiology; Ophthalmology2304309SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304310SD-Tg(Nes/Hspa1b-EGFP)OknThis strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter.transgenicEmbryo; SpermNeurobiology2304311LEW-Tg(Gt(ROSA)26Sor-lacZ)44JmskRrrcThis strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.transgenicEmbryoDevelopment2304312SHRSP.WKY-(<i>D1Mgh5-D1Rat36</i>)(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304313SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2306840E3.DA-(<i>D4Wox22-D4Got132</i>)(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenic2306841E3.DA-(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenic2306842E3.DA-(<i>D20Rat45-D20Rat47</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenic2312471Crl:ZUC(Orl)-<i>Lepr</i><sup>fa</sup>The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991.outbred2312472Crl:WI(WU)Wistar Wu RatSelection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987.outbred2312473BDIX/OrlCrlBDIX RatsRats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991.inbred2312474Crl:OFA(SD)The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968.outbred2314231F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/2TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicEmbryoDiabetes Obesity2314232WI-Tg(WSCD2)1TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSpermWSCD216057102314313NER.F344-(<i>D5Rat100-D5Rat234</i>)/KyoThe Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.congenicNeurobiology2314314NER.F344-(<i>D1Mgh6-D1Rat132</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.congenicNeurobiology2314315F344.NER-(<i>D5Mgh4-D5Rat36</i>)/KyoThe Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.congenicSpermNeurobiology2314316F344.NER-(<i>D1Mgh6-D1Rat73</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.congenicSpermNeurobiology2314317WTC.GRY-<i>Cacna1a<sup>gry</i></sup>/KyoDeveloped by the depositorcongenicSpermNeurobiologyCacna1a22442304315SHRSP.WKY-(<i>Calca-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicEmbryoDiabetes Obesity; Cardio Hypertension2304316F344.LEC-<i>xhs1</i>/2NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assaycongenicSperm2306058LEC.W-Tg(CAG-Zfml)30Ncms/NcmsDeveloped by the DEPOSITORcongenicSperm2306059DA.Cg-<i>Foxn1<sup>rnu</sup> Lyst<sup>bg</sup></i>/SlcDeveloped by the DEPOSITORcongenicEmbryo; SpermImmunology; HematologyFoxn1|Lyst3970|6218372306060LEC.W-Tg(CAG-Zfml)26Ncms/NcmsDeveloped by the DEPOSITORcongenicSperm2306061ACI.BUF-<i>Pur1 Ten2</i>/MnaThe proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002.congenicMetabolism2306062W-Tg(Per1-luc)1OaDeveloped by the DEPOSITORtransgenicEmbryo; Sperm2306063LEC.W-Tg(CAG-Zfml)21Ncms/NcmsDeveloped by the DEPOSITORcongenicSperm2306064MPR/IarDeveloped by the DEPOSITORmutantEmbryo; SpermMetabolism; OsteosisArsb21582311692F344-<i>Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermMyo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup>23116912311693F344-<i>Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantTmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup>23116892311694F344-<i>Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermFam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup>23116872312447SD-Tg(Pmp22)KanThis transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid librarytransgenicPmp22111252312733BN-Chr 13<sup>SS</sup> Chr 18<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressedconsomicSperm2313384Wild/NovThese are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russiawild2314243SHR.WKY-(<i>D1Mgh2-D1Wox10</i>)/IzmTkyoDeveloped by the depositorcongenicEmbryo; SpermCardio Hypertension2314244BCR/NnIn the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene).mutantSpermNeurobiology2314245WI-Tg(WSCD2)6TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicSpermWSCD216057102306529BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwParental strain BBDR.BBDP-(<I>D4Rhw17-ss99306861</i>)(<I>D4Rhw11-D4Rhw10</I>)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congeniccongenic2311049SHROB/KolGmiCrl-<i>Lepr<sup>cp</i></sup>/CrlThis mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001.coisogenic2311078Crl:CD-<i>Hr<sup>hr</i></sup>CD hairless ratsThis spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic.outbred2311079WF/CrCrlJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbred2313221SHHF-<i>Lepr<sup>cp</i></sup>/CrlDeveloped by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001.congenic2313222BN/HsdMcwiCrlBN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles Riverinbred2314364ACI.F344-(<i>D16Nkg112-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals.congenicSpermCancer2314365KFRS2/KyoA male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.mutantSpermOphthalmology; DermatologyTyr15897552304314BDIX.Cg-<i>Tal</i>/NemOdaMating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain).congenicSpermOsteosis2304329WKY/EzoDeposited by the DEPOSITORinbredEmbryoCardio Hypertension2304330SD-Tg(HRAS)128NcuThis strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.transgenicEmbryo; SpermCancer2304331F344-Tg(CCR5)1HikDeposited by the DEPOSITORtransgenicEmbryo; SpermInfectious2304332HER/WkmtDeveloped by the DEPOSITORinbredLive AnimalsNeurobiology2314246SHRSP.WKY-(<i>D1Rat117-D1Rat90</i>)/IzmTkyoDeveloped by the DepositorcongenicEmbryoCardio Hypertension2314247WI-Tg(Prl-EGFP)YampA transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) ratstransgenicSpermMetabolism; Development2314396LCR/McoLow-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.inbred2314397HCR/McoHigh-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.inbred2314655HsdBlu:BRAT-<i>Avp<sup>di</i></sup>BrattleboroHereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988.mutantEmbryo; SpermAvp21842306892SHR.BN-(<i>D2Rat114-D2Rat123</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenic2306893SHR.BN-(<i>D16Rat87-D16Mgh1</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenic2306894SHR.BN-(<i>D4Rat33-D4Rat54</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenic2306895SHR.BN-(<i>D2Rat226-D2Rat294</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenic2307298BN/HanKiniSubstrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany)inbred2307299ACI/ZtmKinisubstrain of ACI derived from ACI/Ztminbred2307300LEW.1AV1/KiniSubstrain of LEW.1AV1congenic2307301DA.LEW.RT1f-(<i>D20Wox15-D20Wox13</i>)/RhdRT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markerscongenic2311051SHRSP/A3NCrlStroke Prone RatsThe SHRSP was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002.inbred2314001N:HSHeterogeneous stockOriginated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsinoutbred2307161SHRSR.SHRSP-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenic2313463F344-<i>Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPpfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup>23134592313464F344-<i>Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantLarge<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup>23134602313465F344-<i>Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermPld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup>23134622313466F344-<i>Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantSpermAgbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup>23134612317196DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interestcongenic2317197DA.PVG.1AV1-(<i>D8Rat41-D8Rat24</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interestcongenic2317201DA.PVG.1AV1-(<i>D8Rat24-D8Got145</i>)DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locuscongenic2316653SS.LEW-(<i>D1Mco102-D1Got46</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Uia8-D1Rat18<i>)/Mco contributing to the introgressed LEW allelecongenic2316654SS.LEW-(<i>D1Mco102-D1Mco129</i>)/1McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2316655SS.LEW-(<i>D1Mco102-D1Mco129</i>)/2McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic2317278Taiep/DunThese mutants were found in Sprague-Dawley rats at University of Puebla in 1989mutant2316928SHR.BN-(<i>D3Rat159-D3Rat1</i>)(<i>D6Rat40-D6Rat170</i>)/Mcothis double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allelecongenic2317590DA.PVG.1AV1-(<i>D4Rat23-D4Rat108</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic2317595DA.PVG.1AV1-(<i>D4Rat23-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic2317596DA.PVG.1AV1-(<i>D4Rat103-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic2317598DA.PVG.1AV1-(<i>D4Rat231-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic2317599DA.PVG.1AV1-(<i>D4Got211-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic2316631F344.GK-(<i>D1Swe8-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/SwecongenicAdra2a|Pdcd4|Shoc22056|620816|13081462316632NEDH/KSimNew England Deaconess HospitalInbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffmaninbred2316633F344.GK-(<i>D1Got251-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swecongenic2316925SHR.BN-(<i>D3Rat159-D3Rat1</i>)/Mco50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdcongenic2316927SHR.BN-(<i>D6Rat40-D6Rat170</i>)/Mco45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdcongenic2325796SS.LEW-(<i>D3Rat52-D3Chm57</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat130</i>)/Aydcongenic2325798SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Aydcongenic2325801SS.LEW-(<i>D16Chm36-D16Mit2</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Aydcongenic2325803SS.LEW-(<i>D16Rat112-D16Chm60</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Aydcongenic4140469F344-<i>Kmch</i>/NSlcKomachifrom NBRPmutant4139872SS-<i>Nckap5<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6.mutantSpermNckap5<sup>em2Mcwi</sup>41398624139873SS-<i>Rag1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.mutantLive Animals; SpermRag1<sup>em2Mcwi</sup>41398664139874SS-<i>Ets1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.mutantSpermEts1<sup>em1Mcwi</sup>41398564139875FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.mutantLive Animals; SpermSorcs1<sup>em1Mcwi</sup>41398644139876SS-<i>Mmp2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.mutantMmp2<sup>em1Mcwi</sup>41398604139877FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.mutantLive Animals; SpermRab38<sup>em1Mcwi</sup>41398674139878SS-<i>Mmp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.mutantExtinctMmp2<sup>em2Mcwi</sup>41398694139879SS-<i>Nckap5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.mutantExtinctNckap5<sup>em1Mcwi</sup>41398594139880SS-<i>Ren<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.mutantLive Animals; SpermRen<sup>em1Mcwi</sup>41398634139881SS-<i>Nckap5<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.mutantSpermNckap5<sup>em3Mcwi</sup>41398614139882SS-<i>Nppa<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.mutantLive Animals; SpermNppa<sup>em4Mcwi</sup>41398574139883SS-<i>Nox4<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.mutantLive Animals; SpermNox4<sup>em2Mcwi</sup>41398684139884SS-<i>Rag1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.mutantLive Animals; SpermRag1<sup>em1Mcwi</sup>41398654139885SS-<i>Sh2b3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.mutantLive Animals; SpermSh2b3<sup>em1Mcwi</sup>41398582317812AT.ANT-(<i>D1Rat234-D1Rat228</i>)/RarF<sub>2</sub> males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were testedcongenic2317813AT.ANT-(<i>D1Rat234-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317814AT.ANT-(<i>D1Rat273-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317815AT.ANT-(<i>D1Rat35-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317816AT.ANT-(<i>D1Rat234-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317817AT.ANT-(<i>D1Rat183-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317818AT.ANT-(<i>D1Rat273-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317819AT.ANT-(<i>D1Rat35-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic4139889BHD/DspeBirt-Hogg-Dube ratA rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony in the Dainippon Pharmaceutical Co., Ltd. and named Nihon rat. