RGD_ID STRAIN_SYMBOL FULL_NAME ORIGIN SOURCE STRAIN_TYPE 10000 ACI/N A X C 9935, Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center inbred 10001 AVN/Orl Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France. inbred 10002 BBDP/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ? 53 days of age after the first and 67 ? 10 days of age after the 9th cycle. inbred 10003 BBDR/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 1 53 days of age after the first and 67 1 10 days of age after the 9th cycle. R. H. William Laboratory, University of Washington, Seattle, Washington, http://www.rrrc.us/Strain/?x=463, Rat Resource and Research Center inbred 10004 BC/CpbU Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands. Central Laboratory Animal Institute of Utrecht University, The Netherlands. inbred 10005 BDIX/Han unknown unknown inbred 10006 BDVII/Cub Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype. Charles University, Department of Biology, Prague, inbred 10008 BN/SsNHsd Obtained by HSD from nucleus colony at NIH Harlan inbred 10009 BP/Cub Charles University, Department of Biology, Prague, inbred 10010 BUF/Pit Buffalo inbred 10011 COP/OlaHsd These are derived from the original colony which was developed by Dr. W.F. Dunning. Harlan inbred 10012 DA/PitN Unknown Rat Resource and Research Center inbred 10013 DON/Melb inbred 10014 F344/Pit inbred 10015 FHH/Eur An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. Erasmus University-Rotterdam inbred 10016 GH/Omr Genetically Hypertensive This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. University of Otago Wellcome Med. Res. Inst, New Zealand. inbred 10017 GK/KyoSwe Goto Kakizaki Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975). Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden inbred 10018 IS/Kyo ishibashi rat Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978. National BioResource Project for the Rat in Japan inbred 10019 LE/Mol Long Evans M & B A/S, Denmark. inbred 10020 LEW/Pit Lewis inbred 10021 LH/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred 10022 LN/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred 10023 LOU/CHan Louvain unknown unknown inbred 10024 M520/N To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. NIH Animal Genetic Resource, Rat Resource and Research Center inbred 10025 MHS/Gib Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred 10026 MNR/N Maudsely non-reactive To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. NIH Animal Genetic Resource, Rat Resource and Research Center inbred 10027 MNRA/N To Harrington in 1965 at F25 (Harrington 1981). NIH Animal Genetic Resource inbred 10028 MNS/Gib Milan Normotensive Strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred 10029 MR/Pit As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). inbred 10030 NEDH/K Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. Central Institute for Diabetes, Karlsburg, Germany. inbred 10031 NP9 From Wistar inbred 10032 ODU/N Osaka Dental University From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982). NIH Animal Genetic Resource, Rat Resource and Research Center inbred 10033 OKA/Wsl Professor Herve Bazin, Universite de Louvain, France inbred 10034 OM/Ztm Osborne-Mendel unknown unknown inbred 10035 P5C inbred 10036 PVG/Pit inbred 10037 SD/Rij From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984). Harlan Rijswijk inbred 10038 SHR/OlaHsd Spontaneously Hypertensive Rat Harlan Sprague Dawley, Inc. inbred 10039 SHRSP/Riv Spontaneously Hypertensive Rat, Stroke Prone inbred 10040 SR/Jr Salt Resistant Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred 10041 SS/Jr Salt Sensitive Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982) Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred 10042 WAG/RijKyo Rij > Kyo (1979, F?, GF) National BioResource Project for the Rat in Japan inbred 10043 WF/Pit Wistar Furth inbred 10044 WIST/Nhg Wistar From outbred Wistar stock in 1967. Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany. inbred 10045 WN/N Inbred Wistar; W/N Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15. NIH Animal Genetic Resource inbred 10046 WKY/OlaHsd Harlan Sprague Dawley, Inc. inbred 10047 WTC/Kyo WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. National BioResource Project for the Rat in Japan inbred 60984 GH University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). inbred 60985 BN BN Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b). Charles River Laboratories inbred 60986 BUF/N Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 60987 MHS/N Milan Hypertensive Strain Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy, Rat Resource and Research Center inbred 60988 LOU/M Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978). inbred 60989 BP Strain selected for resistance to Walker 256 tumour. inbred 60990 LH Lyon Hypertensive Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred 60991 LE Long Evans Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984). inbred 60992 MNS Milan normotensive strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred 60993 FHH Fawn Hooded Hypertensive An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. University of Colorado Health Science Center, Denver, Colorado inbred 60995 DRY Recombinant inbred strain used as normotensive control in studies of hypertension. Sankyo Co., Ltd., Tokyo, Japan inbred 60996 DON Donryu rat R. Sato 1950 by inbreeding Japanese albino rats. xx inbred 60997 DA DA Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case. inbred 60998 COP Curtiss 1921 at Columbia University Institute for Cancer Research. inbred 60999 LEW Lewis Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) Harlan Sprague Dawley Inc. Indianapolis, United States inbred 61000 SHR Spontaneously Hypertensive Rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and DS shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). inbred 61001 NEDH Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. inbred 61002 BDIX Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. See entry for BDI origin. inbred 61003 BC Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973. inbred 61004 WIST/Zihk From Wistar outbred stock in 1978. inbred 61005 OM/N Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 61006 PVG PVG Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994). inbred 61007 WF Wistar Furth J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995). inbred 61008 WAG AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984). inbred 61009 AVN Unknown. Keil University from O Stark, Charles University, Prague. inbred 61010 SHRSP Spontaneously Hypertensive Rat, Stroke Prone The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rabbatu (1994). Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch inbred 61011 BB/N Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). Rat Resource and Research Center inbred 61013 E3 Krvning, Gvttingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968. inbred 61014 OLETF Otsuka Long-Evans Tokushima fatty Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1983. Otsuka Research Institute, Tokushima, Japan inbred 61015 LN lyon normotensive (taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred 61096 SHR/NCruk Spontaneously Hypertensive Rat NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred 61097 WKY/NCruk NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred 61098 BXH These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic recombinant_inbred 61099 HXB Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. Institute of Physiology, Czech Academy of Sciences, Charles University, Prague recombinant_inbred 61100 SHR/Ola Strain originated from an inbred SHR strain from Harlan UK Ltd. Czech Academy of Sciences, Prague, Czech Republic inbred 61103 WKY This strain was maintained at Medical College of Ohio, Toledo, Ohio Medical College of Ohio, Toledo, Ohio inbred 61104 LEW/NCrl Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34. Charles River Laboratories USA inbred 61105 WKY/NHsd These animals were bought from Harlan Indianapolis, Indiana U.S.A. Harlan inbred 61106 SHR.BN-(D8Mit5-D8Mgh6)/Ipcv A segment of chr. 8 is transferred from the normotensive BN-Lx rat to the SHR. Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic 61107 BB/OK This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada. Central Institute for Diabetes, Karlsburg, Germany, National BioResource Project for the Rat in Japan inbred 61109 F344/NHsd F344/NHsd Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. Harlan inbred 61110 SHR/Mol Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. Mollegaard Breeding Centre Ltd., Denmark inbred 61111 DA/Slc dark agouti These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983. National BioResource Project for the Rat in Japan inbred 61112 13M This is a Leprfa/Leprfa substrain derived from the Zucker rat. Laboratory of Human Behavior and Metabolism, Rockefeller University inbred 61113 BN-Lx These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. unknown mutant 61114 DA/Bkl Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls. Bantin and Kingman, Fremont, California inbred 61115 BN/SsN To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 61116 SHRSP/A3 Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan inbred 61117 BN-Lx/Cub Brown Norway with polydactyly-luxate Arose in a colony of random bred Wistar-derived rats. Charles University, Department of Biology, Prague mutant 61118 BUF/Mna Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. National BioResource Project for the Rat in Japan inbred 61119 WKY/NCrlCrlj Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred 61498 BN/NHsdMcwi Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115) PhysGen inbred 61499 SS/JrHsdMcwi Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115). PhysGen inbred 61517 FHL/Eur Fawn Hooded Low blood pressure An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage Erasmus University-Rotterdam inbred 67934 WOKA Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. inbred 67935 WOKW Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred 67936 WR Sykora, Rosice (Stark et al 1968b). No further infromation. inbred 67937 WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986). inbred 67938 Y59 Strain developed in Zagreb, Jugoslavia. inbred 67939 YA/N No further information. Rat Resource and Research Center inbred 67940 YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992) inbred 67941 Z61 Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours. inbred 67942 ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989). inbred 67943 SHE/N-cp Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94. unknown inbred 67945 IS from a cross between a wild male and a Wistar female, with sib mating since 1968. unknown inbred 67948 JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984). inbred 67957 APR Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred 67958 AS Albino Surgery University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973). National Institute for Medical Research, Mill Hill, UK inbred 67959 AS2 Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968). inbred 67960 AUG Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England. inbred 67962 AN Outbred Wistar Imamichi strain. unknown inbred 67965 AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976. recombinant_inbred 67966 B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85. inbred 67967 B/1N No further information. Rat Resource and Research Center inbred 67971 BBZ Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3 inbred 67974 BDE Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring. inbred 67975 BDI Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred 67976 BDII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred 67977 BDIII see BDI. inbred 67978 BDIV see BDI. inbred 67981 BDV see BDI inbred 67983 BDVI see BDI. inbred 67984 BDVII See BDI, Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) inbred 67986 BDVIII see BDI. inbred 67987 BDX see BDI inbred 67988 BEG from a cross between SC and TE. inbred 67989 BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973. inbred 67990 BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992) inbred 67991 BIL/1 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred 67993 BIL/2 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred 68000 BIRMB same as BIRMA. inbred 68001 BLK/N This strain has an agouti mutation Rat Resource and Research Center inbred 68007 BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions. inbred 68008 BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966). inbred 68011 C No further information. inbred 68012 CAP Polish Academy of Sciences, Krakow (Stark et al 1968a). inbred 68013 CAR/N Hunt-Hoppert caries resistant; CA/R Hunt 1937, developed for resistance to dental caries (Hunt et al 1955). NIH Autoimmune Rat Model Repository and Development Center inbred 68014 CAS Hunt 1937, developed for high incidence of dental caries. inbred 68015 CBH Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded). inbred 68018 CPB-WE Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands. inbred 68019 CRDH Cohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995). Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred 68020 CWS R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open. inbred 68022 DB No further information. inbred 68023 DEBR Dr. Roy F. Oliver, Dept. of Biological Sciences, University of Dundee. A possible animal model for human alopecia areata, with hair loss associated with marked peri-and intra-bulbar lymphocytic infiltrate (Michie et al 1991, Sainsbury et al, 1991, Oliver et al, 1991). inbred 68026 DSS/1N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Rat Resource and Research Center inbred 68027 DSS/2N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Rat Resource and Research Center inbred 68028 DSS/3N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Rat Resource and Research Center inbred 68029 DXE -1-? Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover) inbred 68031 ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). Taisho Pharmaceutical Co. Ltd inbred 68032 EXBH Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990) inbred 68034 F6R Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985). inbred 68035 FCH Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol. inbred 68036 FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see FHH and FHL, below), which may have different characteristics. inbred 68038 FHL see FHH. inbred 68039 FHR An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. inbred 68040 FNL Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH). inbred 68041 G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977) inbred 68042 GEPR Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a). inbred 68044 GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973). inbred 68046 HCS Harvard to Liverpool, UK in 1960. inbred 68047 HMT Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor". inbred 68048 HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus. inbred 68049 HXB-1-43 Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands recombinant_inbred 68050 IIM Set of nine strains bred as parallel strains from a single outbred colony in 1948. All strains were selected for large body weight and high fertility. One strain designated IIM\'a7 becomes obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). inbred 68051 INR/N Harrington 1962 from a stock selected by CS Hall for low open field defaecation. Rat Resource and Research Center inbred 68052 IR Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981). inbred 68057 K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973). inbred 68058 KGH/PitN Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). Rat Resource and Research Center inbred 68059 KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980). inbred 68060 KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977) inbred 68061 KYN/Hok Makino, Hokkaido University 1960 from stock the carrying the National BioResource Project for the Rat in Japan inbred 68062 LA/N from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 68063 LA/N-cp from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center congenic 68065 LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993) inbred 68066 LEC Misima, Japan 1956 from a cross between a wild rat and Castle's black rat. To Hok in 1975 at F32 (Sasaki, personal communication). inbred 68067 LEJ/Hok Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication). National BioResource Project for the Rat in Japan inbred 68068 LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980). inbred 68069 LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980). inbred 68070 LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984) inbred 68071 LER/N Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology. Rat Resource and Research Center inbred 68072 LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1 inbred 68073 LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan inbred 68074 LETO A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan. inbred 68077 LL Lyon hypotensive Lyon Low-Tensive. See LH Rat Resource and Research Center inbred 68079 LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred 68082 LUDW Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU. inbred 68083 LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover) recombinant_inbred 68084 M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum. inbred 68085 M17 AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum. inbred 68086 M520 Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992). inbred 68087 MAXX From a cross of BNxLEW with subsequent inbreeding. inbred 68088 MF Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred 68091 MLCS Milan low-calpastatin strain From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy recombinant_inbred 68097 MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977). inbred 68098 MW Munich Wistar Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS. unknown inbred 68099 MWF From outbred Wistar rats selected for large numbers of superficial glomeruli. inbred 68100 NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990). inbred 68103 NER noda epileptic rat From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has. inbred 68104 NIG-III/Hok From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987). National BioResource Project for the Rat in Japan inbred 68106 NSD/N NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 68107 NZR Subline of AS2 separated at F32. inbred 68109 ODUS As for ODU, but maintained at Osaka Dental University. inbred 68113 OXYR Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred 68114 OXYS Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred 68115 P77PMC Wistar rats from Beijing Medical College in 1977. inbred 68116 PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction. inbred 68117 PETH/N Royal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS. NIH Autoimmune Rat Model Repository and Development Center inbred 68118 PKD PKD Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. Central Institute for Laboratory Animal Breeding, Hanover, Germany inbred 68119 PSDO/N Reserved symbol for strain in development now at F6 (NIH 1989). Rat Resource and Research Center inbred 68121 R Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R. inbred 68122 RCS/N Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline. Rat Resource and Research Center inbred 68123 RHA/N Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 68124 RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991). inbred 68125 RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991). inbred 68126 RLA/N Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains. inbred 68127 RP Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). inbred 68128 S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating. inbred 68129 SBH Sabra hypertensive Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics). Barzilai Medical Center, Ashkelon, Israel inbred 68130 SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984). inbred 68131 SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360) inbred 68133 SDJ/Hok Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966. National BioResource Project for the Rat in Japan inbred 68134 SDNK Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan. inbred 68136 SEL Dunning 1948. Probably extinct. inbred 68137 SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. inbred 68140 SPRD/Hsd Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony. Harlan outbred 68143 TA Outbred Wistar Imamichi. inbred 68144 TE Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987). inbred 68145 TF From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988). inbred 68146 THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990). inbred 68147 THE/Utp Tsukuba high-emotional rat Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). National BioResource Project for the Rat in Japan inbred 68148 TLE/Utp Tsukuba low-emotional rat Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). National BioResource Project for the Rat in Japan inbred 68149 TM Tester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication). Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan inbred 68150 TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred 68151 TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred 68152 TO/Hok Tokyo rat A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994). National BioResource Project for the Rat in Japan inbred 68154 TOM Toma Institute, Japan (Ikadai, personal communication, 1991) inbred 68155 TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). inbred 68156 TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred 68157 TS3/N Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). Rat Resource and Research Center inbred 68158 TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991). inbred 68160 TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991) inbred 68161 TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985). inbred 68162 TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991) inbred 68163 U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990). inbred 68164 UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred 68165 UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred 68166 W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977). inbred 68167 W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany. inbred 68168 WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983. inbred 68169 WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977). inbred 68171 WBB/1N No further information Rat Resource and Research Center inbred 68172 WBB/2N No further information. Rat Resource and Research Center inbred 68173 WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived. inbred 68174 WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot. inbred 68175 WDF Ikeda et al (1981) by backcrossing the fatty gene (\i fa\i0 ) to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus. inbred 68176 WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred 68177 WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred 68178 WELS Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984) inbred 68180 WIN WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986). inbred 68183 WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992) inbred 68184 WKAH/Hok Wistar-King Aptekman Hokkaido King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA. National BioResource Project for the Rat in Japan inbred 68185 WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA. inbred 68186 WKHA/N From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. Rat Resource and Research Center inbred 68187 WKHT/N From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). Rat Resource and Research Center inbred 68188 WKS National Institute of Genetics, Mishima, Japan. inbred 68189 HTX/Hcj D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30. Department of Pharmacology, University of Florida, Gainesville. inbred 69369 SS Rapp from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in dientifying the loci responsible for salt-induced hypertension. Brookhaven National Laboratories, Upton, New York inbred 69638 BN/Ka Brown Norway Katholiek (kininogen or kinin deficient) Kitasato University, Kanagawa, Japan. Kitasato University, Kanagawa, Japan. inbred 69643 F344/DuCrlCrlj This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred 70410 AA Alko-accepting Wistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred 70411 ANA Alko-nonaccepting Wistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred 70413 WBB inbred 70416 ACH Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research. inbred 70417 A28807/N Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 70418 A35322 Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990. inbred 70419 A7322 Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus. inbred 70420 A990 Curtiss 1921 at Columbia University Institute for Cancer Research. inbred 70421 AAW Atomic Energy Commission, Melbourne (Adams et al 1984). inbred 70422 ABH Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan. Nishimura, Hammatsu University School of Medicine, Japan. inbred 70423 ACP Dunning to National Cancer Institute 1967 at F54. inbred 70424 AGA Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. inbred 70425 AGUS Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26. inbred 70426 ALB/N Albany Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer. NIH Autoimmune Rat Model Repository and Development Center inbred 70427 AM Torres, Rio de Janeiro, from outbred stock. inbred 70428 AMDIL Torres, Rio de Janeiro, from outbred stock inbred 70429 AO From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995). inbred 70440 BIRMA AM Mandl 1952 from Albino rats purchased from Birmingham market. inbred 70446 LH/Lac Liverpool Hooded "Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981). unknown inbred 70447 MNR Maudsely non-reactive PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982). unknown inbred 70448 MNRA Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981). inbred 70449 MR/N Maudsely reactive Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred 70450 NBR Poiley 1966 from heterogeneous stock inbred 70451 OKA From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days. inbred 70452 OM Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center outbred 70453 SR Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen. inbred 70454 WKY/N National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 70455 WKYO/Kyo Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991). National BioResource Project for the Rat in Japan inbred 70456 WM Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Misima in 1951. inbred 70457 WMS Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF inbred 70459 ZDF Vancouver diabetic fatty Zucker "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b). Animal Model Core Facility, University of California at Davis inbred 70508 SD Sprague-Dawley This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain probably Wistar) and subsequently to his white female offsprings for 7 generations. All the current colonies are from this original stock. Harlan Sprague Dawley Inc. United States outbred 70509 F344/N Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 625624 Eker-Tsc2/Hin Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan mutant 625659 DRH/Seac Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3 National BioResource Project for the Rat in Japan inbred 628372 ACI.FHH-(D1Mit34-D1Rat156) The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI. Animal Research Center of the Erasmus University, Rotterdam, The Netherlands congenic 628486 NER/Kyo Noda epileptic rat, GMS Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan. National BioResource Project for the Rat in Japan inbred 628525 Ni/Hin Found in the Sprague-Dawley in Japan. In these the Tsc2 gene is not mutated. Clea Japan Inc. Shiga inbred 628907 SHR.BN-RT1ⁿ This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. congenic 628908 SHR.BN-(D1Mit3-Igf2)/Ipcv Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic 628909 SHR.BN-(D13Arb5-Ren1)/Ipcv Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. Czech Academy of Sciences, Prague, Czech Republic congenic 629459 ZUC-Lepr^faSteJrpz Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology. Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA mutant 629462 ZUC-Lepr^faSte This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. University of California Davis, Davis, CA mutant 629463 ZUC-Lepr^+Ste This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These are recessive fatty animals. University of California Davis, Davis, CA mutant 629464 ZUC-Lepr^fa When Lois and Theodore Zucker retired they gave the original Zucker rat colony to Dr. Roy Martin. When Dr. Martin was leaving University of Georgia he gave this colony to Dr. Johnny R. Porter at the Louisiana State University. Louisiana State University, Health Science Center, New Orleans, Louisiana mutant 629465 SHR/NCrlCrlj NIH derived strain maintained at the Charles River, Japan. Charles River Japan, National BioResource Project for the Rat in Japan inbred 629481 SHR.WKY-(D1Wox33-D1Got194) This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. Departement de Physiologie et Pharmacologie Clinique, Faculte de Pharmacie, France congenic 629482 WKY.SHR-(D1Wox19-D1Mit2)/Njs Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY University of Leicester, Leicester, UK congenic 629484 LEW-tl The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic 629485 LE/Stm Originated from Long-Evans rats at Ben May laboratory, University of Chicago, Chicago, USA National BioResource Project for the Rat in Japan inbred 629486 PVG/OlaHsd black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992 Harlan inbred 629487 SHR.WKY-(D1Wox19-D1Wox34)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR University of Leicester, Leicester, UK congenic 629488 SI-Tg(Ednrb)1Ywa transgenic spotting lethal A 5.8 kb fragment of the dopamine-beta-hydroxylase (DbH) promoter used directs Endrb expression in the transgenic Sl/+ animals. University of Texas Southwestern Medical Center, Dallas, Texas transgenic 629489 Eker-Tg(Tsc2)5Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic 629490 DA.F344-Aia1/1 genomic segments with region of interest from chr 20 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic 629491 DA.F344-Aia1/2 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic 629492 Sl Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat. Institute of Animal Reproduction, Omiya, Japan mutant 629493 DA.F344-Aia1/3 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic 629494 DA.F344-Aia1/4 genomic segments with region of interest from chr 10 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic 629495 WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Freie Universitdt Berlin, Berlin, Germany congenic 629496 W-Aspa^tmKyo Strain originated spontaneously in July 1985 from a colony of W/Crj rats. Kyoto University, Japan mutant 629497 SDT/CrljJcl SD rats were purchased from Charles River Japan and then bred at Torii Pharmaceutical company Japan. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. CLEA Japan Inc. Japan inbred 629499 BXS These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. Czechoslovak Academy of Sciences, Prague recombinant_inbred 629500 LEXF Recombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating. Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred 629501 SD-Tg(Ren2)27 This is a hypertensive rat strain, the mouse Ren2 renin gene along with its 5and 3 flanking sequence is microinjected into fertilized eggs from Hannover Sprague-Dawley (SD) background. Center for Genome Research, University of Edinburgh, UK transgenic 629502 SHR.BN-(Il6-Npy) This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes MRC Clinical Centre, London, UK congenic 629503 SHR.BN-(D19Rat57-D19Mit7)/Ipcv The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic 629504 WKY.SHR-(D1Mit3-D1Rat57) Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY Shiga University of Medical Science, Otsu, Japan congenic 629505 SS.MNS-(D10Mit11-D10M11Mit119)/Mco fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic 629506 LEW.tl.BN-(D2Arb16-D2Wox8) LEW.tl carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic 629509 FHH/EurMcwi An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. PhysGen, Rat Resource and Research Center inbred 629510 SS.BN-(D12Arb13-D12Rat79)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic 629511 SS-Chr 2^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629512 FHH-Chr 12^BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic 629513 SS-Chr 4^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629514 SS-Chr 6^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629515 SS-Chr 7^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629516 SS-Chr 8^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629517 SS-Chr Y^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629518 SS-Chr 9^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629519 SS.BN-(D13Mgh13-D13Mit4)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic 629520 FHH-Chr 1^BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic 629521 SS-Chr 11^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629522 SS-Chr 20^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629523 SS-Chr 13^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629524 SS-Chr 16^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629525 SS-Chr 18^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 629548 SHR.BN-(D1Mit3-Igf2)/1lpcv SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. Czech Academy of Sciences, Prague, Czech Republic congenic 629578 SS.LEW-(D5Rat130-D5Mco10)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio. congenic 631158 DXE1/Ztm DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred 631160 DXE2/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred 631161 DXE3/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred 631163 LE/BluGill This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock. University of Illinois at Urbana-Champaign inbred 631182 DA/BklArbN This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding. NIH, Arthritis and Rheumatism Branch, Bethesda MD, Rat Resource and Research Center inbred 631219 SDT/Jcl Established from an outbred colony of Sprague-Dawley in Torii Pharmaceutical Co. Ltd.This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. Torii Pharmaceutical Co. Ltd., Tokyo, Japan inbred 631220 SS.LEW-(D10Mco1-D10Mco31)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic 631275 WKY/Cfd WKY/Cfd Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred 631276 WKHA/Cfd WKHA/Cfd Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred 631278 SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. University of Glasgow, Western Infirmary, Glasgow, UK congenic 631279 SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic 631280 WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic 631281 WKY.SHRSP-(Fst-Pklr)/Gcrc Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic 631282 DA.F344-(D10Rat37-D10Arb22) This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA, Rat Resource and Research Center congenic 631283 DA.F344-(D10Arb21-D10Arb22) This subcongenic strain contains an F344 chromosome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA, Rat Resource and Research Center congenic 631285 IER/Ihr A mutant rat strain which is a useful model for human cataract. Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan, National BioResource Project for the Rat in Japan inbred 631286 WKY/Izm Wistar-Kyoto WKY strain from the Izumo colony National BioResource Project for the Rat in Japan inbred 631294 F344.GK-(D1Arb42a-D1Rat90)/Swe This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden congenic 631571 SS.LEW-(D1Uia8-D1Mco38)/Jr Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 631572 SBH/Ygl Sabra hypertension prone Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred 631573 SBN/Ygl Sabra hypertension resistant Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred 631574 Wild/K Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany. Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany 631576 LEW/CrlCrlj Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34. Charles River, Atsugi, Japan, National BioResource Project for the Rat in Japan inbred 631577 SHR/Izm Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan inbred 631578 SHR.BN-(D2Rat171-D2Arb24)/Ipcv This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic. congenic 631579 LEW/OlaHsd Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands. Harlan UK inbred 631581 LEW.1F Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1^f haplotype into the LEW stock Zentralinstitut fur versuchstierzucht, Hannover, Germany inbred 631582 SS.WKY-(Mme-D2Wox18)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic 631583 SS.WKY-(D2Mgh8-D2Mgh9)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic 631585 SS.LEW-(D16Mit2-D16Rat12)/Ayd This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background Research Centre-CHUM, Montreal, Quebec, Canada congenic 631586 SS.MNS-(D10Mco14-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic 631587 SS.MNS-(D10M11Mit119-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic 631588 SS.MNS-(D10Mit11-Vamp2)/Mco Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic 631589 SHR.WKY-(D1Wox34-D1Rat164)/Njs Subcongenic strain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic 631590 SHR.WKY-(D1Wox34-Sah)/Njs Subcongenic strain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic 631591 WKY.SHR-(D1Rat56-D1M7Mit206)/Njs Subcongenic strain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic 631592 WKY.SHR-(D1Rat236-D1M7Mit206)/Njs Subcongenic strain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic 631593 LEW/Rj Strain originated in 1987 from the Centre de Selection et d hopital Purpan, Toulouse Cedex, France inbred 631594 BN/Rj Strain first obtained in 1987 from the Centre de Selection et d hopital Purpan, Toulouse Cedex, France inbred 631595 LEW.1AV1.DA-(D10Rat92-D10Rat135)/Ubc LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain. Biomedical Center in Uppsala, Sweden congenic 631596 LEW.1AV1.DA-(D10Rat92-D10Wox17)/Ubc Subcongenic strain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2. Biomedical Center in Uppsala, Sweden congenic 631597 LEW.1AV1.DA-(D10Wox17-D10Rat135)/Ubc Subcongenic strain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic 631598 LEW.1AV1.DA-(D10Got154-D10Rat135)/Ubc Subcongenic strain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic 631599 SHRSP/Izm Strain has been maintained at Kyoto University. National BioResource Project for the Rat in Japan inbred 631600 WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany. congenic 631601 WKY.SHRSP-(Asgr1-Vamp2)/Bbb Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki Max-Delbruck Center for Molecular Medicine, Germany congenic 631602 BN/Elh These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony. Department of Surgery and Biochemistry, University of Otago inbred 631603 WKY/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred 631604 SHR/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred 631605 SS.LEW-(D10Arb9-D10Got101)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic 631606 SS.MNS-(D10Rat13-D10Mit11)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic 631607 SS.WKY-(D2N35-Mme)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic 631610 SS.LEW-(D1Rat39-D1Rat131)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic 631691 SHRSP/A3Izm Substrain originates from the SHRSP/Izm strain. Research Institute, International Medical Center of Japan inbred 631693 WKY.SHRSP-(Shbg-Atp1b2)/Bbb This strain has the blood pressure locus from chr 10 Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 631694 WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 631695 SS/JrRkb This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany. inbred 631696 SHR/FubRkb Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. Freie Universitat Berlin inbred 631697 BBDP/Hri This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Hagedorn Research Institute, Gentofte, Denmark inbred 631698 BN/Mol This strain is maintained at the Mollegaard breeding center. Mollegaard Breeding Centre Ltd., Denmark inbred 631699 BB.SHR-(D6Rat184-D6Rat101) Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. University of Greifswald, Germany congenic 631700 BB.SHR-(Gnal-D18Mit9) Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcross the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long. Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany congenic 631703 SS.LEW-(D10Rat207-D10Mgh1)/Ayd Congenic strain originated from an inbred SS strain Research Centre-CHUM congenic 631844 HAD1 high-alcohol-drinking These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 631845 LAD1 low-alcohol-drinking These low-alcohol-drinking were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 631846 F344.GK-(D1Mgh10-D1Rat90)/Swe Congenic strain originated from an inbred F344/Mcw strain Karolinska Institute congenic 631847 F344.GK-(D1Mit7-D1Mgh25)/Swe Congenic strain originated from an inbred F344 strain Karolinska Institute congenic 631848 SHR/OlaIpcv These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. Czech Academy of Sciences, Prague, Czech Republic inbred 634359 WF.WKY-(D5Wox7-D5Uwm37) Wky rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region. University of Wisconsin-Madison congenic 634363 LEW/NIcoCrlf A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred 634364 SHR/NIcoCrlf A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred 634365 SS/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred 634366 SR/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred 634367 BN/CrlCrlj 1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred 634369 WBN/KobSlc wistar bonn/kobori This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1. National BioResource Project for the Rat in Japan inbred 634370 F344.GK-(D1Mgh10-D1Rat119)/Swe GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain. Karolinska Institute congenic 634372 GHS SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain. Department of Medicine and Physiology, University of Rochester, Rochester, New York inbred 634373 DA/ZtmRhd DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred 634374 E3/ZtmRhd E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred 634376 LEA/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred 634377 BN/Sea BN/Sea This inbred strain was obtained from Sea life Supply Sea Life Supply, Sand City, CA Sea Life Supply inbred 634380 P alcohol-preferring These were developed at Indiana University for high-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 634381 NP alcohol-nonpreferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 634382 SHR.BN-(D5Wox12-D5Wox20)/Ipcv This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic 634743 BIL University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred 724569 MWF/FubRkb Munich Wistar Fromter The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm). Freie Universitdt Berlin, Berlin, Germany inbred 724570 LEW/Rkb The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany. Freie Universitdt Berlin, Berlin, Germany inbred 724571 MITE/Mna This strain was established from captured Japanese wild rats. Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan inbred 724572 SS.LEW-(D10Wox51-D10Rat27)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 724573 SS/JrMco Dahl salt-sensitive (SS/Jr) rats In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet. Medical College of Ohio, Toledo, Ohio, USA inbred 724574 SHR/NHsd SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) Harlan inbred 724575 SS.LEW-(D10Rat17-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 724576 KDP/Tky Komeda diabetes-prone rat This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross. National BioResource Project for the Rat in Japan inbred 724577 SS.LEW-(D10Rat27-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728133 BN-RT1ⁿ/Rj This coisogenic strain was produced by selecting BN rats with the RT1ⁿ allele. The Center dElevage R. Janvier, France. coisogenic 728134 SS.LEW-(D1Rat35-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728135 SS.LEW-(D5Uwm14-D5Uwm31)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic 728137 SS.LEW-(D10Rat141-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic 728138 SS.MNS-(Mme-Gca)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive Research Centre-CHUM, Montreal, Quebec, Canada congenic 728139 WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 728140 SS.LEW-(D10Rat11-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic 728142 BN.SHR-(Il6-Cd36)/Cub This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 728143 SS.LEW-(D1Mco38-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728144 BN.PD-(D8Rat39-D8Rat35)/Cub This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 728145 SS.LEW-(D5Rat130-D5Rat108)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic 728146 F344.BN-(D3Mgh13-D3Mgh7)/Dlw This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic 728147 BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 728148 SS.LEW-(D16Uia2-D16Rat12)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic 728151 UPL/Ncc The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony. Hiroshima University, School of Medicine, Hiroshima, Japan inbred 728152 SS.LEW-(D1Rat196-D1Mgh7)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728153 SS.LEW-(D1Rat196-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728155 BBDR.BBDP-(D4Mit6-D4Mit7)/1Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic 728156 SS.LEW-(D5Mco34-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic 728157 SS.LEW-(D5Rat130-D5Mco19)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic 728158 SS.LEW-(D5Uia4-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic 728159 SS.LEW-(D1Mco36-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728161 PD/Cub polydactylous Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred 728162 SS.LEW-(D1Mco87-D1Rat71)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728163 SS.LEW-(D1Uia2-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic 728165 SS.LEW-(D1Rat196-D1Mco36)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic 728166 WKY.SHRSP-(D1Rat112-D1Wox29)/Izm A segment from SHRSP/Izm was transferred on a WKY/Izm background Shimane Medical University, Izumo, Japan congenic 728167 SS.LEW-(Nos2-D10M11Mit119)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic 728168 WOK The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany Diabetes Research Center, Karlsberg, Germany inbred 728170 SS.MNS-(Mme-D2Mit14)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 728171 LEW-RT1¹/Rj This coisogenic strain was produced by selecting LEW rats with the RT1¹ allele. The Center dElevage R. Janvier, France. coisogenic 728172 SS.MNS-(D2Mit6-Adh1)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS Research Centre-CHUM, Montreal, Quebec, Canada congenic 728183 WF/N To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia. NIH Autoimmune Rat Model Repository and Development Center inbred 728184 SHRSP/A3N To N in 1975 from Yamori at F36. SHR was isolated from Wis- tar-Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517) NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728185 N/N Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred 728186 LEW/SsN To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728187 ACI/N-j Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center congenic 728188 LOU/MN To N in 1975 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. (045) NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728189 SHR/N-di Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center congenic 728190 RCS-rdy-c Albino retinal dystrophy This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic 728191 LOU/CN To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728192 RCS-rdy-p This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. NIH Autoimmune Rat Model Repository and Development Center congenic 728193 N:SD Sprague-Dawley To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred 728194 SHR/N To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728195 SHR/N-cp Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. congenic 728196 RHA/N-j Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center congenic 728197 RCS-rdy-+ This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic 728198 BHE/N Bureau of Home Economics To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred 728199 RHA Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). NIH Autoimmune Rat Model Repository and Development Center congenic 728200 ACI/N-di Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41. NIH Autoimmune Rat Model Repository and Development Center congenic 728358 SB This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear. R. Kalman, Authority for Animal Facilities outbred 728383 UPL/Cas Upjohn Pharmaceuticals Limited In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating. National BioResource Project for the Rat in Japan inbred 728384 SS.LEW-(D10Rat24-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728385 WF.COP-(D2Rat2-D2M13Mit286/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic 728386 SS.LEW-(D10Rat119-D10Rat133)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728387 WF.COP-(D2Mit29-D2Uwm13)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic 728388 SS.LEW-(D10Rat119-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728389 WF.COP-(D2Mit29-D2Rat201)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic 728391 WF.COP-(D2Rat253-D2Uwm17/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic 728392 RHA/N-di Roman high avoidance-di mutation Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center congenic 728393 SS.LEW-(D10Got125-D10Rat120)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728394 SS.LEW-(D10Rat55-D10Rat131)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728395 SS.LEW-(D10Rat55-D10Rat20)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 728396 SS.LEW-(D10Mco15-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 731185 MWF/Fub Munich Wistar Fromter Munich Wistar Fromter rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred 731186 SHR/Fub Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred 731187 HAD2 high-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 731188 LAD2 low-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 731189 SHRSP.WKY-(Klk1-D1Rat116)/Izm A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan congenic 731190 SS.LEW-(D1Rat211-D1Rat18)/Mco A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 731191 SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic 731192 SS.LEW-(D3Rat52-D3Rat130)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 731193 DA.PVG-(D4Rat141-D4Mgh11) PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic 731194 SS.LEW-(D3Chm64-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 731195 DA.E3-(D14Wox8-D14Rat64)/Rhd The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. Medical Inflammation Research, BMC, University of Lund, Lund, Sweden congenic 734471 SS.LEW-(D1Mgh7-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734472 SS.LEW-(D1Mco2-D1Wox6)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734473 SS.LEW-(D17Mco3-D17Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic 734474 SS.LEW-(D5Mit9-D5Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic 734475 DA/OlaHsd Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965. Harlan inbred 734476 Crl:CD(SD) Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. Charles River Laboratories International, Inc. outbred 734478 F344/DuCrl This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960. Charles River Laboratories inbred 734479 SS.LEW-(D1Mco2-D1Rat49)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734480 SS.LEW-(D10Mit10-D10Mgh1)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic 734481 SS.LEW-(D1Mco2-D1Mco35)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734482 SS.LEW-(D1Rat45-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734483 SS.LEW-(D1Rat42-D1Wox10)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic 734526 OLETF/Got Otsuka Long Evans Tokushima Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan inbred 734527 OLETF.F344-(D1Rat169-D1Rat459)/Got Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic 734528 OLETF.BN-(D1Rat76-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic 734531 OLETF.F344-(D1Rat306-D1Rat461)/Got Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic 734758 DA/Ham Dark-agouti Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). Shizuoka Laboratory Animal Center Hamamatsu, Japan inbred 734759 SHRSP/Gcrc Spontaneously hypertensive rat, stroke prone SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred 734760 WKY/Gcrc Wistar-Kyoto WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred 734761 WF/Kga Wistar-Furth Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan). Kagoshima University Dental School, Kagoshima, Japan inbred 737657 LEW.1AV1 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1^av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. National Veterinary Institute, Uppsala, Sweden, Rat Resource and Research Center congenic 737658 PVG.1AV1 Piebald-Viral-Glaxo Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany Harlan UK, Blackthorn, Bicester, UK congenic 737690 F344/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River, Calco, Italy inbred 737691 BN/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River Laboratories Italy inbred 737703 LEW-Tg(HLA-B*0702,B2M)120-4Trg Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity. Rat Resource and Research Center transgenic 737857 DA.PVG.1AV1-(D4Rat155-D4Rat84) Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic 737858 DA.PVG.1AV1-(D4Rat155-Spr) Subcongenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic 737859 DA.PVG.1AV1-(D4Mgh17-D4Rat56) Subcongenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic 737861 DA.PVG.1AV1-(D4Rat63-D4Rat203) Subcongenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic 737862 SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic 737863 SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP University of Glasgow, Glasgow, UK congenic 737864 SS.SR-(D13Mit9-D13Mit1)/Jr Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain. J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic 737865 WKY.SHRSP-(D2Rat14-D2Mgh12) A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. University of Glasgow, Glasgow, UK congenic 737866 WKY.SHRSP-(D2Rat14-D2Mit5) A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY University of Glasgow, Glasgow, UK congenic 737867 SS.SR-(D13N1-D13Mit1)/Jr Subcongenic strain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic 737868 SS.SR-(Syt2-D13Mit1)/Jr Subcongenic strain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic 737869 OLETF.BN-(D1Rat461-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic 737870 DA.E3-(D20Wox3-D20Mgh4)/Rhd A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 737871 DA.E3-(D12Got46-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 737872 DA.E3-(D4Mit16-D4Mgh11)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 737873 DA.E3-(D6Wox5-D6Rat90)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 737885 RHA/Kun Roman high avoidance Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands inbred 737886 BDX/Cub Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred 737887 AO/OlaHsd These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737888 LEW/NHsdCpb These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737889 LEW/Ipcv These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands unknown inbred 737891 Crl:SD Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory. Charles River Laboratories, Inc., Wilmington, MA outbred 737892 ACI/SegHsd This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc. Harlan inbred 737893 F344/Ztm Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737894 LEW/Orl Substrain of Lewis rats, maintained in Orleans, France Institut de Transgenose, Orleans, France inbred 737895 WKY/HanZtm Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737896 BN/Maas Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred 737897 ACI/Kun Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred 737898 WOKA/K Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany inbred 737899 BN/Cub Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred 737900 WF/Ztm Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737901 LH/Ztu A substrain of LH unknown inbred 737902 BDIX/Orl Substrain of BDIX, now maintained in Orleans, France Institut de Transgenose, Orleans, France inbred 737903 SD/Hsd Substrain of SD, now maintained at Harlan Sprague Dawley Harlan outbred 737904 U/A Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred 737905 LEW/Maas Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. University of Limburg, Netherlands inbred 737906 MWF/Hsd Munich Wistar Fromter Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley Harlan inbred 737907 SS.SR-Inha/Jr A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA congenic 737908 WF/NHsd Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley. Harlan inbred 737909 R/A Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred 737910 ARISTORAT/Wsl Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred 737911 BUF/Ztm Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737912 SS/JrIpcv strain originated from Dr. John P. Rapp, Medical College of Ohio, USA Czech Academy of Sciences inbred 737913 E3/Ztm Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737914 SDL/Ipcv Substrain of SDL unknown inbred 737915 R/AWa Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dept of Genetics, Agricultural University, Wageningen, The Netherlands inbred 737916 DZB/Gro Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred 737917 WF/Mol Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark Mollegaard Breeding Centre Ltd., Denmark inbred 737918 BN/Orl Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France Institut de Transgenose, Orleans, France inbred 737919 LEW/Han Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737920 BH/Ztm Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737921 BDIV/lfz Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971) unknown inbred 737922 LEW/SsNHsd Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to National Institutes of Health Harlan inbred 737923 SHR/Maas Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred 737924 WAG/Rij Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979 Harlan Sprague Dawley, Indianapolis, IN inbred 737925 BN/Gro Substrain of BN, from Billingham and Silvers 1958, to U of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred 737926 F344/NCrl Derived from NIH stock in 1992 by SASCO. To Charles River in 1996. Charles River Laboratories inbred 737927 ALC/Colle Substrain of ALC unknown inbred 737928 BN/NHsdCpb Substrain of BN, from Billingham and Silvers 1958 Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737929 Crl:WI Wistar rats To Scientific Products Farm, Ltd.[predecessor of Charles River United Charles River Laboratories outbred 737930 LEW/Ztm LEW/Ztm This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany Tierlaboratorium der Medizinischen Hochschule Hannover, Germany inbred 737931 GC/Kun inbred 737932 LEW/Crl Lewis Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34. Charles River Laboratories inbred 737933 SD/A Sprague-Dawley stock initiated by R. Dawley in 1925 The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred 737934 BN/RijKun Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred 737935 LEW/Nhg Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany inbred 737936 SR/JrIpcv Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962) Baylor College of Medicine, Houston, TX inbred 737937 SDH/Ztu unknown unknown inbred 737938 AUG/OlaHsd Substrain of AUG, derived from US August substrains in 1951 Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737939 BBWB/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred 737940 PAR/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred 737941 LEP/Cub Substrain of LEP, from Charles University cross of outbred animals Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic inbred 737942 LE/Ztm Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737943 R/AEurRij Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred 737944 BN/RijN Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN, Rat Resource and Research Center inbred 737945 BN/Han Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737946 WAG/OlaHsd Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737947 BDII/Ztm Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971) Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737948 BDE/Ztm Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737949 A2/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred 737950 DA/Ztm Substrain of DA, to Hannover after 1965 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737951 CAP/Kuv unknown Dr. HU Wottge, Universitat Kiel, Kiel, Germany inbred 737952 ACI/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737953 LEW/Gut Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany unknown source inbred 737954 AS/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737955 Hooded/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred 737956 WF/Gut substrain of Wistar Furth stock, from J Furth in 1945 unknown inbred 737957 WOKW/K Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991 Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany; National BioResource Project for the Rat in Japan inbred 737958 CHOC/Cub unknown Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred 737959 RNU/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred 737960 WIST/Hsd These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan. Harlan outbred 737961 SR/JrMol Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard Mollegaard Breeding Centre Ltd., Denmark inbred 737962 SPRD/HanZtm Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737963 LEW/Cub Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred 737964 BN/OlaHsd Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737965 AGUS/OlaHsd Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968 Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 737966 LEW/Kuv Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany Universitat Kiel, Kiel, Germany inbred 737967 BS/Ztm Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 737968 BN/Gut Substrain of BN, from Billingham and Silvers 1958 unknown inbred 737969 NAR/SaU non-albumin rat Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht Dept of Laboratory Animal Science, University of Utrecht, The Netherlands inbred 737970 AMORAT/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium inbred 737971 SHRSP/Rivm unknown National Institute of Public Health and Environmental Protection, The Netherlands inbred 737972 BN/Crl Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976. Charles River Laboratories inbred 738038 HEP high ethanol preferring High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France inbred 738120 LEW-Tg(HLA-B*2705m1,B2M)133-1Trg This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating. Rat Resource and Research Center transgenic 738122 SD-Tg(GFP)1BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals. Rat Resource and Research Center transgenic 1298093 LEW/NHsd Obtained from Harlan-Sprague Dawley (Indianapolis, Indiana) at 35?45 days of age. Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 1299868 SS.SR-(D7Uia1-D7Mco7)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 1299869 SS.SR-(Cyp11b1)/Jr Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic 1299870 SS.LEW-(D5Uia8-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic 1299871 DA.F344-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299872 DA.F344-(D8Arb15-D8Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299873 SS.LEW-(D5Mco34-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic 1299874 OLETF.F344-(D1Rat166-D1Rat90)/Tj Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol. Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan National BioResource Project for the Rat in Japan congenic 1299875 DA.F344-(D7Arb5-D7Mit2)/Arb The DA/Bkl strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299876 SS.LEW-(D5Rat54-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic 1299877 DA.F344-(D10Rat204-D10Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299878 DA.F344-(D4Arb30-D4Arb4)/Arb The DA/Bkl strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299879 SS.SR-(D7Mco7-D7Wox19)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 1299880 F344.DA-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1299881 SS.LEW-(D5Wox3-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic 1300432 HAA/FDSC Hatano High Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred 1300433 LAA/FDSC Hatano Low Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation. Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred 1300439 SD-Tg(GFP)2BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21. Rat Resource and Research Center transgenic 1302359 SD/HsdFcen These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred 1302360 W/HsdFcen These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred 1302372 SDDIO/Rrrc This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet. Rat Resource and Research Center inbred 1302373 SDDR/Rrrc This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet. Rat Resource and Research Center inbred 1302377 SPRD-Anks6/Rrrc From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002. Rat Resource and Research Center mutant 1302416 ACI.DA-(D10Rat2-D10Rat19) A fragment from DA rats is transferred to ACI. Center for Genomics and Human Genetics, Manhasset, New York congenic 1302597 LEXF7C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302598 FXLE26/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302599 WKY/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan inbred 1302600 HTX/Kyo hydrocephalus texas 1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. National BioResource Project for the Rat in Japan mutant 1302601 FXLE23/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302602 FXLE12/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302603 FXLE25/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302604 LEXF4/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302605 LEXF2A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302606 SHRSP/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan mutant 1302607 FXLE21/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302608 CXH6/Tj Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan National BioResource Project for the Rat in Japan recombinant_inbred 1302610 KMI/Tky miniature rat ishikawa Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College. National BioResource Project for the Rat in Japan segregating_inbred 1302611 FXLE24/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302612 LEXF10C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302613 BN/fMaiHok Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21 National BioResource Project for the Rat in Japan inbred 1302614 WKY/NMna Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain. National BioResource Project for the Rat in Japan inbred 1302615 FXLE14/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302616 LEXF10B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302617 LEXF6B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302618 LEXF9/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302619 FXLE16/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302620 SHR/Kyo spontaneously hypertension rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan mutant 1302621 LEXF10A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302622 WF/Kop Inbred originated from Kagoshima University, Japan. National BioResource Project for the Rat in Japan inbred 1302623 TM/Kyo tester moriyama rat Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 . National BioResource Project for the Rat in Japan mutant 1302624 RICO/Ngs Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan. National BioResource Project for the Rat in Japan inbred 1302625 F344.OLETF-(D16Wox4-D16Rat13)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302626 BN.UPL-(D2Rat134-D2Rat2)/Cas Strain originated from Hiroshima University, Japan National BioResource Project for the Rat in Japan congenic 1302627 F344/NSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302628 ACIS/Hok Spontaneous mutation from ACI/Hok in 1981. National BioResource Project for the Rat in Japan coisogenic 1302629 WKY.SHRSP-(D1Rat49-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302630 F344.OLETF-(D10Wox7-D10Wox6)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. National BioResource Project for the Rat in Japan congenic 1302631 BN/SsNSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302632 WKY.SHRSP-(D1Smu11-D1Arb21)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302633 FXLE20/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302634 BB/WorTky biobreeding rat Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan inbred 1302635 F344.OLETF-(D12Rat8-D12Rat16)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302636 WKY.SHRSP-(D1Wox29-D1Arb21)/Izm This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background National BioResource Project for the Rat in Japan congenic 1302637 LAA Hatano Low Avoidance Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred 1302638 LEXF11/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302639 KHR/Kyo kaken hairless rat Kaken hairless rat were detected by Kimura from Gunn National BioResource Project for the Rat in Japan mutant 1302640 ACI/Tj Strain originated from The University of Tokushima, Tokushima, Japan. National BioResource Project for the Rat in Japan inbred 1302641 LEXF1A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302642 LEA/Hkm Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred 1302643 ACI/NKyo august copenhagen irish NIH (1988, F143) > Kyo (F43) National BioResource Project for the Rat in Japan inbred 1302644 CXA5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred 1302645 DMY/Kyo demyelination rat From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996). National BioResource Project for the Rat in Japan mutant 1302646 LEXF2C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302647 F344.OLETF-(D5Rat166-D5Rat90)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic 1302648 LEC/Hok Long Evans Cinnamon Kobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F20 National BioResource Project for the Rat in Japan mutant 1302649 LEXF7B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302650 F344.OLETF-(D9Mgh8-D9Rat15)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302651 CXA1/Tj Strain originated from the The University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred 1302652 LEXF7A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302653 LEXF8A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302654 F344.OLETF-(D7Mgh16-D7Mgh20)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302655 TO/Hkm Strain originated from the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred 1302656 LEA/Hok Long Evans Agouti Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes). Kobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982. National BioResource Project for the Rat in Japan inbred 1302657 DOP/Nem dilute-opisthotonus (dop) Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established. National BioResource Project for the Rat in Japan segregating_inbred 1302658 LEJ/Hkm Strain originated at the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred 1302659 CXH5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred 1302660 RCS/Kyo royal college of surgeons rat From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998. National BioResource Project for the Rat in Japan mutant 1302661 F344.OLETF-(D14Rat23-D14Rat12)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302662 CXH2/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred 1302663 F344.OLETF-(D11Rat4-D11Rat1)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302664 WNA/Nshm Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research National BioResource Project for the Rat in Japan inbred 1302665 FXLE13/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302666 LEXF1C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302667 F344.OLETF-(D5Mgh5-D5Mgh23)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302668 IS-Tlk/Kyo tail anomaly lethal kyoto Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto) National BioResource Project for the Rat in Japan coisogenic 1302669 HAA Hatano High Avoidance Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred 1302670 ACI/NSlc Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302671 WM/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred 1302672 W/Kyo Hok>Hkm>Kyo National BioResource Project for the Rat in Japan inbred 1302673 FXLE15/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302674 VF/Kyo vacuole formation rat Derived by a spontanious mutation from TRM (F26). Trm deletion was subsequently replaced by inbreeeding. National BioResource Project for the Rat in Japan mutant 1302675 WKY.SHRSP-(D1Smu13-D1Smu11)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302676 NER/Slc noda epileptic rat Strain is from Japan SLC, Inc. Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant 1302677 NIG-III/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred 1302678 NAR/Slc non albumin rat Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant 1302679 TRMR/Kyo tremor resistant Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. National BioResource Project for the Rat in Japan segregating_inbred 1302680 SHR/Ta Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant 1302681 WKY.SHRSP-(D1Smu11-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302682 FXLE18/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302683 FXLE22/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302684 F344/NHok Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals National BioResource Project for the Rat in Japan inbred 1302685 F344.OLETF-(D14Rat8-D14Rat26)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment. National BioResource Project for the Rat in Japan congenic 1302686 F344/Stm Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating. National BioResource Project for the Rat in Japan inbred 1302687 WKAH/HkmSlc Wistar King A, Hokkaido Strain originated from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302688 ACI/NMna This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan. National BioResource Project for the Rat in Japan inbred 1302689 WKY.SHRSP-(Ntrk3-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302690 FXLE19/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302691 ALB/Hok Albany Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) National BioResource Project for the Rat in Japan inbred 1302692 WKY.SHRSP-(D1Wox18-D1Rat44)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302693 KZ-Lepr^faTky A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980. National BioResource Project for the Rat in Japan segregating_inbred 1302694 WKA/Seac Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979 National BioResource Project for the Rat in Japan inbred 1302695 SER/Kyo spontaneously epileptic rat Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac National BioResource Project for the Rat in Japan segregating_inbred 1302696 FH/HamSlc fawn hooded rat Strain originated at Japan SLC, Inc., Shizuoka , Japan. National BioResource Project for the Rat in Japan mutant 1302697 KND/Tky komeda non-diabetic rat Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls. National BioResource Project for the Rat in Japan inbred 1302698 SDR/Slc Spontaneous dwarf rat Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan, Rat Resource and Research Center mutant 1302699 LEXF8D/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302700 HOB/Snk hobble rat HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13. National BioResource Project for the Rat in Japan mutant 1302701 LEW/SsNSlc Strain is from Japan SLC, Inc.,Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302702 TRM/Kyo tremor rat Tremor Rat 1980 was found in a colony of outbred Wistar/Kyo while establishing inbred strains from Wistar/Kyo by spontanious mutation. After F18, a control line WTC was separated. National BioResource Project for the Rat in Japan segregating_inbred 1302703 WKY.SHRSP-(D1Wox29-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302704 WKY.SHRSP-(D1Wox29-D1Rat199)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302705 WKY.SHRSP-(D1Wox29-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302706 F344.OLETF-(D5Rat32-D5Rat26)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302707 LEXF3/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302708 FXLE17/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred 1302709 WKY/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan inbred 1302710 LEXF2B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302711 EHC/Seac Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993 National BioResource Project for the Rat in Japan inbred 1302712 ZIMY/Kyo Zitter Masao Yamada ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada) National BioResource Project for the Rat in Japan mutant 1302713 F344.OLETF-(D8Rat58-D8Mgh17)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 1302714 KZC/Tky Komeda Zucker Creeping rat Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan segregating_inbred 1302715 WKY.SHRSP-(D1Wox18-D1Wox29)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic 1302716 OM/NSlc Osborne-Mendel rat The Instutite of Medical Science, The University of Tokyo to Slc (1985) National BioResource Project for the Rat in Japan inbred 1302717 ACI/NHok NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135 National BioResource Project for the Rat in Japan inbred 1302718 HWY/Slc hairless wistar yagi Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant 1302719 DON/Kyo Donryu rat Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2 National BioResource Project for the Rat in Japan inbred 1302720 CXH10/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred 1302721 LEC/Tj Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 National BioResource Project for the Rat in Japan mutant 1302722 PVG/Seac Piebald Virol Glaxo Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan. National BioResource Project for the Rat in Japan inbred 1302723 LEXF5/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred 1302724 SHR/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan mutant 1302726 ZI/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. National BioResource Project for the Rat in Japan mutant 1302727 SHRSR/Ta Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant 1302728 MES/Slc Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999) National BioResource Project for the Rat in Japan mutant 1302729 LEA/Tj Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 National BioResource Project for the Rat in Japan inbred 1302795 HTG Prague hypertriglyceridemic These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding. Institute of Physiology, Academy of Sciences Prague, Czech Republic inbred 1302921 F344-Tg(DTR)C354Wig hDTR cDNA was inserted at the 3' of the 2.5 kb human podocin promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs. Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan transgenic 1303393 LEC/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred 1304487 BBDR/Wor These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. BRM, Worcester MA inbred 1331809 SHR/Rkb Spontaneously Hypertensive Rat This inbred strain is kept at Freie Universitat Berlin, Benjamin Franklin Campus, Berlin, Germany Freie Universitat Berlin, Benjamin Franklin Campus, Berlin, Germany inbred 1331811 LEW.BN-(D10Rat32-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331812 LEW.BN-(D10Rat83-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331813 BN.GK-(D8Rat29-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 1331814 BN.GK-(D8Got302-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 1331815 LEW/Mol LEW/Mol This inbred strain originated from a LEW strain bred at the Mollegaard Breeding Center Ltd., Denmark Mollegaard Breeding Center Ltd., Denmark inbred 1331816 DA.ACI-(D10Rat2-D10Rat29) (DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic 1331817 BN.LEW-(D10Rat32-D10Mgh4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331818 LEW.BN-(D10Rat43-D10Mco4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331819 F344/Eer F344/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred 1331820 LEW.BN-(D10Got9-D10Rat2)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331821 LEW.BN-(D10Wox26-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331822 DA.ACI-(D10Rat2-D10Rat6) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic 1331823 LEW.BN-(D10Rat43-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331824 DA.ACI-(D10Rat219-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic 1331826 LEW.BN-(D10Mgh7-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331827 DA.ACI-(D10Rat10-D10Rat142) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic 1331828 DA.ACI-(D10Rat12-D10Rat144) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic 1331829 BN.LEW-(D9Got8-D9Got200)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331830 F344.BN-(D5Rat1-D5Mit5)/Dlw This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic 1331831 LEW.BN-(D10Rat173-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331832 BN.LEW-(D10Rat72-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331833 DA.ACI-(D10Rat15-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic 1331834 BN.LEW-(D10Rat100-D10Rat126)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1331836 WKY/Eer WKY/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred 1354669 BN/OrlIcoCrlf Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991. Charles River France inbred 1354670 F344/IcoCrlf These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France. Charles River France inbred 1357172 WF.BBDR-(D4Arb29-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357173 SS.MNS-(Vamp2-D10M11Mit84)/Mco This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic 1357174 BBDR.BBDP-(D4Mit6-D4Mit24) The lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breeding Department of Medicine University of Washington, Seattle, Washington congenic 1357175 F344.DR-(D4Mit6-D4Mit24)-Tg(Gimap5)Mcwi Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(D4Mit6-D4Mit24) Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin transgenic 1357176 WF.BBDR-(D4Arb29-D4Rat96)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357177 F344.DR(DP)-(D4Mit6-D4Mit24) The lymphopenia locus from BBDR.BBDP-(D4Mit6-D4Mit24) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding. Department of Medicine University of Washington, Seattle, Washington congenic 1357178 CD Cohen diabetic rat Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred 1357179 SS.WKY-(D2N35-Mme),MNS-(D10Mit11-D10M11Mit119)/Mco SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F₁ were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating Medical College of Ohio, Toledo, Ohio, USA congenic 1357180 SS.LEW-(D8Chm14-D8Rat16)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic 1357181 CDR/Ygl Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel inbred 1357182 Eker-Tg(Tsc2)28Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic 1357183 SS.MNS-(D10Mco10-Aldoc)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic 1357184 Crl:ZUC-Lepr^fa Zucker rats The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. Charles River Laboratories outbred 1357185 RHA.Gunn-Ugt1a1^j/N RHA/N rats were crossed with Gunn rats. F₁ hybrids were intercrossed for 12 cycles while selecting for jaundice loci. Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA congenic 1357186 Gunn-Ugt1a1^jBluHsd Gunn rat This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan mutant 1357187 WF.BBDR-(D4Rat16-D4Got39)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357189 SS.LEW-(D8Rat56-D8Rat51)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic 1357190 SS.MNS-(Adh1-D2Mit5)/Mco This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background Medical College of Ohio, Toledo, Ohio, USA congenic 1357191 CDS/Ygl Cohen diabetic-sensitive rat Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred 1357192 WF.BBDR-(D4Got39-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357193 WF.BBDR-(D4Got51-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357194 WF.BBDR-(D4Rat96-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357195 SS.MNS-(Aldoc-D10Mco1)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic 1357196 WF.BBDR-(D4Arb29-D4Rat265)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1357345 DA/K Dark Agouti/Karlsburg Dark agouti rats which were bred adn housed in Dept. of Laboratory Animal Science, Karlsburg, Germany Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred 1357346 BB.SHR-(D4Mit6-Spr)/K BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany congenic 1357417 SD-Tg(Npy)400Mcwi 14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene. Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1357953 WAG/RijHfr Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Harlan France. Harlan France inbred 1357954 F344/NHfr Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France. Harlan France inbred 1357955 WF/NHfr Wistar-Furth Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France. Harlan France inbred 1357957 LEW/HanHfr Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany. Supplied by Harlan, France. Harlan France inbred 1357958 BN/RijHfr Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France. Harlan France inbred 1357959 FHH.BN-(Rab38)/Mcwi The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin congenic 1357960 LE/CpbHfr Substrain of LE which was bred at Harlan CPB now at Harlan France. Harlan France inbred 1357974 BB.SHR-(D4Got41-Gimap5)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a subcongenic line. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 1357975 SS.LEW-(D1Mco4-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 1357976 BB.SHR-(D4Got41-D4Rat171)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a subcongenic line. Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 1357977 SS.LEW-(D1Mco8-D1Rat213)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 1357978 SS.MNS-(D2Mit6-D2Rat303)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1357979 SS.MNS-(Mme-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1357980 BB.SHR-(D4Got41-Tacr1)/K Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany, National BioResource Project for the Rat in Japan congenic 1357981 SS.LEW-(D3Mco21-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 1357982 SS.LEW-(D3Rat52-D3Chm63)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 1357983 SS.LEW-(D1Mco75-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 1357984 SS.MNS-(D2Mit6-D2Rat166)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1357985 LOU/Ins originated from Universite Catholique de Louvain. INSERM, C.H.U. Bichat-Claude Bernard, Paris, France inbred 1357986 SS.LEW-(D1Uia8-D1Rat211)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 1357987 SS.LEW-(D1Uia8-D1Rat18)/Mco A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 1357988 SS.LEW-(D3Rat52-D3Rat17)/Ayd A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic 1357994 SHR/NCrl To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. Charles River Laboratories inbred 1358112 WKY/NCrl Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11 Charles River Laboratories inbred 1358114 SS-Chr 5^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 1358150 SS.LEW-(D16Rat12-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 1358151 FHH-Chr 8^BN/Mcwi A FHH genomic background with a BN chromosome 8 introgressed. PhysGen consomic 1358152 SS-Chr 14^BN/Mcwi A SS genomic background with a BN chromosome 14 introgressed. PhysGen consomic 1358153 COP/CrCrl Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998. Charles River Laboratories inbred 1358154 SS-Chr 3^BN/Mcwi A SS genomic background with a BN chromosome 3 introgressed. PhysGen consomic 1358155 SS.LEW-(D10Rat119-D10Mgh1)(D16Rat21-D16Rat112)/Ayd This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (D10Rat119-D10Mgh1)and (D16Rat21-D16Rat112) from the LEW strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 1358156 SS.MNS-(D2Rat183-D2Chm113)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358157 FHH-Chr 7^BN/Mcwi A FHH genomic background with a BN chromosome 7 introgressed. PhysGen consomic 1358158 FHH-Chr 16^BN/Mcwi A FHH genomic background with a BN chromosome 16 introgressed. PhysGen consomic 1358159 FHH-Chr 6^BN/Mcwi A FHH genomic background with a BN chromosome 6 introgressed. PhysGen consomic 1358160 SS.BN-(D8Rat163-D8Rat81)/Mcwi A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81. PhysGen congenic 1358161 SS.LEW-(D16Rat38-D16Chm66)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 1358162 SS-Chr 12^BN/Mcwi A SS genomic background with a BN chromosome 12 introgressed. PhysGen consomic 1358163 SS-Chr 15^BN/Mcwi A SS genomic background with a BN chromosome 15 introgressed. PhysGen consomic 1358164 FHH-Chr 17^BN/Mcwi A FHH genomic background with a BN chromosome 17 introgressed. PhysGen consomic 1358165 SS.MNS-(D2Chm51-D2Rat341)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358166 SS.LEW-(D16Mit3-D16Rat112)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 1358167 SS.MNS-(D2Wox27-Adh1)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358168 SS.LEW-(D16Mit2-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 1358169 SS.MNS-(D2Chm25-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Chm90-D2Wox37)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358170 FHH-Chr 5^BN/Mcwi A FHH genomic background with a BN chromosome 5 introgressed. PhysGen consomic 1358171 SS-Chr 17^BN/Mcwi A SS genomic background with a BN chromosome 17 introgressed. PhysGen consomic 1358172 SS.MNS-(D2Chm25-Fgg)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358173 FHH-Chr 11^BN/Mcwi A FHH genomic background with a BN chromosome 11 introgressed. PhysGen consomic 1358174 SS-Chr 19^BN/Mcwi A SS genomic background with a BN chromosome 19 introgressed. PhysGen consomic 1358175 FHH-Chr 20^BN/Mcwi A FHH genomic background with a BN chromosome 20 introgressed. PhysGen consomic 1358176 FHH-Chr 18^BN/Mcwi A FHH genomic background with a BN chromosome 18 introgressed. PhysGen consomic 1358177 SS.MNS-(D2Chm25-D2Mit14)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic 1358178 SS-Chr 10^BN/Mcwi A SS genomic background with a BN chromosome 10 introgressed. PhysGen consomic 1358179 FHH-Chr 13^BN/Mcwi A FHH genomic background with a BN chromosome 13 introgressed. PhysGen consomic 1358180 FHH-Chr 19^BN/Mcwi A FHH genomic background with a BN chromosome 19 introgressed. PhysGen consomic 1358258 RCS/Lav royal college of surgeons rat Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Retinal Degeneration Rat Model Resource inbred 1358259 RCS-p⁺/Lav Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain. Retinal Degeneration Rat Model Resource congenic 1358277 RCS-rdy⁺/Lav Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated. Retinal Degeneration Rat Model Resource congenic 1358278 RCS-rdy⁺ p⁺/Lav Developed by crossing a pink-eyed control(RCS-rdy⁺/Lav x black-eyed dystrophic(RCS-p⁺/Lav) The F12 progeny was backcrossed to RCS-rdy⁺/Lav. Retinal Degeneration Rat Model Resource congenic 1358298 SD-Tg(P23H)1Lav This transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23. Retinal Degeneration Rat Model Resource transgenic 1358299 SD-Tg(P23H)2Lav This transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23. Retinal Degeneration Rat Model Resource transgenic 1358300 SD-Tg(P23H)3Lav This transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23. Retinal Degeneration Rat Model Resource transgenic 1358302 SD-Tg(S334ter)3Lav This transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic 1358303 SD-Tg(S334ter)4Lav This transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic 1358304 SD-Tg(S334ter)5Lav This transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic 1358305 SD-Tg(S334ter)7Lav This transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic 1358306 SD-Tg(S334ter)9Lav This transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic 1358632 MR/Har Maudsely reactive Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred 1358633 MNRA/Har Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred 1358918 W-Plp^mdNya Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. Division of Laboratories and Research, New York State Department of Health, Albany, New York mutant 1358919 F344/Seac Inbred strain originated from F344 rats SEAC Yoshitomi Co., Fukuoka, Japan inbred 1358921 WF.DA-(D19Mit1-D19Mit6)/Kop Congenic strain originated from a parental DA/Slc strain. kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan, National BioResource Project for the Rat in Japan congenic 1358922 BB.WOKW-(D4Got41-Fabp1)/K Congenic strain originated from a BB/OK parental strain. Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany congenic 1358923 LE-Mbp^md 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks. Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada mutant 1358989 WKY.SHR-(D2Rat174-D2Rat28),(D2Rat161-D2Rat185) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358990 DA.F344-(D10Rat37-D10Arb9)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic 1358991 F344.HTX-(D11Rat4-D11Arb4)/Hcj Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj Department of Pharmacology, University of Florida, Gainesville congenic 1358992 SHR.WKY-(D2Rat40-D2Rat50) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358993 WKY.SHR-(D2Rat161-D2Rat185) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358994 SHR.WKY-(D2Rat161-D2Rat241) This subcongenic strain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358995 F344.OLETF-(D1Rat166-D1Rat90)/Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan, National BioResource Project for the Rat in Japan congenic 1358996 SHR.WKY-(D2Rat10-D2Mgh13) This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358997 WKY.SHR-(D2Rat241-D2Rat185) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1358998 BUF/NHsd Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan. Harlan inbred 1358999 WKY.SHR-(D2Rat174-D2Rat28) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359000 DA.F344-(D10Rat24-D10Rat11)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic 1359001 WKY.SHR-(D2Rat42-D2Rat139) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359002 NTac:WKY The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony. Taconic outbred 1359003 LEW/Jr This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA. Medical College of Ohio, Toledo, Ohio, USA inbred 1359004 DA.F344-(D10Rat37-D10Wox22)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic 1359005 SHR.WKY-(D2Rat15-D2Rat50) This subcongenic strain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359006 WKY.SHR-(D2Rat27-D2Rat243) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359007 WKY.SHR-(D2Rat174-D2Rat62) This subcongenic strain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359008 F344.HTX-(D11Rat4-D11Arb4)(D17Rat23-D17Rat154)/Hcj Double congenic strain originated from a cross between single congenic strains F344.HTX-(D11Rat4-D11Arb4)/Hcj and F344.HTX-(D17Rat23-D17Rat154)/Hcj. Department of Pharmacology, University of Florida, Gainesville congenic 1359009 WKY.SHR-(D2Rat174-D2Rat185) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic 1359010 WF.BBDR-ART2^a/Wor Wistar Furth Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 ^u/u , ART2^a. University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605 congenic 1547865 FHH-Chr 3^BN/Mcwi A FHH genomic background with a BN chromosome 3 introgressed. PhysGen consomic 1547866 F344/Jcl Inbred strain originated from F344 CLEA Japan, Inc.,1-2-7, Higashiyama, Meguro-ku Tokyo 153-8533 inbred 1547867 FHH-Chr 4^BN/Mcwi A FHH genomic background with a BN chromosome 4 introgressed. PhysGen consomic 1547868 FHH-Chr 2^BN/Mcwi A FHH genomic background with a BN chromosome 2 introgressed. PhysGen consomic 1547869 ACI/Eur August x Copenhagen Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands inbred 1547870 FHH-Chr 14^BN/Mcwi A FHH genomic background with a BN chromosome 14 introgressed. PhysGen consomic 1547871 ACI.FHH-(D1Rat324-D1Rat156)/Eur Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1547872 FHH-Chr X^BN/Mcwi FHH-Chr X^BN/Mcwi A FHH genomic background with a BN chromosome X introgressed. PhysGen consomic 1547873 FHH-Chr 15^BN/Mcwi A FHH genomic background with a BN chromosome 15 introgressed. PhysGen consomic 1547874 FHH-Chr Y^BN/Mcwi FHH-Chr Y^BN/Mcwi A FHH genomic background with a BN chromosome Y introgressed. PhysGen consomic 1547875 ACI.FHH-(D17Rat117-D17Arb5)(D17Rat180-D17Rat51)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1547876 FHH-Chr 10^BN/Mcwi A FHH genomic background with a BN chromosome 10 introgressed. PhysGen consomic 1549794 SS.LEW-(D2Rat199-D2Mco17)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic 1549795 SS.LEW-(D2Rat199-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic 1549796 BN/2Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16 National BioResource Project for the Rat in Japan coisogenic 1549797 BUF.ACI-(D16Rat31-D16Arb1)/Ncc This congenic strain in the BUF background that had homozygous ACI chr16 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic 1549798 BB.PVG-RT1^u/a/Tky A congenic strain with the genetic background of the BB/WorTky strain (RT1.B^u,D^u ) onto which the MHC locus of PVG.R23 strain (RT1.B,D ) has been transferred. National BioResource Project for the Rat in Japan congenic 1549799 BB.SHR-(D6Rat184-D6Rat3)/K Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. National BioResource Project for the Rat in Japan congenic 1549800 BN/KunKtsSlc Kitasato University School of Medicine to Slc (2001) National BioResource Project for the Rat in Japan mutant 1549801 BN/Seac Seac Yoshitomi, LTD, Fukuoka, Japan Seac Yoshitomi, LTD, Fukuoka, Japan inbred 1549802 BN/1Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15 National BioResource Project for the Rat in Japan coisogenic 1549803 ACI-Lyst^bg-Kyo/Kyo Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999. National BioResource Project for the Rat in Japan coisogenic 1549804 BUF/NacJcl CLEA Japan, Inc., Tokyo Japan Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan inbred 1549805 BUF.Cg-Foxn1^rnu/Mna BUF/Mna, NN1H-Rnu/Rnu National BioResource Project for the Rat in Japan congenic 1549806 BUF.ACI-(D3Rat56-D3Rat83)/Ncc This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan, National BioResource Project for the Rat in Japan congenic 1549808 SS.LEW-(Prlr-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic 1549809 BN/KtsSlc Kitasato University School of Medicine to Slc (2002) National BioResource Project for the Rat in Japan inbred 1549810 AI/Msik amelogenesis imperfecta rat This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc. National BioResource Project for the Rat in Japan mutant 1549811 ACI/NJcl ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan. Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; National BioResource Project for the Rat in Japan inbred 1549813 F344.ACI-Lmx1a^qc/Kyo Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. Institute of Laboratory Animals at Kyoto University, Japan, National BioResource Project for the Rat in Japan congenic 1549849 DRH.F344-(D1Mgh8-D1Mgh12)/Kyo desired fragment from F344 was introgressed into DRH background Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan congenic 1554301 WKHA/Bord Strain was originated from WHHA/Edh at the University of Vermont College of Medicine Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France inbred 1554302 HOB-Unc5c^+Snk hobble rat Homozygous hobble rats that were taken from the inbred hobble rat colony. National BioResource Project for the Rat in Japan mutant 1554303 CVD/Opu Cerebellar vermis defect rat Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates. Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan mutant 1554304 GAERS/Mave Genetic Absence Epilepsy Rats from Strasbourg 30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding. National BioResource Project for the Rat in Japan inbred 1554305 DA-Tg(CAG-lacZ)30Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan transgenic 1554306 GK/Slc Goto Kakizaki Rat Spontaneous mutant GK rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan mutant 1554307 W-Tg(LAC3)Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase. YS New Technology Institute, Tochigi, Japan transgenic 1554308 Gunn-Ugt1a1^jSlc Gunn Segregated inbred Gunn rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan segregating_inbred 1554309 W-Tg(CAG-GFP)184Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic 1554310 DA-Tg(CAG-lacZ)19Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan transgenic 1556748 F344/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred 1558660 SHRSP/Tkyo Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred 1558661 WKY/Tkyo Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred 1558662 SHR/Tkyo Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred 1559030 LEC-Tg(ATP7B)Tohm A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA. National BioResource Project for the Rat in Japan transgenic 1559031 NE/Mave The control strain of GAERS, free of any spontaneous spike and wave discharges. National BioResource Project for the Rat in Japan inbred 1559032 SS.LEW-(D17Rat65-D17Chm2)/Ayd This subcongenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic 1559033 SS.LEW-(D17Rat65-Prl)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic 1559034 SS.LEW-(D17Chm14-D17Rat97)/Ayd This subcongenic strain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic 1559035 SS.LEW-(D17Chm14-D17Rat181)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic 1559036 LEW/Jms Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred 1559037 SS.LEW-(D17Chm9-D17Rat97)/Ayd This subcongenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic 1559039 ODS/Jcl Osteogenic disorder Shionogi The osteogenic disorder Shionogi (ODS) rat is a mutant Wistar rat that is subject to scurvy, because it lacks L-gulono-gamma-lactone oxidase, a key enzyme in L-ascorbic acid biosynthesis. CLEA Japan, Inc. Tokyo Japan mutant 1559040 MD/Tama myelin deficient rat X-linked mutant of the Wistar rat. National BioResource Project for the Rat in Japan mutant 1559041 SHRSP/Ngsk Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. National BioResource Project for the Rat in Japan inbred 1559042 SHR/Nig Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. National BioResource Project for the Rat in Japan inbred 1559043 MV/Opu myelin vacuolation rat The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999. National BioResource Project for the Rat in Japan mutant 1559044 SS.SR-(D3Mco19-D3Mco5)/Jr A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats Medical College of Ohio, Toledo, Ohio, USA congenic 1559045 LEW/Crlc LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada Charles River Laboratories, La Salle, Quebec, Canada inbred 1559046 SHR-Chr Y^W/K Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996. National BioResource Project for the Rat in Japan consomic 1559047 SHRSP/Ezo Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan National BioResource Project for the Rat in Japan inbred 1559048 SHR.ODS-Gulo^od/Shi A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous oens were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995. National BioResource Project for the Rat in Japan congenic 1566430 SimTac:LE Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock. Taconic outbred 1566431 BN/MolTac The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003. Taconic inbred 1566432 WKY/NMolTac Wistar Kyoto The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit. Taconic inbred 1566433 HanTac:WH In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000. Taconic outbred 1566434 NTac:SHR Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. Taconic outbred 1566437 SS-Chr X^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 1566438 DA/MolTac Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004. Taconic inbred 1566439 F344/NTac Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH. Taconic inbred 1566440 NTac:SD Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies. Taconic outbred 1566443 LEW/MolTac Lewis Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived. Taconic inbred 1566444 MolTac:SD The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993. Taconic outbred 1566445 ACI.BN-(D5Mgh17-D5Rat205)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic 1566447 GK/MolTac Goto-Kakizaki Originating at Tohoku University, Sendai, Japan in 1975, the Goto-Kakizaki rat was obtained by Aarhus University Hospital, Denmark in 1994. Received from Aarhus by M&B A/S in 1997. Taconic inbred 1566448 FHH-Chr 9^BN/Mcwi A FHH genomic background with a BN chromosome 9 introgressed. PhysGen consomic 1566453 SD-Tg(HIV-LacZ)AngRrrc Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid. Rat Resource and Research Center transgenic 1566454 BDIV/Zte BDIV/Zte derived from Berlin-Druckrey strain BDIV Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred 1566455 HTX/HcjRrrc Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30. Rat Resource and Research Center inbred 1566456 BDIX/Zte derived from Berlin-Druckrey strain BDIX Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred 1566457 SPRD Sprague-Dawley From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990). unknown inbred 1566458 F344-Tg(ROSA26-hPAP)Eps F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP). Rat Resource and Research Center transgenic 1566459 F344-Tg(ROSA26-EGFP)Eps F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP). Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin transgenic 1566460 SD-Tg(ICAM2-DAF)AngRrrc Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter. Rat Resource and Research Center transgenic 1578692 BN.LEW-(D10Mco17-D10Rat116)/Ciml Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578693 LEW.BN-(D10Mco17-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578694 AT Alcohol-Tolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center recombinant_inbred 1578695 SHA/Bru Syracuse High Avoidance Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats. Rat Resource and Research Center inbred 1578696 LAS1 Low Alcohol Sensitive strain 1 Selectively bred for 24 generations for low sensitivity to ethanol then inbred. Rat Resource and Research Center recombinant_inbred 1578697 BN.LEW-(D10Mco17-D10Rat31)/Ciml Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578698 LAS2 Low Alcohol Sensitive strain 2 Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred Rat Resource and Research Center recombinant_inbred 1578699 BG anemic Belgrade These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY. Rat Resource and Research Center inbred 1578700 HAS1 High Alcohol Sensitive strain 1 Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred Rat Resource and Research Center recombinant_inbred 1578701 HAS2 High Alcohol Sensitive strain 2 Selectively bred for high ethanol sensitivity for 24 generations, then inbred. Rat Resource and Research Center recombinant_inbred 1578702 LEW.BN-(D10Rat32-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578703 SLA/Bru Syracuse Low Avoidance Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats. Rat Resource and Research Center inbred 1578704 WLP Warsaw Low Prefering These were bred from albino stock of Wistar rats as lines that had low ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred 1578705 LEW.BN-(D10Arb4-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578706 LEW.BN-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578707 BN.LEW-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578708 LEW.BN-(D10Mgh7-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578709 IA incisor absent These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption. Rat Resource and Research Center inbred 1578710 LEW.1AR1-iddm/Ztm arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A^aB/D^uC^u) in the intra-MHC recombinant inbred strain LEW.1AR1 ; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany coisogenic 1578711 LEW.BN-(D10Mco17-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578712 BN.LEW-(D10Rat32-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578713 BN/Ztm substrain of BN Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany inbred 1578714 BN.LEW-(D10Mit2-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic 1578715 ANT Alcohol-Nontolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center recombinant_inbred 1578716 LEW.1AR1/Ztm Lewis strain containing MHC haplotype RT1.A^aB/D^uC^u Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany congenic 1578717 WHP Warsaw High Prefering These were bred from albino stock of Wistar rats as lines that had ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred 1579677 FHH-Madd^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579678 ACI.FHH-(D3Wox2-D3Rat59)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1579680 Wild/Tku Wild These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed. Caught in Tokyo inbred 1579681 BN-Birc3^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579682 FHH-Tlr4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579683 FHH-Ghsr^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579684 FHH-Slc8a2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579685 FHH-Tgfbr2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579686 GH/OmrMcwi This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then. PhysGen inbred 1579687 FHH-Proc^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579688 BN-Tgfbr2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579689 FHH-F10^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579690 FHH-Slc27a5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579691 SS.SHR-(D11Mgh3-D11Rat31)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic 1579692 FHH-Lcat^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579693 T2DN/Mcwi Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin inbred 1579694 FHH-Egln3^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579695 ACI.FHH-(D1Rat298-D1Rat90)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1579696 SS.SHR-(D6Wox13-D6Rat84)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic 1579697 SS.SHR-(D13Rat63-D13Mit1)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic 1579698 FHH-Adra1a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579699 WKY.WKHA-(D5Rat45-D5Rat245)/Cfd WKY.WKHA-(D5Rat45-D5Rat245)/Cfd This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA congenic 1579700 ACI.FHH-(D1Rat475-D1Rat90)(D3Rat84-D3Rat59)/Eur Double congenic strain from backcross of ACI.FHH-(D1Rat298-D1Rat90)/Eur and ACI.FHH-(D3Wox2-D3Rat59)/Eur. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1579701 BN-Nos1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579702 SS.SHR-(D9Wox16-D9Rat64)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic 1579703 SS.SHR-(D2Rat61-D2Mco18)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic 1579704 FHH-Agtr1b^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579705 FHH-Nr0b2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579706 FHH-Nr4a1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579707 FHH-Adipoq^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579708 FHH-Des^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579709 Wild/Mcwi Wild These rats were caught wild in Milwaukee, used for experiments and then sacrificed. Caught in Milwaukee inbred 1579710 GK/Far Goto-Kakizaki Generated by selective brother x sister breding of 18 non-diabetic Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan James A. Haley Veterans Hospital, Tampa Florida inbred 1579711 FHH-Adipoq^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579712 FHH-Klf6^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579894 SS.LEW-(D10Rat204-D10Rat9)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579895 FHH-Bdkrb2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579896 SS.LEW-(D2Rat18-D2Chm277)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic 1579897 SS.SR-(D9Rat69-D9Mco14)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic 1579898 SS.LEW-(D10Chm128-D10Chm182)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579899 SS.LEW-(D5Rat130-D5Rat31)/JrMcwi SS.LEW-(D5Rat130-D5Rat31)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic 1579900 SS.SR-(D9Rat89-Resp18)/Mco Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain Medical College of Ohio, Toledo, Ohio congenic 1579901 SS.LEW-(D10Chm224-D10Chm6)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579902 SS.LEW-(D5Rat130-D5Rat108)/JrMcwi SS.LEW-(D5Rat130-D5Rat108)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic 1579903 SS.LEW-(D10Rat13-D10Rat11)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579904 SS.SR-(D9Mgh11-D9Mco33)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic 1579905 SS.SR-(D9Rat89-D9Mco27)/Mco Congenic strain derived from parental strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic 1579906 FHH-Adipoq^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579907 SS.LEW-(D10Chm128-D10Chm169)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579908 SS.SR-(D9Mco14-D9Rat9)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic 1579909 FHH-Fgl2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579910 FHH-Ccr2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579911 SS.LEW-(D5Rat130-D5Rat72)/Mcwi SS.LEW-(D5Rat130-D5Rat72)/Mcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee congenic 1579912 FHH-F10^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1579913 SS.LEW-(D10Chm224-D10Chm222)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1579914 SS.LEW-(D10Mco30-D10Got92)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 1580542 PCK/CrljCrl-Pkhd1^pck/Crl This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Katsuyama and associates in 2000. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). To Charles River in 2006. Charles River Laboratories coisogenic 1581616 DA.ACI-(D15Rat23-D15Rat71)/Kini DA.ACI-(D15Rat23-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic 1581617 SD-Tg(Ubc-eGFP/ Dazl-shRNA)16-13Gar This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas Texas transgenic 1581618 SHRSP/Bbb This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by srict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred 1581619 BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 1581620 SS.SR-(D9Mco61-D9Mco27)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic 1581621 DA.ACI-(D15Rat6-D15Rat48)/Kini DA.ACI-(D15Rat6-D15Rat48)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic 1581622 SD-Tg(Ubc-eGFP/ Dazl-shRNA)17-9GarRrrc Dazl shRNA (17-9) This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas, Texas; Rat Resource and Research Center transgenic 1581623 LA/Humd low autotomy Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred 1581624 FHH-Lipe^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1581625 BN-Hand1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1581626 FHL/EurMcwi Fawn Hooded Low blood pressure The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage. PGA inbred 1581627 WF.WKY-(D5Uwm66-D5Uwm67)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581628 DA.ACI-(D15Rat6-D15Rat13)/Kini DA.ACI-(D15Rat 6-D15Rat13)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic 1581629 WF.WKY-(D5Wox8-D5Uwm62)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581630 WF.WKY-(D5Uwm63-D5Uwm64)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581631 WF.WKY-(D5Uwm61-D5Uwm37)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581632 WF.WKY-(D5Uwm65-D5Uwm60)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581633 DA.ACI-(D15Rat6-D15Rat71)/Kini DA.ACI-(D15Rat6-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic 1581634 BN-Adora2a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1581635 WKY/Bbb This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred 1581636 BN-Cebpe^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1581637 FHH-Has1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1581638 DA.ACI-(D15Rat126-D15Rat71)/Kini DA.ACI-(D15Rat126-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic 1581639 HAn/Humd high autotomy new Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred 1581640 HA/Humd high autotomy High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred 1581641 WF.WKY-(D5Uwm68-D5Mit4)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine congenic 1581642 FHH-Ccr4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1581643 LAn/Humd low autotomy new Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred 1581644 FHH-Htr1a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1581645 LL/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred 1582184 SR/JrHsd Dahl Salt-Resistant Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Harlan inbred 1582185 SS.SR-(D3Mco36-D3Got166)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582186 FHH.FHH.1^BN-(D1Rat183-D1Rat76)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic 1582187 SS.SR-(D3Mco24-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582188 SS.SR-(D3Mco36-D3Mco46)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582189 SS.SR-(D3Mco39-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582190 SS/JrHsd Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Harlan inbred 1582191 FHH.FHH.1^BN-(D1Rat287-D1Rat84)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic 1582192 SS.SR-(D3Mco36-D3Got159)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582193 FHH.FHH.1^BN-(D1Mgh13-D1Rat89)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic 1582194 SS.SR-(D3Mco78-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 1582195 FHH.FHH.1^BN-(D1Rat173F6B-D1Rat84)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic 1582196 FHH.FHH.1^BN-(D1Rat234-D1Rat265)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic 1598797 WF.WKY-(D10Got124-D10Rat187)/Uwm WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL. Department of Oncology, University of Wisconsin, Madison Wisconsin congenic 1598798 BBDP/WorN Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr, Rat Resource and Research Center inbred 1598799 ACI.FHH-(D1Rat384-D1Rat452)(D17Rat61-D1Arb5)(D17Rat51)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1598800 ACI.FHH-(D1Rat384-D1Rat156)/Eur Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1598801 ACI.FHH-(D1Mit18-D1Mit8)(D14Mit11-D14Hmgc14b)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic 1598802 BBDR/WorN Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation NIH Autoimmune Rat Model Repository and Dev Ctr, Rat Resource and Research Center inbred 1598803 BBNB/WorN Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr, Rat Resource and Research Center inbred 1598804 WKY.GHS-(D1Rat32-D1Mit32) GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL Department of Medicine and Physiology, University of Rochester, Rochester New York congenic 1599674 BBDP.WF-(D8Rat59-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1599675 BBDP.WF-(D13Rat124-D13Mgh5)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1599755 F344.BN-(D16Mit5-D16Rat75) BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy congenic 1599756 BN-Has2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599757 BN-Adora2a^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1599758 SS-Sod3^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599759 GRY/Idr groggy rat Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003. National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan inbred 1599760 SPRD.WKY-(D18Wox8-D18Rat44)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic 1599761 BN-Lcat^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599762 SS-Bdkrb2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599763 SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic 1599764 COP.DA-(D16Rat12-D16Rat90)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic 1599765 SS-Klf4^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599766 SS-Hps6^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599767 SS-Htr1a^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599768 SS-Klf4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1599769 COP.DA-(D3Rat233-D3Mgh14)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic 1600337 F344.GK-(D1Mgh14-D1Rat90)/Swe This is a subcongenic strain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic 1600338 SHR.F344-(D12Mgh5-D12Mgh6)/Snk Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan congenic 1600339 BN.GK-(D1Wox18-D1Got254)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 1600340 DA/BklArbNsi Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI. Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY inbred 1600341 LEW-Tg(Ren2)27 This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats Wake Forest University School of Medicine, Winston-Salem, North Carolina transgenic 1600342 F344.GK-(D1Got250-D1Rat90)/Swe This is a subcongenic strain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic 1600343 SHRSP.WKY-(D1Wox29-D1Arb21)/Izm This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy National BioResource Project for the Rat in Japan congenic 1600344 F344.GK-(D1Rat175-D1Rat90)/Swe This is a subcongenic strain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic 1600345 F344.GK-(D1Rat83-D1Rat376)/Swe This is a subcongenic strain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic 1600346 F344.GK-(D1Swe4-D1Rat85)/Swe This is a subcongenic strain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic 1600490 SS-Chr 1^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic 1625284 Wild1/Hubr This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation Hubrecht Laboratory, Utrecht, The Netherlands outbred 1626207 BN-Adora2a^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PhysGen mutant 1626210 BN-Lipe^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1626213 BN-Oxtr^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1626214 BN-Slc27a5^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1641831 MWF-Chr 6^SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic 1641849 SS.LEW-(D10Mit1-D10Mgh1)/Jr This is a subcongenic strain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641850 SHR.WKY-(D1Got158-D1Got161)/Njs This is a subcongenic strain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic 1641851 SHR.PD-(D8Rat42-D8Arb23)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 1641852 WF.BBDR-(D4Got48-D4Got43)/Wor This subcongenic was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1641853 SS.LEW-(D10Mco38-D10Mgh1)/Jr This is a subcongenic strain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641854 HAS.LAS-(D5Rat70-D5Rat37) F1 generation males were backcrossed to HAS females and the offsprings were genotyped Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic 1641855 BBDP.WF-(D8Rat73-D8Rat20)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1641856 P.NP-(D4Rat119-D4Rat55)/Iusm P and NP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic 1641857 BBDP.WF-(D8Rat16-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1641858 SHR.WKY-(D1Rat420-D1Rat278)/Njs This is a subcongenic strain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic 1641859 SS.MNS-(D10Bra1-D10Mit11)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641860 SS.MNS-(D10Mco62-D10Mit1)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641861 HAS.LAS-(D2Rat38-D2Rat69) F1 generation males were backcrossed to HAS females and the offsprings were genotyped Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic 1641862 F344-Apc^PircUwm Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened University of Wisconsin-Madison, Madison, Wisconsin mutant 1641863 SHR.PD-(D8Mgh9-D8Rat149)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic 1641864 WF/CrCrli J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute. Charles River Laboratories Italy inbred 1641865 SD-Brca2^m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened University of Wisconsin-Madison, Madison, Wisconsin mutant 1641866 SS.LEW-(D10Mit10-D10Rat24)/Jr This is a subcongenic strain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641867 P/Iusm alcohol-preferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 1641868 WF.BBDR-(D4Rat93-D4Rat228)/Wor This subcongenic was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1641869 SS.MNS-(D10Mco31-D10Mit11)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641870 BBDP.WF-(D8Rat73-D8Rat121)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1641871 SS.MNS-(D10Mco62-D10Mco31)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641872 SS.LEW-(D10Mco38-D10Mco41)/Jr This is a subcongenic strain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1641873 NP/Iusm alcohol-nonpreferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred 1641874 BBDP.WF-(D8Rat73-D8Rat90)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1641875 SHR-Chr Y^BN/Cub BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations Czech Academy of Sciences, Prague, Czech Republic consomic 1641876 BBDP.WF-(D8Rat73-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic 1641877 NP.P-(D4Rat119-D4Rat55)/Iusm Male P and female NP rats were backcrossed to get F1 animals which were further backcrossed to NP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic 1641878 WF.BBDR-(Clcn1-D4Rat228)/Wor This subcongenic was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic 1641879 SS-Chr 19^SHR/Rkb SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic 1641880 SD-Brca1^m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened University of Wisconsin-Madison, Madison, Wisconsin mutant 1642017 BBDR/WorBrm This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. Biomedical Research Models, Inc. inbred 1642018 BBDP/WorBrm This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. Biomedical Research Models, Inc. inbred 1642036 SHR/OlaIpcv-mt^BN/Crl Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic 1642269 SS-Birc3^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642270 BN-Lcat^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642271 SS-Klf4^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642272 SS.LEW-(D10Mco84-D10Got93)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642273 SS-Thbd^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642274 SS-Has1^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642275 SS.LEW-(D10Rat29-D10Mco88)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642276 SS-Kcna5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642277 SS-Cpt2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642278 SS-Ghsr^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642279 SS.LEW-(D10Arb9-D10Rat161)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642281 SS-Podxl^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642282 SS-Cacna1g^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642283 SS.LEW-(D10Rat29-D10Got93)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642284 SS-Fgl2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642285 SS.LEW-(D10Arb9-D10Rat57)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642287 SS.LEW-(D10Arb9-D10Mco84)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642288 SS.LEW-(D10Mco89-D10Got101)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642289 SS-Serpina5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642362 SS-Has1^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642363 BN-Fgl2^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642364 SS-Ghsr^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642365 SS-Fgl2^m4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642366 SS-Lcat^m4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642367 BN-Ccr2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642439 SS-Lcat^m5Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant 1642689 BN.OLETF-(D1Rat169-D1Rat90)/Got OLETF/Got females were crossed with BN/Crlj to produce F₁ which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped Otsuka Pharmacuetical Company, Tokushima, Japan congenic 1642690 LA/NJcr-cp JCR:LA-corpulent rat Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta. Department of Surgery, University of Alberta, Edmonton, Canada congenic 1642968 SS.LEW-(D10Mco84-D10Rat58)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642969 SS.LEW-(D10Mco84-D10Mco134)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642970 SS.LEW-(D10Mco113-D10Got93)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642971 SS.LEW-(D10Mco84-D10Mco129)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642972 SS.LEW-(D10Mco84-D10Mco143)/Mco This is a subcongenic strain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 1642989 SS-Tg(CAG-eGFP)1Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642990 SD-Tg(CAG-eGFP)63Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642991 SS-Tg(CAG-eGFP)18Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642992 SS-Tg(CAG-eGFP)28Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642993 SD-Tg(CAG-eGFP)97Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642994 SS-Tg(CAG-eGFP)43Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642995 SS-Tg(CAG-eGFP)10Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642996 SS-Tg(CAG-eGFP)2Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1642997 SS-Tg(CAG-eGFP)23Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic 1643001 FH/Unc Fawn-hooded A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina inbred 1643002 SHR.WKY-(D1Rat420-D1Got161)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic 1643007 DA.ACI-(D12Wox12-D12Rat53)/Arb ACI/Hsd and DA/Hsd were crossed to get F₂ animals which were backcrossed with DA/Hsd and the progeny genotyped then backcrossed with DA/Hsd The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic 1643010 F344.OLETF-(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj double congenic strain generated by intercrossing F344.OLETF-(D7Rat18-D7Mit2)/Tj and F344.OLETF-(D14Rat23-D14Rat12)/Tj and F₂ rats screened for homozygosity University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan congenic 2289819 SS.MNS-(D10Mco62-D10Got99)/Mco This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289820 SS.MNS-(D10Mco30-D10Got91)/1Mco This is a subcongenic strain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289821 SS.MNS-(D10Mco30-D10Got91)/3Mco This is a subcongenic strain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA coisogenic 2289822 SS.MNS-(D10Mco30-D10Got112)/Mco This is a subcongenic strain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289823 SS.MNS-(D10Mco62-D10Mco30)/Mco This is a subcongenic strain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289824 SS.MNS-(D10Mco30-D10Got101)/Mco This is a subcongenic strain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289825 SS.MNS-(D10Rat24-D10Mco31)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289826 SS.MNS-(D10Mco30-D10Got91)/2Mco This is a subcongenic strain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289827 SS.MNS-(D10Mco30-D10Mco31)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2289913 SS.MNS-(D10Rat13-D10Rat12)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic 2289916 SS.MNS-(D10Mco15-D10Mit11)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic 2289917 SS.MNS-(D10Mco70-D10Mit11)/Jr This is a subcongenic strain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic 2290056 F344-Rbed1^{Tn(sb-T2/Bart3)2.42Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290057 F344-Tg(T2/Bart3)1Ceb The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic 2290064 F344-Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290065 F344-CA338503^{Tn(sb-T2/Bart3)2.196Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290066 F344-Nell1^{Tn(sb-T2/Bart3)2.195Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290067 F344-BI285226^{Tn(sb-T2/Bart3)2.193Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290078 F344-Myo9a^{Tn(sb-T2/Bart3)2.186Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290079 F344-BI285226^{Tn(sb-T2/Bart3)2.194Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290080 F344-BI284938^{Tn(sb-T2/Bart3)2.187Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290081 F344-BI284934^{Tn(sb-T2/Bart3)2.185Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290082 F344-Fam5c^{Tn(sb-T2/Bart3)2.189Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2290083 F344-Slc24a3^{Tn(sb-T2/Bart3)2.188Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290100 F344-Entpd6^{Tn(sb-T2/Bart3)2.174Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290101 F344-CB706876^{Tn(sb-T2/Bart3)2.181Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290102 F344-Klhl13^{Tn(sb-T2/Bart3)2.176Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290103 F344-Nrg1^{Tn(sb-T2/Bart3)2.183Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290104 F344-Cadm2^{Tn(sb-T2/Bart3)2.180Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290105 F344-Sptbn4^{Tn(sb-T2/Bart3)2.179Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290106 F344-BQ195794^{Tn(sb-T2/Bart3)2.182Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290107 F344-Cyss^{Tn(sb-T2/Bart3)2.173Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290108 F344-LOC290071^{Tn(sb-T2/Bart3)2.170Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290109 F344-CA338503^{Tn(sb-T2/Bart3)2.168Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290110 F344-Lims1^{Tn(sb-T2/Bart3)2.169Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290111 F344-Cst3^{Tn(sb-T2/Bart3)2.172Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290112 F344-CA338503^{Tn(sb-T2/Bart3)2.175Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290113 F344-Fam19a2^{Tn(sb-T2/Bart3)2.184Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290114 F344-Slc24a3^{Tn(sb-T2/Bart3)2.178Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290135 F344-Chsy1^{Tn(sb-T2/Bart3)2.165Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290136 F344-Slc24a4^{Tn(sb-T2/Bart3)2.145Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290137 F344-BF522453^{Tn(sb-T2/Bart3)2.166Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290138 F344-Glis1^{Tn(sb-T2/Bart3)2.149Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290139 F344-AW527406^{Tn(sb-T2/Bart3)2.156Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290140 F344-BI285110^{Tn(sb-T2/Bart3)2.167Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290141 F344-Abat^{Tn(sb-T2/Bart3)2.163Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Transposagen mutant 2290142 F344-LOC681893^{Tn(sb-T2/Bart3)2.161Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290143 F344-Napb^{Tn(sb-T2/Bart3)2.162Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290144 F344-Lphn3^{Tn(sb-T2/Bart3)2.151Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290145 F344-BI284938^{Tn(sb-T2/Bart3)2.155Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290146 F344-Plce1^{Tn(sb-T2/Bart3)2.146Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290147 F344-Sptlc3^{Tn(sb-T2/Bart3)2.147Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290148 F344-Map2k5^{Tn(sb-T2/Bart3)2.150Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290159 F344-Spetex-2H^{Tn(sb-T2/Bart3)2.136Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290160 F344-Rph3a^{Tn(sb-T2/Bart3)2.104Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290161 F344-Tmco1^{Tn(sb-T2/Bart3)2.135Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290162 F344-Inpp4b^{Tn(sb-T2/Bart3)2.143Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen/a>, Transposagen mutant 2290163 F344-Tg(T2/Bart3)2Ceb The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic 2290164 F344-Syne1^{Tn(sb-T2/Bart3)2.68Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290165 F344-Hnt^{Tn(sb-T2/Bart3)2.130Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290166 F344-Plcb3^{Tn(sb-T2/Bart3)2.69Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2290167 F344-Dlg1^{Tn(sb-T2/Bart3)2.133Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290168 F344-Pde5a^{Tn(sb-T2/Bart3)2.144Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource and Research Center mutant 2290169 F344-Tg(PGK2-SB11)Ceb SB11 cDNA linked to human PGK2 promoter was used. PGA transgenic 2290170 F344-Cd226^{Tn(sb-T2/Bart3)2.141Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2290171 F344-LOC681893^{Tn(sb-T2/Bart3)2.159Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2290186 SD-Tg(SOD1*G93A)39 SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic 2290187 SD-Tg(SOD1*H46R)4 SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic 2290272 SS/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred 2290273 SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic 2290274 SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2290275 SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo The desired fragment is transferred from WKY to SHRSP National Bio Resource Project Japan congenic 2290276 SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2290277 SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic 2290278 SR/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred 2290279 SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2290280 SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic 2290281 SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2290282 SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic 2290298 SHR-Tg(Thy1-MAPT)318 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic 2290299 SHR-Tg(Thy1-MAPT)72 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic 2290311 SD-Tg(SOD1*G93A)26Dwc SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California transgenic 2290386 SD-Tg(Wld^s)23Cole SD rats were microinjected with a mouse Wld^s with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic 2290387 SD-Tg(UbC-APPswe)6590 SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation Karolinska Institutet, Stockholm, Sweden transgenic 2290391 SD-Tg(Wld^s)79Cole SD rats were microinjected with a mouse Wld^s with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic 2290429 SS-Tg(ApoC3-CETP)53Opaz SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic 2291840 F344-RGD1311344^{Tn(sb-T2/Bart3)2.164Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant 2292168 ISIAH Inherited stress-induced arterial hypertension Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred 2292384 SS.LEW-(D10Chm167-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292385 SS.LEW-(D10Mco30-D10Got107)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292386 SS.LEW-(D10Chm155-D10Chm127)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292387 SS.LEW-(D10Chm224-D10Chm259)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292388 SS.LEW-(D10Chm246-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292389 SS.LEW-(D10Chm10-D10Chm14)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat13-D10Rat11)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292390 SS.LEW-(D10Chm194-D10Chm243)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic 2292451 F344-Stxbp5l^{Tn(sb-T2/Bart3)2.202Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2292452 F344-RGD1310753^{Tn(sb-T2/Bart3)2.171Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2292453 F344-BE329202^{Tn(sb-T2/Bart3)2.198Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2292454 F344-RGD1564304^{Tn(sb-T2/Bart3)2.201Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2292459 WF.LEW-RVFV Congenic Wistar Furth strain carrying genetic resistant to rift valley fever virus from the resistant Lewis rat strain Rat Resource and Research Center congenic 2292526 SS-Tg(R-alpha1NK)48Opaz SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 Rat Resource and Research Center transgenic 2292527 SS-Tg(RA1V9)64Opaz Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal. Rat Resource and Research Center transgenic 2292528 F344-Tg(APPswe)Opaz F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter Rat Resource and Research Center transgenic 2292529 LEW-Tg(Gt(ROSA)26Sor-luc)11Jmsk LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site Rat Resource and Research Center, National BioResource Project for the Rat in Japan transgenic 2292530 SD-Tg(Pou5f1-Dsred) This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells. Rat Resource and Research Center transgenic 2292531 SD-Tg(Pou5f1-EGFP) This transgenic strain carries a random insertion of a construct containing mouse Rat Resource and Research Center transgenic 2292532 F344-Tg(betaCTF-l45F) F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein Rat Resource and Research Center transgenic 2292564 ACI.COP-(D6Rat80-D6Rat146)/Shul Female COP/Crl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic 2292565 ACI.COP-(D3Mgh16-D3Rat119)/Shul Female COP/Crl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic 2292566 ACI.COP-(D3Rat130-D3Rat114)/Shul Female COP/Crl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic 2292567 ACI.COP-(D10Mgh8-D10Rat4)/Shul Female COP/Crl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic 2292647 SS.LEW-(D1Mco36-D1Rat106)/Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292648 SS.LEW-(D1Mco36-D1Mco77)/Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292649 SS.LEW-(D1Mco36-D1Rat131)/1Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292650 SS.LEW-(D1Mco36-D1Rat131)/2Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292651 