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd.inbredEmbryoFlcn7350884139890TT/SgnRats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats.mutantSpermFkbp613089264139891F344-Chr 3<sup>SDT</sup>/NyoThis consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background.consomicEmbryoDiabetes Obesity4139892ALD/Hyoacid lipase deficiency ratIn a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far.inbredEmbryoMetabolismLipa30084140402W-Tg(Gh1as)NibsThe construct which contains of rat growth hormone (<i>Gh1</i>) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat <i>Gh1</i> cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science.transgenicSperm4140403SD-Tg(Eno2-ATXN3*64Q)29KakizBackground strain is Slc:SD.transgenicSpermNeurobiology4140404ODS/ShiJclOsteogenic disorder Shionagi ratscurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.inbredGulo6207014140405LEXF6A/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredEmbryo4140406SHRSP.WKY-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.congenicEmbryo4142540SHR.WKY-(<i>D4Rat10-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4142541W-Tg(Tek-GFP)1SohThis transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion.transgenicEmbryo; Sperm4142542BN.SDT-<i>Gluco14</i>/NyoThe Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo.congenicEmbryo; SpermDiabetes Obesity4142543BN.SDT-<i>Gluco13</i>/NyoThe Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo.congenicEmbryo; SpermDiabetes Obesity4142544WKY/KihaA WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University.mutantEmbryo4142545SHR.WKY-(<i>D3Rat108-D3Rat166</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4142546AMI/TjRats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003.mutantEmbryoDentistry4142547SHR.WKY-(<i>D4Wox27-D4Rat11</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4142548SHR.WKY-(<i>D4Wox27-D4Rat10</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4142549SHR.WKY-(<i>D4Wox27-D4Rat4</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4142550SHR.WKY-(<i>D4Rat101-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicSpermCardio Hypertension4140407SDT.BN-<i>Gluco13</i>/NyoThe <i>Gluco13</i> (<i>Gisdt1</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-<i>Gluco14</i>/Nyo (NBRP No. 0602).congenicEmbryo; SpermDiabetes Obesity4140408LEXF8C/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredEmbryo4140409COP-Chr 16<sup>DA</sup>/McoRrrcTransfer of the DA-rat chromosome 16 (RNO16) into the COP-rat backgroundconsomic4140410SD-Tg(Eno2-ATXN3*64Q)16KakizBackground strain is Slc:SD.transgenicSpermNeurobiology4140411SDT.BN-<i>Gluco14</i>/NyoThe <i>Gluco14</i> (<i>Gisdt2</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN-<i> Gluco13</i>/Nyo (NBRP No. 0601).congenicEmbryo; SpermDiabetes Obesity4140412LEXF1D/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredEmbryo4140413LEXF1B/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredEmbryo4140414WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.congenic4140415TRMRC/KyoThe coisogenic control strain for the TRMR strain (NBRP No.0016).coisogenicLive Animals; Sperm4140416SD-Tg(Eno2-Vcp)16KakizThis transgenic strain was generated by microinjection into Slc:SD fertilized eggs.transgenicSpermNeurobiology2325724PVG.LEW-(<i>D1Rat270-D1Rat68</i>)/Kini63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1congenic4143456BN.GK-(<i>D2Wox30-D2Wox68</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic4143457BN.GK-(<i>D2Rat40-D2Wox35</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic4143458BN.GK-(<i>D2Wox49-D2Rat70</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic4143459BN.GK-(<i>D2Rat40-D2Got149</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenic2317891SHR-Chr 6<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomic2324631DA.E3-(<i>D4Wox49-D4Got136</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenicClec4a313595284891048SS.LEW-(<i>D7Rat73-D7Rat128</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891051LEW.SS-(<i>D7Rat73-D7Rat128</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891103WMI/EerWKY most immobile3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.inbred4891107WLI/EerWKY least immobile3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.inbred4891165Wig/YmaswigglingThese are congenic wiggling rats established by transferring the gene from LEC to Wistar King-Aptekman/Hokkaido (WKAH) straincongenic4891380SS.SR-(<i>D9Mco95-D9Mco98</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891383SS.SR-(<i>D9Mco98-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891386SS.SR-(<i>D9Mco98-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891388SS.SR-(<i>D9Mco95-D9Mco100</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891390SS.SR-(<i>D9Mco95-D9Mco100</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891392SS.SR-(<i>D9Mco95-D9Mco102</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891394SS.SR-(<i>D9Mco101-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891396SS.SR-(<i>D9Mco72-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891400SS.SR-(<i>D9Mco14-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic2325773WKY.LEW-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrlcongenic2325774WKY.LEW-(<i>D13Arb10-D13Arb15</i>)(<i>D16Rat88-D16Rat40</i>)/TjaWKY.LEW-(<i>D13Arb10-D13Arb15</i>) were crossed with WKY.LEW-(<i>D16Rat88-D16Rat40</i>), the F<sub>1</sub> were backcrossed to WKY.LEW-(<i>D13Arb10-D13Arb15</i>) and then the offsprings were intercrossedcongenic4889499CDS-Chr 4<sup>CDR</sup>/YglHomozygous male CDS/Ygl were bred with CDR/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4891402SS.SR-(<i>D9Mco14-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4891404SS.SR-(<i>D9Mco14-Resp18</i>)/3McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenic4107048SS.SR-(<I>D7Rat16-D7Rat189</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic4107052SS.SR-(<I>D7Rat16-D7Mgh5</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic4107055SS.SR-(<I>D7Rat16-D7Rat176</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic4107057SS.SR-(<I>D7Mco7-D7Rat81</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenic4107063SS.LEW-(<i>D1Uia8-D1Rat124</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allelecongenic4107065SS.LEW-(<i>D1Uia8-D1Rat213</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allelecongenic2325202SS/JrSeacDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRPinbredEmbryo; SpermCardio- Hypertension2325206LEW/SeacSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japaninbred2325209SHRSP/HosSubstrain of SHRSP purchased from Sankyo Lab Service, Japan.inbred2325754SD-<i>Pax6<sup>Sey</sup></i>Autosomal dominant mutation that arose spontaneously in SD ratsmutantPax632584889450DA.PVG.1AV1-(<i>D1Rat248-D1Rat10</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb)congenic4143165SD-Tg(Aqp5-GFP)ZboroRrrcAqp5EGFPThis rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained.transgenicEmbryo; SpermAqp521444889464GK/OxOriginal breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UKinbred2317791DA.PVG.1AV1-(<i>D4Got60-D4Kini1</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kinicongenic4142799LEW.SS-(<i>D2Uia5-D2Rat143</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic straincongenic4142800LEW.SS-(<i>D18Chm31-D18Mit8</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic straincongenic4145374ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Rat98-D14Hmgc18</i>)/McwiCongenic strain developed by crossing ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/Eur (Rf-1a) males to ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi (Rf-1a+4) double congenic femalescongenic2317820AT.ANT-(<i>D1Rat158-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317822AT.ANT-(<i>D1Rat35-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317825AT.ANT-(<i>D1Rat234-D1Rat35</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic2317827AT.ANT-(<i>D1Rat234-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenic4145088SS.BN-(<i>D6Rat119-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenic4145089SS.BN-(<i>D6Rat149-D6Rat18</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenic4145090SS.BN-(<i>D6Rat149-D6Got171</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenic4145091SS.BN-(<i>D6Rat149-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenic4889411SHRSP.WKY-(<i>D1Smu13-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic straincongenic4889414WKY.SHRSP-(<i>D1Rat171-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(<i>D1Smu13-D1Smu11</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic straincongenic4889817SBN-Chr 1<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889820SBH-Chr 1<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889822SBN-Chr 17<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889875SBH-Chr 2<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889877SBH-Chr 20<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889879SBH-Chr X<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889882SBH-Chr 17<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomic4889890DA.PVG.1AV1-(<i>D17Rat8-D17Rat37</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37congenicSpermImmunology2325143SHR/NHsdMcoSpontaneously Hypertensive RatSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred2325145LEW/CrlMcoLewisThese were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred2325146MNS/NMcoMilan normotensive strainThese were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred5130721HXB1/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131920SS-<i>Apoe<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.mutantExtinctApoe<sup>em8Mcwi</sup>51319155131921SS-<i>Apoe<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.mutantExtinctApoe<sup>em7Mcwi</sup>51319185131922SS-<i>Cdh13<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.mutantLive Animals; SpermCdh13<sup>em1Mcwi</sup>51319195144101SS-<i>Kcnq1<sup>em14Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.mutantLive Animals; SpermKcnq1<sup>em14Mcwi</sup>51440835144102ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi-<i>Asip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat33)(D14Mit11-D14Rat33/D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.mutantSpermAsip<sup>em1Mcwi</sup>51440995144103SS-<i>Ldlr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.mutantSpermLdlr<sup>em1Mcwi</sup>51440905144104SS-<i>Ncf2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2.mutantLive Animals; SpermNcf2<sup>em1Mcwi</sup>51440895144105SS-<i>Hexim2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.mutantSpermHexim2<sup>em4Mcwi</sup>51440955144106SS-<i>Kcnq1<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3.mutantSpermKcnq1<sup>em9Mcwi</sup>51440765144107SS-<i>Itga9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor.mutantSpermItga9<sup>em1Mcwi</sup>51440775144108SS-<i>Ldlr<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.mutantSpermLdlr<sup>em4Mcwi</sup>51440755131094BN-<i>Lx</i>/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.mutant5131095BXH13/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131097BXH12/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131099BXH11/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131101BXH10/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131104BXH9/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131106BXH8/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131108BXH6/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131110BXH5/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131113HXB31/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131115HXB29/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131118HXB27/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131120HXB26/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131122HXB25/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131124HXB23/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131126HXB20/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131128HXB17/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131130HXB15/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131963SS-<i>Nox4<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.mutantSpermNox4<sup>em1Mcwi</sup>51314285131964SS-<i>Mstn<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.mutantSpermMstn<sup>em3Mcwi</sup>51319625131965SS-<i>Mthfr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.mutantLive Animals; SpermMthfr<sup>em1Mcwi</sup>51319615131966SS-<i>Plod1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.mutantLive Animals; SpermPlod1<sup>em1Mcwi</sup>51319605131132HXB13/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131134HXB10/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131136HXB7/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131138HXB4/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131140HXB3/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131142HXB2/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5131144HXB18/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbred5143940ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/EurCongenic substrain that originated from ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eurcongenic5143941ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwiTriple congenic ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of Wisconsincongenic5143942ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.congenic5143943ACI.FHH-(<i>D14Mit11-D14Rat82</i>)/EurCongenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain.congenicSperm5131932SS-<i>Cyp1a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.mutantSpermCyp1a1<sup>em1Mcwi</sup>51319285131933SS-<i>Cyba<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.mutantLive Animals; SpermCyba<sup>em1Mcwi</sup>51319305131934SS-<i>Cyp1a1<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4.mutantCyp1a1<sup>em5Mcwi</sup>51319295135472ACI.BN-(<I>D5Uwm70-D5Rat32</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5135473ACI.BN-(<I>D5Uwm70-D5Got42</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5135475ACI.BN-(<I>D5Rat60-D5Rat115</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5135477ACI.BN-(<I>D5Uwm70-D5Mgh15</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5135479ACI.BN-(<I>D5Rat113-D5Rat36</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5135481ACI.BN-(<I>D5Mgh17-D5Rat98</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5144110ACI.BN-(<i>D5Mgh17-D5Mgh15</i>)/ShulThis congenic strain is developed by further genotyping ACI.BN-(<i>D5Mgh17-D5Rat205</i>)/Shul.congenic4892563WF.WKY-(<i>D5Rat26-D5Uwm42</i>)/UwmWKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region.congenic5143984SS-<i>Plekha7<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.mutantSpermPlekha7<sup>em1Mcwi</sup>51439785143985SS-<i>Mstn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor.mutantSpermMstn<sup>em1Mcwi</sup>51439645143986SS-<i>Ulk3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.mutantSpermUlk3<sup>em1Mcwi</sup>51439685143987SS-<i>Gpr183<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.mutantSpermGpr183<sup>em3Mcwi</sup>51439615143988SS-<i>Gpr183<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.mutantSpermGpr183<sup>em2Mcwi</sup>51439555143989SS-<i>Agtrap<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor.mutantLive Animals; SpermAgtrap<sup>em4Mcwi</sup>51439635143990SS-<i>Ulk3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5.mutantSpermUlk3<sup>em4Mcwi</sup>51439715143991SS-<i>Gpr183<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2.mutantSpermGpr183<sup>em1Mcwi</sup>51439575143992SS-<i>Rasgrp3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12.mutantLive Animals; SpermRasgrp3<sup>em3Mcwi</sup>51439465143993SS-<i>Plcd3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donormutantSpermPlcd3<sup>em4Mcwi</sup>51439545143994SS-<i>Plcd3<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codonmutantSpermPlcd3<sup>em7Mcwi</sup>51439765143995SS-<i>Plekha7<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 6.mutantLive Animals; SpermPlekha7<sup>em4Mcwi</sup>51439795143996SS-<i>Agtrap<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.mutantLive Animals; SpermAgtrap<sup>em8Mcwi</sup>51439705131950SS-<i>Msra<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1.mutantSpermMsra<sup>em3Mcwi</sup>51319455131951SS-<i>Prokr1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2.mutantSpermProkr1<sup>em2Mcwi</sup>51319475131952SS-<i>Mas1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.mutantLive Animals; SpermMas1<sup>em1Mcwi</sup>51319465131953SS-<i>Prokr1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2.mutantSpermProkr1<sup>em1Mcwi</sup>51319485131954SS-<i>Mstn<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.mutantMstn<sup>em2Mcwi</sup>51319495134951WF.COP-(<i>D7Rat39-D7Uwm12</i>)/1UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundcongenic5134953WF.COP-(<i>D7Rat39-D7Uwm12</i>)/2UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundcongenic5131987SS-<i>Tgfb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3.mutantTgfb1<sup>em1Mcwi</sup>51319865131988SS-<i>Wdr72<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3.mutantSpermWdr72<sup>em2Mcwi</sup>51319785131989SS-<i>Tgfb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.mutantSpermTgfb1<sup>em3Mcwi</sup>51319805131990SS-<i>Slc30a8<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.mutantSpermSlc30a8<sup>em2Mcwi</sup>51319815131991SS-<i>Slc30a8<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.mutantSpermSlc30a8<sup>em1Mcwi</sup>51319795135031BN.MES-<i>Cyba</i>/Snamutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlccongenic5131910SS-<i>Acad10<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.mutantSpermAcad10<sup>em2Mcwi</sup>51319055131911SS-<i>Alms1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.mutantSpermAlms1<sup>em1Mcwi</sup>51319065131912SS-<i>Aldh2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.mutantSpermAldh2<sup>em2Mcwi</sup>51319075131974SS-<i>Rasgrp3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.mutantSpermRasgrp3<sup>em1Mcwi</sup>51319685131975SS-<i>Ptpn11<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.mutantSpermPtpn11<sup>em1Mcwi</sup>51319705131976SS-<i>Ptpn11<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4.mutantSpermPtpn11<sup>em4Mcwi</sup>51319695134683WF.WKY-(<i>D7Rat171-D7Rat128</i>)/1UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenic5134685WF.WKY-(<i>D7Rat171-D7Rat128</i>)/2UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenic5134687WF.WKY-(<i>D7Rat51-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenic5134689WF.WKY-(<i>D7Uwm25-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenic5134692WF.WKY-(<i>D7Rat171-D7Rat45</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenic5685369SS-<i>Agtr1a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3.mutantLive Animals; SpermAgtr1a<sup>em1Mcwi</sup>55083315686300SS-<i>Adra2a<sup>em1Mcwi-/-</sup></i>SS-<i>Adra2a<sup>em1Mcwi-</sup>/Adra2a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686302SS-<i>Adra2a<sup>em1Mcwi+/+</sup></i>SS-<i>Adra2a<sup>em1Mcwi+</sup>/Adra2a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686304SS-<i>Agtrap<sup>em4Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em4Mcwi-</sup>/Agtrap<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686306SS-<i>Agtrap<sup>em4Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em4Mcwi+</sup>/Agtrap<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686652SS-<i>Agtr1a<sup>em1Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em1Mcwi-</sup>/Agtr1a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688090FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+/+</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+</sup>/Rab38<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688092SS-<i>Rag1<sup>em1Mcwi-/-</sup></i>SS-<i>Rag1<sup>em1Mcwi-</sup>/Rag1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688094SS-<i>Rag1<sup>em1Mcwi+/+</sup></i>SS-<i>Rag1<sup>em1Mcwi+</sup>/Rag1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688096SS-<i>Rag1<sup>em2Mcwi-/-</sup></i>SS-<i>Rag1<sup>em2Mcwi-</sup>/Rag1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5509988SS-<i>Nppb<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.mutantLive Animals; SpermNppb<sup>em4Mcwi</sup>55099795509989SS-<i>Msra<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1.mutantSpermMsra<sup>em4Mcwi</sup>55099775509990SS-<i>Cyp1a1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4mutantSpermCyp1a1<sup>em2Mcwi</sup>55099765509991SS-<i>Mylip<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp frameshift deletion in exon 1.mutantSpermMylip<sup>em2Mcwi</sup>55083335509992SS-<i>Ube2q2<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7.mutantSpermUbe2q2<sup>em3Mcwi</sup>55099875509993SS-<i>Tcf7l2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5.mutantSpermTcf7l2<sup>em1Mcwi</sup>55099815509994SS-<i>Sh2b3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.mutantLive Animals; SpermSh2b3<sup>em2Mcwi</sup>55099825509995SS-<i>Adra2a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2.mutantSpermAdra2a<sup>em1Mcwi</sup>55099865509996SS-<i>Stk39<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7.mutantExtinctStk39<sup>em2Mcwi</sup>55099785509997SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.mutantExtinctNckap5<sup>em4Mcwi</sup>55099755686764SS-<i>Plod1<sup>em1Mcwi+/+</sup></i>SS-<i>Plod1<sup>em1Mcwi+</sup>/Plod1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686766SS-<i>Sh2b3<sup>em2Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em2Mcwi-</sup>/Sh2b3<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686768SS-<i>Slc30a8<sup>em1Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em1Mcwi-</sup>/Slc30a8<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686770SS-<i>Slc30a8<sup>em1Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em1Mcwi+</sup>/Slc30a8<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686772SS-<i>Slc30a8<sup>em2Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em2Mcwi-</sup>/Slc30a8<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5490515FHH.BN(<i>D1Rat265-D1Rat76</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicExtinct5490516FHH.BN(<i>D14Rat80-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicLive Animals; Sperm5490517FHH.BN(<i>D14Rat78-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicLive Animals; Sperm5687974SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.mutantExtinctCyp4a2<sup>em1Mcwi</sup>56877245688098SS-<i>Rag1<sup>em2Mcwi+/+</sup></i>SS-<i>Rag1<sup>em2Mcwi+</sup>/Rag1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant6478791F344-Tg(UBC-EGFP)F455RrrcThis transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344.transgenicLive Animals; Embryo; Sperm6480190NAft:HSHeterogeneous stockFrom Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, Barcelonaoutbred6480205MWF-Chr 6<sup>SHR</sup> Chr 8<sup>SHR</sup>/RkbChr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkbconsomic6480210SHR-Chr 8<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomic6480218AR-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, JapanmutantEdnrb25366480220LE-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis rat<i>Ednrb<sup>Sl</sup></i> mutation from Aganglionosis Rat (AR) was introgressed into a closed colony of Long-Evans ratscongenicEdnrb25366480223F344-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis ratgenerated by backcrossing original aganglionosis rats to F344 from SLC (Hamamatsu, Japan) for more than 10 generationscongenicEdnrb25366480863BBDR/RhwRrrcBBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research CenterinbredEmbryo; Sperm6480866BN-Chr 13<sup>LH</sup>/MavRrrcChr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomicEmbryo; Sperm6480868BN-Chr 2<sup>LH</sup>/MavRrrcChr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomicEmbryo; Sperm6480874COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoRrrcMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research CentercongenicEmbryo; Sperm5686776SS-<i>Slc30a8<sup>em2Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em2Mcwi+</sup>/Slc30a8<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686778SS-<i>Stk39<sup>em2Mcwi-/-</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686780SS-<i>Stk39<sup>em2Mcwi+/+</sup></i>SS-<i>Stk39<sup>em2Mcwi+</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686782SS-<i>Stk39<sup>em2Mcwi-/+</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686784SS-<i>Tcf7l2<sup>em1Mcwi-/-</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686786SS-<i>Tcf7l2<sup>em1Mcwi+/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi+</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686788SS-<i>Tcf7l2<sup>em1Mcwi-/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686790SS-<i>Ulk3<sup>em1Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686792SS-<i>Ulk3<sup>em1Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi+</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686794SS-<i>Ulk3<sup>em1Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686797SS-<i>Wdr72<sup>em1Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em1Mcwi-</sup>/Wdr72<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686799SS-<i>Wdr72<sup>em1Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em1Mcwi+</sup>/Wdr72<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant6482243WI-<i>Cit<sup>fh</i></sup>JjloRrrcflathead ratFlathead rat was discovered at University of in an inbred colony of Wistar ratsmutantEmbryo; Sperm6482244SS-Tg(APOA1)116OpazRrrcSS/JrHsd embryos were microinjected with human APOA1 C3 promotertransgenicEmbryo; Sperm6482245SS-Tg(alpha1NK)24OpazRrrcSS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library)transgenicEmbryo; Sperm6482247FDIO/RrrcCross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype.inbredEmbryo; Sperm6482252F344-Tg(Pgk1-EGFP)/RrrcMultiple random integration of EGFP gene under the control of the PGK promoter.transgenicEmbryo; Sperm6482254Gunn-<i>Ugt1a1</i><sup>jBluHsdRrrc</sup>Gunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.mutantLive Animals; Embryo; Sperm6482256HS/RrrcHigh Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.inbredCryopreserved6482259LS/RrrcLow Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.inbredCryopreserved6482268RrrcHsdBlu:BRAT-<i>Avp<sup>di</i></sup>BrattleboroBrattleboro rats transferred to the RRRC in 2009.mutantLive Animals; Embryo; Sperm6482271LEW.Cg-<i>Foxn1</i><sup>rnu</sup>/NRrrcThe NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain.congenicEmbryo; Sperm6482282LEW-Tg(EGFP)463-5RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicSperm6482284LEW-Tg(EGFP)456-9RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicSperm6482286LEW-Tg(EGFP)458-7RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicEmbryo; Sperm6482288LEW-Tg(EGFP)463-1RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicSperm6482290LEW-Tg(EGFP)455RrrcLewis- GFP transgenicThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos.transgenicEmbryo; Sperm6482292LEW-Tg(Gt(ROSA)26Sor-lacZ)15JmskThis strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.transgenicEmbryo6482294LH-Chr 13<sup>BN</sup>/MavRrrcChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicEmbryo; Sperm6482296LH-Chr 17<sup>BN</sup>/MavRrrcChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicEmbryo; Sperm5687969ACI.BN-(<i>D2Rat251-D2Mgh3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.congenic5687971ACI.BN-(<i>D2Rat10-D2Rat202</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.congenic5687973ACI.BN-(<i>D18Rat30-D18Rat89</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background.congenic5687975SS-<i>Prex1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16.mutantSpermPrex1<sup>em2Mcwi</sup>56877195688396ACI.BN-(<i>D3Rat80-D3Rat3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background.congenic5688400ACI.BN-(<i>D4Rat5-D4Got131</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background.congenic5688402ACI.BN-(<i>D6Rat148-D6Rat109</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background.congenic5688405ACI.COP-(<i>D5Rat12-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenic5688407ACI.COP-(<i>D5Rat28-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenic5688409ACI.COP-(<i>D5Rat28-D5Rat36</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenic6218997SHR/NCrlAnraThese were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, Brazilinbred6219002LEW/HsdUnibAnraLEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, Brazilinbred6478788STOCK-<i>Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc</i>p53 knockout ratThis strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats.mutantEmbryo; SpermTp5338896482298MWF/ZtmRrrcMunich Wistar FromterFrom outbred Wistar rats selected for large numbers of superficial glomeruli.inbredEmbryo; Sperm5688100SS-<i>Ren<sup>em1Mcwi+/+</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688102SS-<i>Ren<sup>em1Mcwi-/-</sup></i>SS-<i>Ren<sup>em1Mcwi-</sup>/Ren<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant6482643WIN/RhwRrrcSubmitted to Rat Resource & Research CenterinbredEmbryo; Sperm6482645SD-Tg(S334ter)3LavRrrcThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Submitted to Rat Resource & Research CentertransgenicLive Animals; Embryo; Sperm6482654ACI.BN-(<i>D7Rat36-D7Rat11</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic6482674HIS/NdkRrrcHigh-Saccharin-Consuming (HiS) RatThe Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.inbredEmbryo; Sperm6482676LOS/NdkRrrcLow-Saccharin-Consuming (HiS) RatThe Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.inbredEmbryo; Sperm6482680SD-Tg(MMTV-Esrrb)1UwmRrrcHsd:SD background carrying a transgene which produces over-expression of the rat Esrbb proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat.transgenicEmbryo; Sperm6483453SS-<i>Dguok<sup>em2Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)mutantLive Animals; SpermDguok<sup>em2Mcwi</sup>55083546483454SS-<i>Dguok<sup>em1Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105)mutantLive AnimalsDguok<sup>em1Mcwi</sup>55083456483455SS-<i>Dguok<sup>em3Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc)mutantSpermDguok<sup>em3Mcwi</sup>55083252303759WT/Jttwhitish teeth ratIn 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating.mutantEmbryo; SpermDentistry6484519SS-<i>Rosa26<sup>em1(SB11)Mcwi</sup></i>This strain was produced by ZFN-stimulated knockin in the rat Rosa26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry.mutantRosa26<sup>em1(SB11)Mcwi</sup>64845186484559SS-<i>Slc34a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4.mutantSlc34a1<sup>em1Mcwi</sup>56876995508356SS-<i>Gucy1a3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5.mutantExtinctGucy1a3<sup>em1Mcwi</sup>55083515508357SS-<i>Tfdp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6.mutantSpermTfdp2<sup>em2Mcwi</sup>55083325508358SS-<i>Wdr72<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3mutantSpermWdr72<sup>em1Mcwi</sup>55083275508359SS-<i>Prune<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp frameshift deletion in exon 1.mutantSpermPrune<sup>em3Mcwi</sup>55083485508360SS-<i>Dguok<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1.mutantSpermDguok<sup>em4Mcwi</sup>55083235508361SS-<i>Bcas3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9.mutantSpermBcas3<sup>em4Mcwi</sup>55083295508362SS-<i>Ncf2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2.mutantSpermNcf2<sup>em4Mcwi</sup>55083425508363SS-<i>Sorcs2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15.mutantSpermSorcs2<sup>em4Mcwi</sup>55083265508364SS-<i>Prune<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1.mutantSpermPrune<sup>em1Mcwi</sup>55083415508365SS-<i>Agtr1a<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3.mutantSpermAgtr1a<sup>em5Mcwi</sup>55083185508366SS-<i>Tfdp2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.mutantExtinctTfdp2<sup>em5Mcwi</sup>55083345508367SS-<i>Ulk4<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15mutantSpermUlk4<sup>em3Mcwi</sup>55083405508368SS-<i>Trafd1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5.mutantSpermTrafd1<sup>em1Mcwi</sup>55083525508369SS-<i>Myadml2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.mutantSpermMyadml2<sup>em1Mcwi</sup>55083175508370SS-<i>Nppb<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.mutantSpermNppb<sup>em2Mcwi</sup>55083245508371SS-<i>Mylip<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.mutantExtinctMylip<sup>em3Mcwi</sup>55083365688087FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-/-</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-</sup>/Rab38<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant6483846HsdFcen:WIWistarDescendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentinaoutbred6484560SS-<i>Pdc<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5.mutantSpermPdc<sup>em2Mcwi</sup>56876956484561SS-<i>Comt<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4.mutantSpermComt<sup>em1Mcwi</sup>56877256484562SS-<i>Fgf5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.mutantSpermFgf5<sup>em1Mcwi</sup>56877206484563SS-<i>Cst3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1.mutantSpermCst3<sup>em3Mcwi</sup>56877386484564SS-<i>Cd247<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.mutantLive Animals; SpermCd247<sup>em3Mcwi</sup>56877306484565SS-<i>Ldlr<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4.mutantLdlr<sup>em3Mcwi</sup>51440826484566SS-<i>Slc6a12<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 2mutantSpermSlc6a12<sup>em1Mcwi</sup>56877366484567FHH-Chr 1<sup>BN</sup>-<i>Sorcs3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 7mutantSpermSorcs3<sup>em1Mcwi</sup>56877316484568SS-<i>Cd247<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.mutantExtinctCd247<sup>em5Mcwi</sup>56877136484569SS-<i>Adora2b<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 1mutantSpermAdora2b<sup>em1Mcwi</sup>56877296484570SS-<i>Stc1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3.mutantSpermStc1<sup>em2Mcwi</sup>56877226484571SS-<i>Myadml2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1.mutantSpermMyadml2<sup>em5Mcwi</sup>56877266484572SS-<i>Fgf5<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1.mutantSpermFgf5<sup>em5Mcwi</sup>56877276484573SS-<i>Clcn6<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13.mutantLive Animals; SpermClcn6<sup>em2Mcwi</sup>56877405683886SS-Chr 12<sup>BN</sup>.SS-(<i>D12Arb13-D12Mit2</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic5683888SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Rat79</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic5683890SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic5686826ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain.congenic5686829ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat6-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.congenic5686832ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Got102-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.congenic5687977SS-<i>Acad10<sup>em2Mcwi+/+</sup></i>SS-<i>Acad10<sup>em2Mcwi+</sup>/Acad10<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687979SS-<i>Acad10<sup>em2Mcwi-/-</sup></i>SS-<i>Acad10<sup>em2Mcwi-</sup>/Acad10<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687981SS-<i>Alms1<sup>em1Mcwi-/-</sup></i>SS-<i>Alms1<sup>em1Mcwi-</sup>/Alms1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687983SS-<i>Alms1<sup>em1Mcwi+/+</sup></i>SS-<i>Alms1<sup>em1Mcwi+</sup>/Alms1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687985SS-<i>Apoe<sup>em7Mcwi+/+</sup></i>SS-<i>Apoe<sup>em7Mcwi+</sup>/Apoe<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687987SS-<i>Apoe<sup>em7Mcwi-/-</sup></i>SS-<i>Apoe<sup>em7Mcwi-</sup>/Apoe<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5508380SS-Tg(T2ONC)2McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.transgenicSperm5508381SS-Tg(T2ONC)1McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.transgenicSperm5686670SS-<i>Cdh13<sup>em1Mcwi+/+</sup></i>SS-<i>Cdh13<sup>em1Mcwi+</sup>/Cdh13<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686672SS-<i>Cyp1a1<sup>em1Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi-</sup>/Cyp1a1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686676SS-<i>Cyp1a1<sup>em1Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi+</sup>/Cyp1a1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686678SS-<i>Cyp1a1<sup>em2Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi-</sup>/Cyp1a1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686680SS-<i>Cyp1a1<sup>em2Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi+</sup>/Cyp1a1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686684SS-<i>Cyp1a1<sup>em5Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi-</sup>/Cyp1a1<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686687SS-<i>Cyp1a1<sup>em5Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi+</sup>/Cyp1a1<sup>em5Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686689SS-<i>Prokr1<sup>em1Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em1Mcwi-</sup>/Prokr1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686692SS-<i>Prokr1<sup>em1Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em1Mcwi+</sup>/Prokr1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686695SS-<i>Prokr1<sup>em2Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em2Mcwi-</sup>/Prokr1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686697SS-<i>Prokr1<sup>em2Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em2Mcwi+</sup>/Prokr1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687989SS-<i>Apoe<sup>em8Mcwi-/-</sup></i>SS-<i>Apoe<sup>em8Mcwi-</sup>/Apoe<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687992SS-<i>Apoe<sup>em8Mcwi+/+</sup></i>SS-<i>Apoe<sup>em8Mcwi+</sup>/Apoe<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687994SS-<i>Bcas3<sup>em4Mcwi+/+</sup></i>SS-<i>Bcas3<sup>em4Mcwi+</sup>/Bcas3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687996SS-<i>Bcas3<sup>em4Mcwi-/-</sup></i>SS-<i>Bcas3<sup>em4Mcwi-</sup>/Bcas3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5687998SS-<i>Cyba<sup>em1Mcwi-/-</sup></i>SS-<i>Cyba<sup>em1Mcwi-</sup>/Cyba<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688000SS-<i>Cyba<sup>em1Mcwi+/+</sup></i>SS-<i>Cyba<sup>em1Mcwi+</sup>/Cyba<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688002SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688004SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/-</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688006SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688008SS-<i>Ets1<sup>em1Mcwi+/+</sup></i>SS-<i>Ets1<sup>em1Mcwi+</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688010SS-<i>Ets1<sup>em1Mcwi-/+</sup></i>SS-<i>Ets1<sup>em1Mcwi-</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686700SS-<i>Kcnq1<sup>em14Mcwi-/-</sup></i>SS-<i>Kcnq1<sup>em14Mcwi-</sup>/Kcnq1<sup>em14Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686702SS-<i>Kcnq1<sup>em14Mcwi+/+</sup></i>SS-<i>Kcnq1<sup>em14Mcwi+</sup>/Kcnq1<sup>em14Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686704SS-<i>Msra<sup>em3Mcwi-/-</sup></i>SS-<i>Msra<sup>em3Mcwi-</sup>/Msra<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686706SS-<i>Msra<sup>em3Mcwi+/+</sup></i>SS-<i>Msra<sup>em3Mcwi+</sup>/Msra<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686708SS-<i>Msra<sup>em4Mcwi-/-</sup></i>SS-<i>Msra<sup>em4Mcwi-</sup>/Msra<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686710SS-<i>Msra<sup>em4Mcwi+/+</sup></i>SS-<i>Msra<sup>em4Mcwi+</sup>/Msra<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686713SS-<i>Mstn<sup>em1Mcwi-/-</sup></i>SS-<i>Mstn<sup>em1Mcwi-</sup>/Mstn<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686715SS-<i>Mstn<sup>em1Mcwi+/+</sup></i>SS-<i>Mstn<sup>em1Mcwi+</sup>/Mstn<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686718SS-<i>Mstn<sup>em3Mcwi-/-</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686721SS-<i>Mstn<sup>em3Mcwi+/+</sup></i>SS-<i>Mstn<sup>em3Mcwi+</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686723SS-<i>Mstn<sup>em3Mcwi-/+</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686725SS-<i>Nppa<sup>em4Mcwi-/-</sup></i>SS-<i>Nppa<sup>em4Mcwi-</sup>/Nppa<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688012SS-<i>Gpr183<sup>em1Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em1Mcwi-</sup>/Gpr183<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688014SS-<i>Gpr183<sup>em1Mcwi+/+</sup>SS-<i>Gpr183<sup>em1Mcwi+</sup>/Gpr183<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688016SS-<i>Gpr183<sup>em2Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em2Mcwi-</sup>/Gpr183<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688018SS-<i>Gpr183<sup>em2Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em2Mcwi+</sup>/Gpr183<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688020SS-<i>Gpr183<sup>em3Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em3Mcwi-</sup>/Gpr183<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688022SS-<i>Gpr183<sup>em3Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em3Mcwi+</sup>/Gpr183<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688024SS-<i>Itga9<sup>em1Mcwi+/+</sup></i>SS-<i>Itga9<sup>em1Mcwi+</sup>/Itga9<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688026SS-<i>Mas1<sup>em1Mcwi+/+</sup></i>SS-<i>Mas1<sup>em1Mcwi+</sup>/Mas1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688028SS-<i>Mas1<sup>em1Mcwi-/-</sup></i>SS-<i>Mas1<sup>em1Mcwi-</sup>/Mas1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688030SS-<i>Mmp2<sup>em1Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em1Mcwi-</sup>/Mmp2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688032SS-<i>Mmp2<sup>em1Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em1Mcwi+</sup>/Mmp2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688034SS-<i>Mmp2<sup>em2Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em2Mcwi-</sup>/Mmp2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5508392HsdHlr:ZUC-<i>Lepr</i><sup>fa</sup>Derived from a colony obtained in 1992outbred5508393BN/RijHsdThese were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Harlan.inbred5508394FBNF1/HsdOffspring of a cross between the F344/NHsd inbred femalehybrid5508395Hsd:RH-<i>Foxn1</i><sup>rnu</sup>Athymic NudeDerived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland.outbred5508396RccHan:WISTDerived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc.,outbred5508397HsdHot:SDSprague DawleyOriginally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986.outbred5508398HsdBlu:LELong Evans (Blue Spruce)From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988.outbred5529230ACI.FHH-(<i>D1Hmgc16-D1Rat225</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicSperm5529529ACI.FHH-(<i>D1Hmgc1-D1Hmgc19</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicSperm5529731ACI.FHH-(<i>D1Hmgc20-D1Hmgc21</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicSperm5686308SS-<i>Hexim2<sup>em4Mcwi-/-</sup></i>SS-<i>Hexim2<sup>em4Mcwi-</sup>/Hexim2<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686311SS-<i>Hexim2<sup>em4Mcwi+/+</sup></i>SS-<i>Hexim2<sup>em4Mcwi+</sup>/Hexim2<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686314SS-<i>Rasgrp3<sup>em1Mcwi-/-</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi-</sup>/Rasgrp3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686316SS-<i>Rasgrp3<sup>em1Mcwi+/+</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi+</sup>/Rasgrp3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686654SS-<i>Agtr1a<sup>em1Mcwi+/+</sup></i>SS-<i>Agtr1a<sup>em1Mcwi+</sup>/Agtr1a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686657SS-<i>Agtr1a<sup>em5Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em5Mcwi-</sup>/Agtr1a<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686659SS-<i>Agtrap<sup>em8Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em8Mcwi-</sup>/Agtrap<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686662SS-<i>Agtrap<sup>em8Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em8Mcwi+</sup>/Agtrap<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686664SS-<i>Aldh2<sup>em2Mcwi-/-</sup></i>SS-<i>Aldh2<sup>em2Mcwi-</sup>/Aldh2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686666SS-<i>Aldh2<sup>em2Mcwi+/+</sup></i>SS-<i>Aldh2<sup>em2Mcwi+</sup>/Aldh2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686668SS-<i>Cdh13<sup>em1Mcwi-/-</sup></i>SS-<i>Cdh13<sup>em1Mcwi-</sup>/Cdh13<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688037SS-<i>Mmp2<sup>em2Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em2Mcwi+</sup>/Mmp2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688039SS-<i>Mthfr<sup>em1Mcwi+/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi+</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688041SS-<i>Mthfr<sup>em1Mcwi-/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi-</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688043SS-<i>Nckap5<sup>em1Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em1Mcwi-</sup>/Nckap5<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688045SS-<i>Nckap5<sup>em1Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em1Mcwi+</sup>/Nckap5<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5508304WUN-<i>Abcc2<sup>TR-</i></sup>/HsdRrrcSpontaneous mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC).mutantEmbryo; SpermAbcc223665508305F344-WUN-<i>Abcc2<sup>TR-</i></sup>Dpp4<sup>DPPIV-</i></sup>/DchcHsdRrrcThe DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital.mutantEmbryo; SpermDpp425155686318SS-<i>Sh2b3<sup>em1Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686320SS-<i>Sh2b3<sup>em1Mcwi+/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi+</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686322SS-<i>Sh2b3<sup>em1Mcwi-/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686326SS-<i>Ulk3<sup>em4Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686328SS-<i>Ulk3<sup>em4Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi+</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686330SS-<i>Ulk3<sup>em4Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686332SS-<i>Wdr72<sup>em2Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em2Mcwi-</sup>/Wdr72<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686335SS-</i>Wdr72<sup>em2Mcwi+/+</sup></i>SS-</i>Wdr72<sup>em2Mcwi+</sup>/Wdr72<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686728SS-Nppa<sup>em4Mcwi+/+</sup>SS-Nppa<sup>em4Mcwi+</sup>/Nppa<sup>em4Mcwi+</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686730SS-Nppb<sup>em2Mcwi-/-</sup>SS-Nppb<sup>em2Mcwi-</sup>/Nppb<sup>em2Mcwi-</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686732SS-Nppb<sup>em2Mcwi+/+</sup>SS-Nppb<sup>em2Mcwi+</sup>/Nppb<sup>em2Mcwi+</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688047SS-<i>Nckap5<sup>em2Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em2Mcwi-</sup>/Nckap5<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688049SS-<i>Nckap5<sup>em2Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em2Mcwi+</sup>/Nckap5<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688051SS-<i>Nckap5<sup>em3Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em3Mcwi-</sup>/Nckap5<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688053SS-<i>Nckap5<sup>em3Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em3Mcwi+</sup>/Nckap5<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688059SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/-</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688061SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688063SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688066SS-<i>Ncf2<sup>em1Mcwi-/-</sup></i>SS-<i>Ncf2<sup>em1Mcwi-</sup>/Ncf2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688069SS-<i>Ncf2<sup>em1Mcwi+/+</sup></i>SS-<i>Ncf2<sup>em1Mcwi+</sup>/Ncf2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688074SS-<i>Nox4<sup>em2Mcwi-/-</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688077SS-<i>Nox4<sup>em2Mcwi+/+</sup></i>SS-<i>Nox4<sup>em2Mcwi+</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5509086ACI.BN-(<i>D5Rat72-D5Rat36</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5509087ACI.BN-(<i>D5Rat113-D5Rat159</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenic5686734SS-<i>Nppb<sup>em4Mcwi-/-</sup></i>SS-<i>Nppb<sup>em4Mcwi-</sup>/Nppb<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686736SS-<i>Nppb<sup>em4Mcwi+/+</sup></i>SS-<i>Nppb<sup>em4Mcwi+</sup>/Nppb<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686738SS-<i>Plcd3<sup>em4Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em4Mcwi-</sup>/Plcd3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686740SS-<i>Plcd3<sup>em4Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em4Mcwi+</sup>/Plcd3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686742SS-<i>Plcd3<sup>em7Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em7Mcwi-</sup>/Plcd3<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686744SS-<i>Plcd3<sup>em7Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em7Mcwi+</sup>/Plcd3<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686747SS-<i>Plekha7<sup>em1Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em1Mcwi-</sup>/Plekha7<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686749SS-<i>Plekha7<sup>em1Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em1Mcwi+</sup>/Plekha7<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686758SS-<i>Plekha7<sup>em4Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em4Mcwi-</sup>/Plekha7<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686760SS-<i>Plekha7<sup>em4Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em4Mcwi+</sup>/Plekha7<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5686762SS-<i>Plod1<sup>em1Mcwi-/-</sup></i>SS-<i>Plod1<sup>em1Mcwi-</sup>/Plod1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688080SS-<i>Nox4<sup>em2Mcwi-/+</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688083SS-<i>Prex1<sup>em2Mcwi-/-</sup></i>SS-<i>Prex1<sup>em2Mcwi-</sup>/Prex1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688107FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-/-</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-</sup>/Sorcs1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688109FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+/+</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+</sup>/Sorcs1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688111SS-<i>Tfdp2<sup>em2Mcwi-/-</sup></i>SS-<i>Tfdp2<sup>em2Mcwi-</sup>/Tfdp2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688113SS-<i>Tfdp2<sup>em2Mcwi+/+</sup></i>SS-<i>Tfdp2<sup>em2Mcwi+</sup>/Tfdp2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688116SS-<i>Tgfb1<sup>em1Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em1Mcwi+</sup>/Tgfb1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688119SS-<i>Tgfb1<sup>em3Mcwi-/+</sup></i>SS-<i>Tgfb1<sup>em3Mcwi-</sup>/Tgfb1<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688121SS-<i>Ube2q2<sup>em3Mcwi-/-</sup></i>SS-<i>Ube2q2<sup>em3Mcwi-</sup>/Ube2q2<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688123SS-<i>Ube2q2<sup>em3Mcwi+/+</sup></i>SS-<i>Ube2q2<sup>em3Mcwi+</sup>/Ube2q2<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant5688125SS-<i>Ulk4<sup>em3Mcwi-/-</sup></i>SS-<i>Ulk4<sup>em3Mcwi-</sup>/Ulk4<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutant6478789LEW-Tg(CAG-EGFP)YsRrrcTransgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancerÿ¿promoter and rabbit b-globin poly(A) signal.transgenicEmbryo; Sperm; Cryo-recovery6893530BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/RhwKoletsky rat leptin receptor mutant (lepr) from the LA/N-<i>cp</i> was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle.congenic6893599SS-<i>Pdc<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5.mutantSpermPdc<sup>em3Mcwi</sup>56877126893600SS-<i>Abcb1b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.mutantSpermAbcb1b<sup>em2Mcwi</sup>68935986893429SS-<i>Nos3<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3.mutantSpermNos3<sup>em8Mcwi</sup>68934216893430SS-<i>Nat8<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1.mutantSpermNat8<sup>em4Mcwi</sup>68934136893431SS-<i>Nos3<sup>em13Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4mutantLive Animals; SpermNos3<sup>em13Mcwi</sup>68934226893432SS-<i>Hvcn1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.mutantSpermHvcn1<sup>em1Mcwi</sup>68934106893433SS-<i>Nos3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.mutantSpermNos3<sup>em2Mcwi</sup>68934186893434SS-<i>Kcnj16<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.mutantLive Animals; SpermKcnj16<sup>em1Mcwi</sup>68934236893435SS-<i>Tfdp2<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6.mutantSpermTfdp2<sup>em6Mcwi</sup>68934176893436SS-<i>Kcnmb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2.mutantSpermKcnmb1<sup>em1Mcwi</sup>68934156893437BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.mutantExtinctIl1r1<sup>em1Mcwi</sup>68934256893438SS-<i>Fgf1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3.mutantSpermFgf1<sup>em2Mcwi</sup>68934126893439SS-<i>Hvcn1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.mutantSpermHvcn1<sup>em2Mcwi</sup>68934196893440SS-<i>Fyn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.mutantExtinctFyn<sup>em1Mcwi</sup>68934116893441SS-<i>Grm7<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3.mutantSpermGrm7<sup>em2Mcwi</sup>68934166893442SS-<i>Pparg<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 133-bp deletion of part of intron 4 and exon 5.mutantSpermPparg<sup>em1Mcwi</sup>68934246893443BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.mutantExtinctIl1r1<sup>em2Mcwi</sup>68934146893444SS-<i>Kcnmb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2.mutantSpermKcnmb1<sup>em3Mcwi</sup>68934206893382BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwi-<i>Il1r1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5.mutantLive Animals; SpermIl1r1<sup>em3Mcwi</sup>68933786893383SS-<i>Fyn<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4.mutantSpermFyn<sup>em6Mcwi</sup>68933806893384SS-<i>Kcnj11<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.mutantSpermKcnj11<sup>em9Mcwi</sup>68933816893385SS-<i>Kcnj11<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1.mutantSpermKcnj11<sup>em5Mcwi</sup>68933796484574SS-<i>Umod<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.mutantExtinctUmod<sup>em1Mcwi</sup>56876976484575SS-<i>Resp18<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3.mutantSpermResp18<sup>em3Mcwi</sup>56877146484576SS-<i>Adipoq<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.mutantSpermAdipoq<sup>em1Mcwi</sup>56877096484577SS-<i>Gnb3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7.mutantSpermGnb3<sup>em1Mcwi</sup>56876966484578SS-<i>Mylip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.mutantSpermMylip<sup>em1Mcwi</sup>55083476484579SS-Chr 5<sup>BN</sup>-<i>Cyp4a3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.mutantExtinctCyp4a3<sup>em3Mcwi</sup>56877376484580SS-<i>Ldlr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4.mutantLdlr<sup>em2Mcwi</sup>51440946484581SS-<i>Resp18<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp substitution in exon 3.mutantSpermResp18<sup>em2Mcwi</sup>56877056484582SS-<i>Cd247<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.mutantLive Animals; SpermCd247<sup>em1Mcwi</sup>56877036484583SS-<i>Nr2f2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.mutantSpermNr2f2<sup>em1Mcwi</sup>56877216484584SS-<i>Adipoq<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1.mutantSpermAdipoq<sup>em2Mcwi</sup>56877166484585SS-<i>Slc7a9<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.mutantSpermSlc7a9<sup>em2Mcwi</sup>56877016902893BB.SHR-(<i>Acsm3-Igf2</i>)/KCongenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK ratscongenic6903912SS.SHR-(<i>D9Mco72-D9Rat89</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903914SS.SHR-(<i>D9Mco72-D9Rat55</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903917SS.SHR-(<i>D9Mco72-D9Mco109</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903920SS.SHR-(<i>D9Mco72-D9Uia4</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903922SS.SHR-(<i>D9Mco72-D9Mco106</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903925SS.SHR-(<i>D9Mco72-D9Mco105</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903928SS.SHR-(<i>D9Rat7-D9Got111</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903932SS.SHR-(<i>D9Rat7-D9Rat52</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903934SS.SHR-(<i>D9Rat7-D9Mco91</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903936SS.SHR-(<i>D9Rat7-D9Rat84</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenic6903879SS/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japaninbred6903881SR/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japaninbred6903902WF.COP-(<i>D2Uwm14-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.congenic6903904WF.COP-(<i>D2Uwm17-D2Rat16</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.congenic6766770BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwiThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of Wisconsincongenic6893535BBDR.LA-(<i>D5Rat98-D5Rat233</i>), BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwHeterozygous BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/Rhw (DR.<sup><i>lepr</sup></i>) were crossed with homozygous BBDR.BBDP-(-(<i>D4Mit6-D4Mit7</i>)/Rhw (DR.<sup><i>Gimap5</sup></i>), to geenrate teh double congenic rats that had mutations for Gimap5 and lepr genes.congenic6484711SS-<i>Atp2b1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.mutantSpermAtp2b1<sup>em2Mcwi</sup>64847076484712SS-<i>Lpin1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3.mutantSpermLpin1<sup>em1Mcwi</sup>64847096484713SS-<i>Cubn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14.mutantSpermCubn<sup>em1Mcwi</sup>64847056484714SS-<i>Lss<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2.mutantSpermLss<sup>em2Mcwi</sup>64847066484715SS-<i>Adora2b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1mutantSpermAdora2b<sup>em2Mcwi</sup>56876986484716SS-<i>Bcat1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 5mutantSpermBcat1<sup>em2Mcwi</sup>64847086484717SS-<i>Cacna1h<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11.mutantSpermCacna1h<sup>em2Mcwi</sup>64847036484718SS-<i>Ace<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6.mutantLive Animals; SpermAce<sup>em2Mcwi</sup>64847046484719SS-<i>Lepr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion in exon 11.mutantSpermLepr<sup>em2Mcwi</sup>64847016484720SS-<i>Lep<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.mutantSpermLep<sup>em5Mcwi</sup>64847006484721SS-<i>Ace<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6.mutantLive Animals; SpermAce<sup>em1Mcwi</sup>64847026893551DA.PVG.1AV1-(<i>D1Rat32-D1Rat51</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicSpermNeurobiology6893554DA.PVG.1AV1-(<i>D1Rat193-D1Rat68</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicSpermNeurobiology7245556WKHT/EdhWKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR.inbred7365040SS.SR-(<i>rs65785750-rs13452155</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic7365043SS.SR-(<i>rs65785750-rs106808193</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic7411634WDB/NipsCrlj:WI females were bred to DA/Slc males to generate F<sub>1</sub> pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating.inbred8551714SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D10Chm246-D10Chm257</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Aydcongenic8551716SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Aydcongenic8551718SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Aydcongenic8551721SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551723SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8551725SS.LEW-(<i>D8Chm12-D8Rat15</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Chm12-D8Rat15</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8551727SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8551737SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551739SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8551748SS.LEW-(<i>D3Rat17-D3Mco80</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat17-D3Mco80</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic7771589SS.SR-(<i>D2Rat352-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic8551711SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8552285F344.WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferasetransgenicSperm8552346DA.PVG.1AV1-(<i>D4Rat107-D4Got132</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations.congenicSpermNeurobiology8552348DA.PVG.1AV1-(<i>D13Rat105-D13Rat131</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats.congenicSpermNeurobiology8657079SS.LEW-(<i>D18Chm124-D18Chm126</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic7240512DA.PVG.1AV1-(<i>D4Rat113-D4Kiru80</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenic7240513DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenic7240514DA.PVG.1AV1-(<i>D4Kiru12-D4Kiru55</i>)/KiruCongenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kiru onto the genetic background of DA/ZtmKinicongenic7240521DA.PVG.1AV1-(<i>D4Kini3-D4Rat177</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic straincongenic7240522DA.PVG.1AV1-(<i>D4Kini3-D4Mgh14</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic straincongenicSpermViral encephalitis (HSE)7777138SS.LEW-(<i>D5Mco41-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic7777140SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco41-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1Mco and SS.LEW-(<i>D5Mco41-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenic7777143SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic7800692MKO/TamiMinko RatMKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism.inbredLiving Animals; Embryo7800694NER.F344-(<i>D1Rat132</i>)(<i>D5Rat100</i>)/KyoDeveloped by the DEPOSITORcongenic7800705KHR/Kyo<sup>-/+</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).mutantEmbryo; SpermDermatologyOca223184128551752SS.LEW-(<i>D1Rat320-D1Mgh32</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551755SS.LEW-(<i>D1Chm64-D1Rat19</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Chm64-D1Rat19</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551757SS.LEW-(<i>D7Uia3-D7Mgh1</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D7Uia3-D7Mgh1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Aydcongenic7411703SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentscongenic7411705SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentscongenic7411707SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)/Izmmale SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izmcongenic7411709SHRSP.SHR-(<i>D1Mit30-D1Rat269</i>)/Izmmale SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izmcongenic7800702KHR/Kyo<sup>-/-</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).mutantEmbryo; SpermDermatologyOca223184128551763SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8662878LOU.BN-(<i>D5Rat59-D5Rat125</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenic6907094WF.WKY-(<i>D5Uwm87-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907096WF.WKY-(<i>D5Uwm85-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907098WF.WKY-(<i>D5Uwm82-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907100WF.WKY-(<i>D5Uwm82-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907104WF.WKY-(<i>D5Uwm77-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic7207880LEW.WKY-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsdcongenic7771610SHRSP-Chr 1<sup>F344</sup>/RkbSHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomic8551750SS.LEW-(<i>D1Uia4-D1Rat320</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D1Uia4-D1Rat320</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8657399SS.MNS-(<i>D2Chm214-D2Chm302</i>)/AydCongenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic8657402SS.LEW-(<i>D3Rat52-D3Chm57</i>),MNS-(<i>D2Chm214-D2Chm302</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Chm57</i>)/Ayd, SS.MNS-(<i>D2Chm214-D2Chm302</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic7421599SS.LEW-(<i>D1Chm64-D1Rat19</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421606SS.LEW-(<i>D1Uia4-D1Rat320</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421617SS.LEW-(<i>D17Chm14-D17Rat65</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421619SS.LEW-(<i>D17Chm85-D17Chm71</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421621SS.LEW-(<i>D17Chm31-D17Chm93</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421623SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7771600SS.SR-(<i>rs106870553-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic8142383SHRSP/BbbUtxAnimals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of Heidelberginbred8142385SHR/UtxAnimals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974inbred8549599BN.LEW-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental BN/Rj and LEW/Rj strains.congenic8552331F344-<i>Il2rg<sup>em7Kyo</sup></i>The strain having a Endonuclease-induced mutation in Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University.mutantHematology; Immunology7421612SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydA segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic8551759SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551761SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Got112-Igfbp4</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Got112-Igfbp4</i>)/Aydcongenic8551880DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8661235FHH-Tg(T2/Rab38)AMcwiThis strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4)transgenicRab386287528661233SS-Tg(T2GFP)E3McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4)transgenic8663453BN.ACI-(<i>D14Uwm4-D14Rat39</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.congenic8663455BN.ACI-(<i>D14Uwm1-D14Uwm5</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.congenic7241594(SDxF344)F1-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.mutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241595(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offsprings were intercrossed and maintained as wild typemutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241596(SDxF344)F1-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offsprings were intercrossed and maintained as wild typemutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241597(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on (Hsd:SD x F344/NHsd)F1 x BN/SsNHsd.mutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937204133LEW-<i>Rag1<sup>em1Ztm</sup></i>This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.mutantRag1<sup>em1Ztm</sup>72041328552366WI-Tg(CAG-Cre)NipsThe construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenic8552368WI-Tg(CAG/Venus)NipsThe construct contains L2-Venus × CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenic8552371WDB-<i>Rosa26<sup>em1(RT2)Nips</sup></i>This strain was produced by knock-in in the rat Rosa26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb)mutant7777180SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic8552364WI-Tg(L2-Venus)NipsThe construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenic8552293SR/JrSeacDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRPinbredEmbryo; SpermCardio- Hypertension8662861LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbbthe desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbbcongenic8657392SS.LEW-(<i>D10Rat155-D10Chm171</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenic9587466SD-Tg(UBC-Cre/ERT2)7NarlThis strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter.transgenicEmbryoUBC13468537401201SS.SR-(<i>D17Rat24-rs106534785</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic7401203SS.SR-(<i>rs105019230-D17Rat44</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenic8553005BN/RijHsdArcTo Animal Resources Centre, Australia from Harlan.inbred8662449LOU/MBbbLOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germanyinbred8663462ACI.BN-(<i>D7Uwm32-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic8657361SS.MNS-(<i>D2Chm254-D2Chm161</i>),LEW-(<i>D10Chm246-D10Chm257</i>),LEW-(<i>D16Chm48-D16Chm60</i>),LEW-(<i>D18Rat55-D18Mgh2</i>)/AydA congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm254-D2Chm161</i>)/Ayd, SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/Aydcongenic9587464SD-Tg(UBC-DsRedT3-emGFP)18NarlSD-Tg(UBC-DsRedT3-emGFP)18This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.transgenicLive AnimalsUBC13468539587475SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-Cre)NarlThis strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinasetransgenic7241047LE-<i>Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup></i>This strain was produced by crossing LE-Lrrk1<sup>em1Sage</sup> with LE-Lrrk2<sup>em1Sage</sup>mutantLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241048LE-<i>Park7<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5mutantPark7<sup>em1Sage</sup>72410427241049LE-<i>Pink1<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantPink1<sup>em1Sage</sup>72410467241050LE-<i>Lrrk2<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30.mutantLrrk2<sup>em1Sage</sup>72410457241051LE-<i>Lrrk1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.mutantLrrk1<sup>em1Sage</sup>72410447241052LE-<i>Park2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantPark2<sup>em1Sage</sup>72410417241053LE-<i>Lrrk1<sup>em1Sage-/-</sup>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241054LE-<i>Pink1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4.mutantPink1<sup>em1Sage</sup>72410467241055LE-<i>Park7<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantPark7<sup>em1Sage</sup>72410427241056LE-<i>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantLrrk2<sup>em1Sage</sup>72410457241057LE-<i>Lrrk1<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantLrrk1<sup>em1Sage</sup>72410447241058LE-<i>Park2<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4.mutantPark2<sup>em1Sage</sup>72410417794700SS.LEW-(<i>D5Mco39-D5Mco41</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic8553013SHR/NCrlArcTo Animal Resources Centre from Charles Riverinbred8553015WKY/NCrlArcTo Animal Resources Centre from Charles Riverinbred8663464ACI.BN-(<i>D7Uwm33-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic6907054WF.WKY-(<i>D5Uwm67-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907057WF.WKY-(<i>D5Uwm76-D5Uwm61</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907059WF.WKY-(<i>D5Uwm76-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907061WF.WKY-(<i>D5Uwm67-D5Uwm78</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907063WF.WKY-(<i>D5Uwm76-D5Got18</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic7204136Wild-<i>Rag1<sup>em1Ang</sup></i>This strain was produced by injecting ZFNs into wild rat embryos. The resulting mutation is a 21-bp frameshift deletion in exon 2.mutantRag1<sup>em1Ang</sup>72041357241239DA.BN-(<i>D9Wox18-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241240DA.BN-(<i>D9Mit6-D9Rat29</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241241DA.BN-(<i>D9Mit6-D9Got15</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241242DA.BN-(<i>D9Got8-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241243DA.BN-(<i>D9Wox24-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicSpermNeurobiology7241244DA.BN-(<i>D9Wox24-D9Wox18</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241245DA.BN-(<i>D9Wox24-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241246DA.BN-(<i>D9Wox24-D9Rat44</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7241247LEW.BN-(<i>D9Got8-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic6907436SS.BN-(<i>D13Hmgc41-D13Hmgc23</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic6907438SS.BN-(<i>D13Rat77-D13Rat105</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic6907445SS.BN-(<i>D13Rat124-D13Rat101</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenic7247594WKY.SHR-(<i>D1Rat90-D1Mit18</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenic7241248LEW.BN-(<i>D9Wox24-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenic7394821P.NP-(<i>Snca-D4Rat35</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenic7794691SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenic8551885DA.PVG.1AV1-(<i>D4Mit22-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8551887DA.PVG.1AV1-(<i>D4Got126-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8551889DA.PVG.1AV1-(<i>D4Rat62-D4Got136</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8655992W-<i>Lepr</i><sup>faNin</sup>Spontaneously developed obese rat in the colony of inbred W/Nin was isolated and selectively bredmutant7245521SD-Tg(SNCA)3Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (TH)promoter was microinjected into SD ovocytes to generate 3 transgenic rat linestransgenic7245523SD-Tg(SNCA)4Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (TH)promoter was microinjected into SD ovocytes to generate 3 transgenic rat linestransgenic7247286F344-Tg(APP)21BeseyF344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats.transgenicSperm7247289SD-Tg(TETRA-EGFP)BeseySD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pΔ8.9 and pVSV-G into a 293FT packaging cell linetransgenicSperm7247290SD-Tg(P2ry2)BeseySD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA.transgenicSperm7248453SS.BN-(<i>D12Hmgc3-AU047911</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenic7248454SS.BN-(<i>D12Hmgc7-D12Hmgc6</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenic7248456SS.BN-(<i>D12Hmgc3- D12Got29</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenic7364919SS.BN-(<i>rs64114288-rs107464428</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background.congenicSpermcardiac ischemia7364923SS.BN-(<i>rs106982173-rs65057186</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.congenicSpermcardiac ischemia7364927SS.BN-(<i>rs13453786-rs66377062</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.congenicSpermcardiac ischemia7364932ACI.BN-(<i>D7Rat86-rs198562267</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7364934ACI.BN-(<i>rs199006987-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7364936ACI.BN-(<i>rs198562267-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7364938(LE x RCS-<i>p</i><sup>+</sup>/LavRrrc)F1RCS-<i>p</i><sup>+</sup>/LavRrrc males were mated to LE females.congenicSpermRetinal ResearchMertk692837364940F344-<i>Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc</i>Backcrossed STOCK-Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc with F344 using speed congenic approach to move mutation onto F344 genetic background.mutanttumorigenesis model8662925LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenic8551864DA.LEW.1AV1-(<i>D4Mgh17-D4Mgh21</i>)/KiruLEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats.congenic8551866LEW.1AV1.DA-(<i>D4Mgh17-D4Rat203</i>)/KiruDA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats.congenic8551868PVG.1AV1.DA-(<i>D4Mgh17-D4Rat84</i>)/KiruDA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats.congenic8551882DA.PVG.1AV1-(<i>D4Rat203-D4Mit22</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic7247278SD-Tg(Camk2a-tTA)XgxCamk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water.transgenicSperm7247279SD-Tg(TRE-FUS-R521C)XgxOverexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element.transgenicSperm7247280SD-Tg(TRE-LacZ)XgxLacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression.transgenicSperm8548794F344-Tg(NC1-269B17)1NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicSpermCasp322758662933LOU.BN-(<i>rs65016308-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenic8663458ACI.BN-(<i>D7Rat164-D7Rat22</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic8548809F344-Tg(NC1-269B17)2NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicSpermCasp322758548812F344-Tg(NC1-269B17)3NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicSpermCasp322758548815F344-Tg(NC1-269B17)4NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicSpermCasp322758548817KDP.PVG-RT1<sup>a/u</sup>/NyoMHC haplotype (RT1.B<i>a</i>D<i>a</i>) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.B<i>u</i>D<i>u</i>). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib matingcongenicSpermDiabetes Obesity9587470SD-Tg(UBC-DsRedT3-emGFP)26NarlThis strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.transgenicEmbryoUBC13468537245527WKHA/Edhderived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressureinbred7394698ZUC.BN-(<i>D1Rat42-D1Rat90</i>)/Stehomozygous lean wild-type ZUC-<I>Lepr</I><sup>+Ste</sup> were crossed with BN/Crl to get F<sub>1</sub>; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markerscongenic7411676SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/GcrcCongenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background.congenic7411679SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)(<i>D3Mgh16-D3Rat114</i>)/GcrcF<sub>1</sub> rats generated by crossing SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/Gcrc and SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc were backcrossed to SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get teh desired bicongenic straincongenic8657351SS.MNS-(<i>D2Chm366-D2Rat52</i>),LEW-(<i>D18Rat61-D18Rat45</i>),LEW-(<i>D10Chm128-D10Chm121</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm366-D2Rat52</i>)/Ayd, SS.LEW-(<i>D18Rat61-D18Rat45</i>)/Ayd and SS.LEW-(<i>D10Chm128-D10Chm121</i>)/Aydcongenic8662955LOU.BN-(<i>rs13448399-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenic8662958LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbb-/+this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenic8549776F344-<i>Lep<sup>m1Kyo</sup></i>F344 OB ratThis strain has Lep mutation (Q92X)mutantLive AnimalsDiabetes ObesityLep30008549778PVG.KDP-<i>Cblb<i>/NyoPVG.KDP-Cblb congenicDeveloped by the DEPOSITORcongenicEmbryoDiabetes ObesityCblb6205358549779DRU/UubcThe mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 1991inbredEmbryo8549782SD.GR-<i>Ugt1a1<sup>j</i></sup>/AonDeveloped by the DEPOSITORcongenicSpermNeurobiology; MetabolismUgt1a139358549785W.GR-<i>Ugt1a1<sup>j</i></sup>/AonDeveloped by the DEPOSITORcongenicNeurobiology; MetabolismUgt1a139357349357DA.PVG.1AV1-(<i>D4Got128-D4Got136</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenic8552341DA.PVG.1AV1-(<i>D10Got6-D10Rat184</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations.congenicSpermNeurobiology8552351DA.PVG.1AV1-(<i>D9Wox24-D9Rat44</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003.congenicSpermNeurobiology7364902SS-Chr 2<sup>BN</sup>/1McwiAekCompared to the current SS-Chr 2<sup>BN</sup>/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2<sup>BN</sup>/Mcwi strain).consomicEmbryoStudies of ischemia reperfusion injury or hypertension7364954DA.ACI-(<i>D2Mit12-D2Got121</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364956DA.ACI-(<i>D2Wox20-D2Mit14</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364959DA.ACI-(<i>D2Uwm24-D2Rat54</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364970DA.ACI-(<i>D12Mit2-D12Got49</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364974DA.F344-(<i>D10Rat195-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364976DA.F344-(<i>D10Rat195-D10Arb27</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364978DA.F344-(<i>D10Arb27-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies8662874LOU.BN-(<i>D5Rat59-D5Rat127</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbb to LOU/MBbbcongenic7364879SS-<i>Apoe<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3mutantSpermApoe<sup>em8Mcwi</sup>51319157364880SS-<i>Cst3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.mutantSpermCst3<sup>em1Mcwi</sup>56877087364881SS-<i>Slc7a9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6.mutantSpermSlc7a9<sup>em1Mcwi</sup>56877007364882SS-<i>Sorcs2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15.mutantSpermSorcs2<sup>em1Mcwi</sup>55083437364981DA.F344-(<i>D7Rat22-D7Rat15</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous statecongenicSpermarthritis/autoimmunity studies7364991ACI/EurMcwiACI (August × Copenhagen Irish)substrain of ACI derived from ACI/EurinbredEmbryo; SpermRenal disease7800671F344-<i>Sv2a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Sv2a: synaptic vesicle glycoprotein 2amutantSv2a6197157800673KFRS2/Kyo<sup>-/+</sup>KFRS2<sup>-/+</sup>A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.mutantLive Animals; SpermOphthalmology; DermatologyTyr15897558552279WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferasetransgenicSperm8552287F344.WIC-Tg<i><sup>rdw</i>Kts</sup>Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.congenicSpermMetabolism8552296UPL/CasTakeuSubstrain of UPLinbredEmbryoOphthalmology8552996F344/Arcsubstrain of F344 bred at Animal Resources Centre Australiainbred8553001ArcCrl:CD(SD)substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system.outbred8553003ArcCrl:WIWistar ratsFrom Charles River to Animal Resources Centre, Australiaoutbred8553008LEW/CrlArcLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles Riverinbred8553010PVG/Arcsubstrain of PVG maintained at Animal Resources Centreinbred7257663WI-<i>Tlr4<sup>em1Geh</i></sup>This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WImutantalcohol action, immune system function, septic shockTlr4<i><sup>em1Geh</i></sup>72576617401261LOU/NimrOlaHsdLouvainLOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to HarlaninbredCryopreserved8553006DA/Arcsubstrain of DA bred at Animal Resources Centre, Australiainbred8655977W/NinWistar NINInbred stock of Wistar rats dating back to 1920inbred7800661F344.Cg-<i>Du Tyr<sup>CKyo+/+</i></sup>downunder ratDeveloped by the DEPOSITORmutant8552309ODUS/OduThe mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991.inbredEmbryo8552311ODUR/OduThis inbred strain was established from WKY rats as a control for ODUS/Odu.inbredEmbryo8552313DA.PVG.1AV1-(<i>D10Rat81-D10Rat238</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicSpermNeurobiology8552315W-Tg(Thy1-COP4/YFP*)4JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicSpermOphthalmology; Otorhinology8552317W-Tg(Thy1-COP4/YFP*)5JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicSpermOphthalmology; Otorhinology8552319W-Tg(Thy1-COP4/YFP*)6JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicSpermOphthalmology; Otorhinology8552321SHR-Tg(APOC3-CETP)1TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs.transgenicEmbryoDiabetes Obesity; Neurobiology8552323SHR-Tg(APOC3-CETP)2TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.transgenicSpermDiabetes Obesity; Neurobiology8552325SHR-Tg(APOC3-CETP)3TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs.transgenicSpermDiabetes Obesity; Neurobiology8552327SHR-Tg(APOC3-CETP)4TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.transgenicSpermDiabetes Obesity; Neurobiology8552329W-Tg(Nqo1)KopThe transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs.transgenicSpermOncology; Metabolism7800676KFRS3A/Kyo<sup>+/+</sup>A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.mutant8552235SD-Tg(Pbsn-TAg)1ObsSV40 Large T Antigen along with Rat probasin promotertransgenicSpermPbsn7085718552267SHRSP.WKY-(<i>D1Rat116-D1Wox10</i>)/TkyoDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity8552269SHRSP.WKY-(<i>D1Tkyo58-D1Rat90</i>)/TkyoDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity8552271SHRSP.WKY-(<i>D1Rat27-D1Wox18</i>)/TkyoDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity8552273SHRSP.WKY-(<i>D1Tkyo57-D1Wox18</i>)/TkyoDeveloped by the DEPOSITORcongenicSpermDiabetes Obesity8552275F344-<i>Lgi1<sup>m1Kyo</i></sup>Developed by gene driven ENU mutagenesis. Lgi1-mutant rats carrying a missense mutation (L385R).mutantSpermLgi16287428552298DA-<i>Tyr<sup>em1Kyo</i></sup>Developed by the DEPOSITORmutantSpermBehavior; DermatologyTyr15897558552303DA-<i>Tyr<sup>em2Kyo</i></sup>Developed by the DEPOSITORmutantSperm; Live AnimalsBehavior; Dermatology8657348SS.LEW-(<i>D17Chm31-D17Chm93</i>),MNS-(<i>D2Rat155-D2Chm161</i>),LEW-(<i>D18Chm41-D18Rat92</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd, SS.MNS-(<i>D2Rat155-D2Chm161</i>)/Ayd and SS.LEW-(<i>D18Chm41-D18Rat92</i>)/Aydcongenic7243955DA.F344-(<i>D4Got44-D4Arb21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7349321LEXF2D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbred7349322LEXF8B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbred7394818P.NP-(<i>D4Mgh16-D4Rat173</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenic7421634SS.MNS-(<i>D2Got93-D2Rat222</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421636SS.MNS-(<i>D2Chm90-D2Rat38</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421638SS.MNS-(<i>D2Chm381-D2Chm225</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421640SS.MNS-(<i>D2Rat155-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421643SS.MNS-(<i>D2Chm254-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421645SS.MNS-(<i>D2Rat155-D2Chm419</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421647SS.MNS-(<i>D2Chm161-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421649SS.MNS-(<i>D2Chm153-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421651SS.MNS-(<i>D2Chm442-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421654SS.MNS-(<i>D2Chm366-D2Rat52</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7240510DA.PVG.1AV1-(<i>D4Rat113-D4Kiru96</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenic7421603SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic7421610SS.LEW-(<i>D5Mit5-D5M4Mit14</i>)/AydA segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenic8551872DA.PVG.1AV1-(<i>D4Rat155-D4Rat113</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8551874DA.PVG.1AV1-(<i>D4Rat63-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8551876DA.PVG.1AV1-(<i>D4Rat203-D4Got130</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic8657051F344/NinSubstrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India.inbred7248725ACI.BN-(<i>D7Rat164-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248727ACI.BN-(<i>D7Rat164-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248729ACI.BN-(<i>D7Rat206-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248731ACI.BN-(<i>D7Rat164-D7Uwm31</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248733ACI.BN-(<i>D7Rat164-D7Uwm33</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248736ACI.BN-(<i>D7Uwm32-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248738ACI.BN-(<i>D7Uwm36-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248740ACI.BN-(<i>D7Uwm38-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248742ACI.BN-(<i>D7Uwm33-D7Mit27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248744ACI.BN-(<i>D7Uwm33-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248746ACI.BN-(<i>D7Uwm41-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic7248748ACI.BN-(<i>D7Uwm28-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenic8655639WAG/NovSubstrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)inbred8655663WAG.OXYS-(<i>D1Rat219-D1Rat81</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Novcongenic9586448SHR/NCrlPrinSubstrain of SHR originally from Charles River now maintained at University of Californiainbred9586450SHR/OlaIpcvPrinThese are substrains of SHR from Czech Academy of Sciences now maintained at University of Californiainbred7246924HanTacFcfiq:WHWistar HannoverReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.outbred8551772SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551774SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic6907076WF.WKY-(<i>D5Uwm78-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907078WF.WKY-(<i>D5Uwm95-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907080WF.WKY-(<i>D5Uwm67-D5Uwm81</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907084WF.WKY-(<i>D5Uwm76-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907087WF.WKY-(<i>D5Uwm78-D5Uwm84</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907090WF.WKY-(<i>D5Uwm78-D5Uwm93</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic6907092WF.WKY-(<i>D5Uwm88-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenic7257722WKY.SHR-(<i>D1Mgh14-D1Rat77</i>)/IwaiFragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrljcongenic8661234SS-Tg(T2ePet-eGFP)A1McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4)transgenic6907047WF.WKY-(<i>D5Uwm63-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenic7777135SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic8551778SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D3Rat2-D3Chm79</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Aydcongenic8551892DA.PVG.1AV1-(<i>D4Rat113-D4Rat62</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenic7241811BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)(<i>D13Rat124-D13Mgh5</i>)/Sunna double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunncongenic7244374FXLE/StmRecombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating.advanced_intercross_line7244380DA.F344(Cia3c)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7244381DA.F344(Cia3e)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7246927NTacFcfiq:SDSprague DawleyReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.outbred7246928NTac:NIH-<i>Foxn1</i><sup>rnu</sup>nudeThe NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation.outbred7246929NTacFcfiq:NIH-<i>Foxn1</i><sup>rnu</sup>nudeReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female.outbred8655660WAG.OXYS-(<i>D1Rat30-D1Rat219</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Novcongenic7241265SHR-Chr Y<sup>WKY</sup>/MetWKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosomeconsomic7241267WKY-Chr Y<sup>SHR</sup>/MetSHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosomeconsomic7241271SHR.BN-(<i>D10Mit4-D10Wox11</i>)/CubSegment of chromosome 10 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congeniccongenic7794694SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic7794696SS.LEW-(<i>D5Mco43-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic7794698SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco43-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3Mco and SS.LEW-(<i>D5Mco413-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenic7794704SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenic7794706SS.LEW-(<i>D5Mco39-D5Mco41</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco41</i>)/Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenic7800667F344.Cg-<i>Foxn1<sup>rnuKyo-/+</sup></i>Jic N13 to Kyo (1988)mutantLive Animals; SpermImmunology; CancerFoxn139707245481SD-Tg(hsMt-LacZ)Rehpresses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium.transgenicEmbryo; Sperm7245482SD-Tg(ROSA26-EGFP)RehRrrcStrain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development.transgenicEmbryo; Sperm7245488SD-Tg(Chat-tTA)Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.transgenicSperm7245494SD-Tg(TRE-TDP43-M337V)Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.transgenicSperm8547938CrljJcl:SDSprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc.outbred8552337DA.PVG.1AV1-(<i>D10Got406-D10Rat93</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls.congenicSpermNeurobiology9587473SD-Tg(UBC-emGFP)18NarlThis strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18NarltransgenicLive AnimalsUBC13468537800659F344.Cg-<i>Du Tyr<sup>C</sup></i>/Kyodownunder ratDeveloped by the DEPOSITORcongenicDevelopment8549798WMS/SimNcpMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata UniversityinbredEmbryo8551776SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Aydcongenic8551782SS.LEW-(<i>D18Chm90-D18Chm4</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic7241794SHR/BbbThis SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, Germanyinbred8551730SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551732SS.LEW-(<i>D17Chm31-D17Chm93</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8551734SS.LEW-(<i>D17Chm31-D17Chm93</i>)(<i>D17Rat84-D17Chm17</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D17Rat84-D17Chm17</i>)/Aydcongenic8551742SS.LEW-(<i>D16Chm48-D16Chm60</i>)(<i>D18Rat101-D18Rat92</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat101-D18Rat92</i>)/Aydcongenic8657135SS.LEW-(<i>D10Chm280-D10Chm216</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Aydcongenic8551766SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Aydcongenic8552242ETR/EisEisai Turning RatDeveloped by the DEPOSITORinbredEmbryoBehavior8552244SD-Tg(Dsp-mCherry-DTR)JflnThis rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain.transgenicSperm7243960DA.F344-(<i>D4Got44-D4Rat128</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7243963DA.F344-(<i>D4Uia2-D4Wox21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7243965DA.F344-(<i>D4Arb21-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic7243966DA.F344-(<i>D4Arb5-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenic8551785SS.LEW-(<i>D18Wox7-D18Rat67</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic8551787SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic8551789SS.LEW-(<i>D18Chm59-D18Rat1</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenic8552237WI-Tg(Nanog-GFP-PuroR)22Kyomouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performancetransgenicLive Animals8552239F344.WI-Tg(Nanog-GFP-PuroR)KyoWI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic backgroundtransgenicSperm8552247SD-Tg(Neurod6-mCherry-DTR)JflnThis rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated.transgenicSperm8552249SD-Tg(Camk2a-FLPo)JflnThis transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated.transgenicSperm8552252ACI.BUF-<i>Aftm1</i>/2MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.congenicEmbryo8552255LAP/Hshyolow alcohol preference ratDeveloped by the DEPOSITORinbredEmbryo8552257HAP/Hshyohigh alcohol preference ratDeveloped by the DEPOSITORinbredEmbryo8552259F344-<i>Ldlr<sup>m1Kyo</i></sup>/TaDeveloped by the DEPOSITORmutantEmbryo8552261WIAR.MPR-<i>Arsb<sup>abd</i></sup>/NcchdDeveloped by the DEPOSITORmutantEmbryoOsteology; MetabolismArsb21588552289A5M/KhosDeveloped by the DEPOSITORinbredEmbryoMetabolism