SS.LEW-(D1Mco99-D1Rat49)/Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292652 SS.LEW-(D1Mco85-D1Rat49)/Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2292653 SS.LEW-(D1Mco36-D1Mco101)/Mco This is a subcongenic strain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic 2293012 ACI.BBDP-(RT1^u),(Gimap5)/Sunn 2 BBDP regions were introgressed into the ACI/SegHsd background Sunnybrook Research Institute, Toronto, Ontario, Canada congenic 2293120 LOU.BN-(D10Mgh1-D10Mgh14)/Ins segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU Cardiovascular Physiopathology, INSERM, Montpellier, France congenic 2293143 SS.BN-(D13Rat20-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2293144 SS.BN-(D13Rat91-D13Rat179)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2293145 SS.BN-(D13Rat123-D13Rat101)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2293146 SS.BN-(D13Rat20-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2293354 LEW.WKY-(D16Rat88-D16Rat40) segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/NHsd Imperial College, London, UK congenic 2293355 WKY.LEW-(D16Rat88-D16Rat40) 22.6 cM segment of chr 16 from LEW/NHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic 2293729 SHR-Gja8^m1Cub This strain is derived from SHR where a mutation is observed in the NH₂-terminal cytosolic domain of Cx50, L7Q Department of Biology, Charles University in Prague, Prague, Czech Republic mutant 2293761 LH-Chr 17^BN/Mav Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic 2293770 SHHF/Bbb Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred 2293832 LOU.BN-(D6Rat128-D6Rat115)/Ins segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross INSERM, Paris, France congenic 2298494 Kini:DA,PVG-G10 Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F₁ generation, 7 couples of F₁ with DA/Han and PVG.1AV1 females founders generated F₂. F₃ generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line 2298498 W/Gaox Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China inbred 2298772 WF^fzHsd Fuzzy rat Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987) Harlan, Rat Resource and Research Center mutant 2299122 F344-Tasp1^{Tn(sb-T2/Bart3)2.219Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299123 F344-AW921689^{Tn(sb-T2/Bart3)2.209Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299124 F344-Ubqln4^{Tn(sb-T2/Bart3)2.230Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299125 F344-Ccdc85a^{Tn(sb-T2/Bart3)2.248Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299126 F344-Kcnip4^{Tn(sb-T2/Bart3)2.225Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299127 F344-Fam176a^{Tn(sb-T2/Bart3)2.233Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299128 F344-Lama2^{Tn(sb-T2/Bart3)2.2013Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299129 F344-Lrrc4c^{Tn(sb-T2/Bart3)2.224Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299130 F344-Ada^{Tn(sb-T2/Bart3)2.237Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299131 F344-Grk1^{Tn(sb-T2/Bart3)2.234Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299132 F344-Cadm1^{Tn(sb-T2/Bart3)2.229Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299133 F344-Rap1gds1^{Tn(sb-T2/Bart3)2.251Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299134 F344-Ppapdc1a^{Tn(sb-T2/Bart3)2.207Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299135 F344-Mgat4c^{Tn(sb-T2/Bart3)2.244Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299136 F344-Snph^{Tn(sb-T2/Bart3)2.214Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299137 F344-Erbb4^{Tn(sb-T2/Bart3)2.208Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299138 F344-Nrxn2^{Tn(sb-T2/Bart3)2.250Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299139 F344-LOC686729^{Tn(sb-T2/Bart3)2.243Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299140 F344-Dcc^{Tn(sb-T2/Bart3)2.205Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299141 F344-Ppp2r2b^{Tn(sb-T2/Bart3)2.239Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299142 F344-Inpp4b^{Tn(sb-T2/Bart3)2.232Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299143 F344-Kif16b^{Tn(sb-T2/Bart3)2.200Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299144 F344-Trdn^{Tn(sb-T2/Bart3)2.238Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299145 F344-Rprd1a^{Tn(sb-T2/Bart3)2.247Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299146 F344-Ptpre^{Tn(sb-T2/Bart3)236Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2299147 F344-RGD1309969^{Tn(sb-T2/Bart3)2.228Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2299148 F344-Immp1l^{Tn(sb-T2/Bart3)2.246Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2300018 SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm Mukogawa Women's University, Nishinomiya, Hyogo Japan, National BioResource Project for the Rat in Japan congenic 2300195 EHC.BN-(D14Rat43-D14Rat132)/Kyu EHC/Seac and BN/Seac were crossed to get F₁ progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics Kyushu University, Fukuoka, Japan congenic 2300215 SHR.BN-(D10Mgh3-D10Rat85)/Ipcv subcongenic line derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic 2300216 SHR-Tg(PEPCK-SREBF1)1Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic 2300217 SHR.BN-(D10Mgh3-Srebf1)/Ipcv 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic 2301079 F344-Lrrc7^{Tn(sb-T2/Bart3)2.253Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2301080 F344-Lrrc4c^{Tn(sb-T2/Bart3)2.254Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2301081 F344-Mmel1^{Tn(sb-T2/Bart3)2.255Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource and Research Center, Transposagen mutant 2301246 SS.LEW-(D3Rat61-D3Wox1)/Ayd A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301247 SS.LEW-(D16Got3-D16Rat112)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Mit2-D16Chm23)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301248 SS.LEW-(D3Got33-D3Chm68)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301249 SS.LEW-(D18Rat30-D18Chm29)/Ayd A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301315 LE/Orl Long-Evans/Cryptorchid Obtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware Centre Nationale de la Researche Scientifique, Orleans, France inbred 2301330 KH Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma inbred 2301367 SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic 2301368 SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic 2301369 SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic 2301370 SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic 2301371 SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic 2301381 SS.LEW-(D18Chm41-D18Rat92)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301382 SS.LEW-(D18Chm91-D18Rat67)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301383 SS.LEW-(D18Chm31-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301384 SS.LEW-(D18Chm41-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301385 SS.LEW-(D18Rat29-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301386 SS.LEW-(D18Rat61-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301387 SS.LEW-(D18Rat67-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301388 SS.LEW-(D18Chm56-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 2301700 F344-Spata13^{Tn(sb-T2/Bart3)2.267Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2301701 F344-Ptpra^{Tn(sb-T2/Bart3)2.261Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen,Transposagen mutant 2301702 F344-Sf4^{Tn(sb-T2/Bart3)2.264Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2301937 BN.GH-(D18Rat41-D18Mgh4)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301938 BN.GH-(D6Mit12-D6Rat15)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301939 BN.GH-(D2Rat22-D2Mgh11)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301986 BN.GH-(D2Rat22-D2Mgh11)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301987 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)/Mcwi desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301988 BN.GH-(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2301989 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302067 F344/DuCrlSwe Substrain of Fischer rats maintained at Malmo, Sweden Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred 2302080 Rhd:F344,GK-G21 GK/Swe and F344/Swe were bred to create F₁ generation, couples of F₁ with GK/Swe and F344/Swe females founders generated F₂. F₃ generation originated from breeding random couples which were intercrossed to get further generations Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden advanced_intercross_line 2302081 DA.E3-(D11Got79-D11Wox5)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2302082 DA.E3-(D11Got79-D11Rat50)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2302106 SHRSP.WKY-(D1Rat44-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic 2302108 SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic 2302109 SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic 2302110 SHRSP.WKY-(Apbb1-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic 2302132 SHRSP-Tg(Tagln-ACE2)6918Bdr Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany transgenic 2302141 F344-Tg(Cyp1a1-Ren2)10Jmul Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression University of Edinburgh Medical School, Edinburgh, UK transgenic 2302148 SHR-Tg(Ef1a-Cd36)10Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic 2302149 SHR-Tg(Ef1a-Cd36)19Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic 2302150 SHR-Tg(Ef1a-Cd36)93Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic 2302151 SHR-Tg(Ef1a-Cd36)106Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic 2302279 F344.SDT-(D3Wox9-D3Arb20)/Kbe Female F344/NSlc were crossed with male SDT/CrljJcl, then female F₁ were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers Kobe University School of Medicine, Chuo-ku, Kobe, Japan congenic 2302387 DA.ACI-(D2Mit12-D2Mgh29)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/Hsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic 2302649 F344-Nsun4^{Tn(sb-T2/Bart3)2.286Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302650 F344-Enox1^{Tn(sb-T2/Bart3)2.282Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302651 F344-Klra2^{Tn(sb-T2/Bart3)2.279Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302652 F344-Pde4d^{Tn(sb-T2/Bart3)2.285Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302653 F344-Mov10^{Tn(sb-T2/Bart3)2.281Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2302654 F344-Csmd3^{Tn(sb-T2/Bart3)2.288Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302655 F344-Tmtc2^{Tn(sb-T2/Bart3)2.276Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302656 F344-Casp7^{Tn(sb-T2/Bart3)2.280Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2302657 F344-Orc3l^{Tn(sb-T2/Bart3)2.275Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302658 F344-Bbx^{Tn(sb-T2/Bart3)2.291Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302659 F344-Snx25^{Tn(sb-T2/Bart3)2.270Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302660 F344-Pvrl1^{Tn(sb-T2/Bart3)2.284Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302661 F344-Gramd1b^{Tn(sb-T2/Bart3)2.287Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302662 F344-Slc7a11^{Tn(sb-T2/Bart3)2.266Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2302666 Scr:sP Sardinian alcohol-preferring rats sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding. The Scripps Research Institute, LaJolla, California outbred 2302984 SS.BN-(D13Rat151-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302985 SS.BN-(D13Rat111-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302987 SS.BN-(D13Rat7-D13Rat60)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302989 SS.BN-(D13Rat57-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302994 SS.BN-(D13Rat127-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302996 SS.BN-(D13Rat7-D13Rat88)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302997 SS.BN-(D13Rat91-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2302999 SS.BN-(D13Rat178-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303001 SS.BN-(D13Rat111-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303002 SS.BN-(D13Rat123-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303003 SS.BN-(D13Rat7-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303004 SS.BN-(D13Rat115-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303005 SS.BN-(D13Rat127-D13Rat77)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303006 SS.BN-(D13Rat101-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303007 SS.BN-(D13Rat127-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303008 SS.BN-(D13Rat61-D13GRat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303009 SS.BN-(D13Rat183-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303010 SS.BN-(D13Got51-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303011 SS.BN-(D13Got51-D13Rat57)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 2303099 F344-Kcnh7^{Tn(sb-T2/Bart3)2.295Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2303100 F344-Slc16a12^{Tn(sb-T2/Bart3)2.298Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2303101 F344-Kcnab1^{Tn(sb-T2/Bart3)2.300Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2303102 F344-Dnah11^{Tn(sb-T2/Bart3)2.293Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2303103 F344-Pebp4^{Tn(sb-T2/Bart3)2.299Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2303116 SPRD.WKY-(D10Rat91-D10Rat135)/Ibmm SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic 2303117 SPRD.WKY-(D5Rat190-D5Rat114)(D18Rat102-D18Rat44)/Ibmm Double congenic strain generated by intercrossing SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm and SPRD.WKY-(D18Rat102-D18Rat44)/Ibmm; F₁ animals were intercrossed and F₂ screened for heterozygousity by markers Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic 2303148 SS.SHR-(D9Wox16-D9Rat76)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303149 SS.SHR-(D9Wox16-D9Mco73)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. Medical College of Ohio, Toledo, Ohio congenic 2303150 SS.SHR-(D9Mco74-D9Rat64)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303151 SS.SHR-(D9Wox16-D9Mco77)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303152 SS.SHR-(D9Mco72-D9Mco93)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303153 SS.SHR-(D9Uia6-D9Mco93)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303154 SS.SHR-(D9Wox16-D9Mco85)/Mco This is a subcongenic strain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic 2303504 LEW/JmsNgs congenital hydrocephalus rat Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant 2303761 SD-Tg(CAG-EGFP)4Osb Green rat This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc. National BioResource Project for the Rat in Japan transgenic 2303779 OLETF-Chr 14^F344/Tj Chromosome 14 from F344 is introgressed in OLETF background National BioResource Project for the Rat in Japan consomic 2303784 SHR-Chr 4^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic 2303785 SHRSP-Chr 3^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2303792 WTC.ZI-Atrn^zi/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University National BioResource Project for the Rat in Japan congenic 2303793 WTC.DMY-dmy/Kyo Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University National BioResource Project for the Rat in Japan congenic 2303971 OLETF.F344-(D7Mgh16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303972 BN-Chr 13^SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed PhysGen consomic 2303973 OLETF.F344-(D10Wox7-D10Wox6)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303976 F344-Cyp7b1^{Tn(sb-T2/Bart3)2.306Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2303977 F344-Ano3^{Tn(sb-T2/Bart3)2.307Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen mutant 2303978 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303979 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303986 WKAH.LEC-Atp7b^hts/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan congenic 2303987 F344.OLETF-(D17Mgh4-Edn1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303988 F344.OLETF-(D14Rat23-D14Rat12)(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303989 F344.OLETF-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303990 F344.OLETF-(D1Mit20-D1Mgh26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303991 F344.OLETF-(D7Rat31-D7Rat35)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303992 F344.OLETF-(D5Mgh29-D5Mgh22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303993 OLETF.F344-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303994 F344.OLETF-(D5Mgh4-D5Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303995 F344.OLETF-(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303996 F344.Cg-Foxn1^rnu/Kyo Jic N13 to Kyo (1988) National BioResource Project for the Rat in Japan congenic 2303997 F344.OLETF-(D7Mgh8-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2303998 WKAH.LEC-Ptprk^thid/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan congenic 2303999 F344.OLETF-(D14Rat8-D14Rat26)(D14Rat18-D14Rat22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304000 F344.OLETF-(D12Wox5-D12Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304001 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304002 F344.OLETF-(D11Mgh4-D11Mgh1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304003 F344.OLETF-(D16Rat19-D16Rat13)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304004 F344.OLETF-(D7Mit2-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304016 BUF.ACI-(D4Rat192-D4Rat66)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic 2304017 F344.CVD-Unc5c^cvd/Kyo Spontanious mutation from LEW inbred at Osaka Prefecture University in 1992. A congenic strain was produced by backcrosses to F344/NSlc strain at Kyoto University. National BioResource Project for the Rat in Japan congenic 2304018 BUF.ACI-(D4Rat226-D4Rat109)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic 2304019 BUF.ACI-(D15Rat68-D15Rat29)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic 2304020 ACI.BUF-(D15Rat97-D15Rat29)/Ncc This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic 2304037 DDI/Ddia dokkyo diabetes insipidus rat Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan National BioResource Project for the Rat in Japan inbred 2304038 OP/Jtt Opacitas Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats. National BioResource Project for the Rat in Japan mutant 2304039 WIC-Tg^rdwKts Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. National BioResource Project for the Rat in Japan mutant 2304040 F344.OP-Op/Jtt Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj. National BioResource Project for the Rat in Japan congenic 2304041 SD-Tg(CAG-Rgn)Slc Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and Rgn gene National BioResource Project for the Rat in Japan transgenic 2304045 F344.ZUC-Lepr^fa(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304046 F344.ZUC-Lepr^fa(D7Rat16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304047 F344.ZUC-Lepr^fa/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304050 F344.OLETF-(D14Rat23-D14Rat55)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304051 F344.OLETF-(D14Rat8-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304052 F344.OLETF-(D14Rat55-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304053 F344.OLETF-(D14Rat23-D14Rat5)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304054 F344.OLETF-(D14Rat23-D14Rat10)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304055 F344.OLETF-(D14Wox1-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304056 F344.OLETF-(D14Rat23-D14Wox14)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304057 F344.OLETF-(D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in JapanD14Rat143-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304059 F344.OLETF-(D14Rat5-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304060 F344.OLETF-(D14Wox14-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304061 F344.OLETF-(D14Rat23)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2304063 KDP-Tg(H2Kd-Cblb)2Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic 2304064 KDP-Tg(H2Kd-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic 2304065 KDP-Tg(INS-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic 2304066 KDP-Tg(CAG-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic 2304074 WKY.BUF-Tsr1d/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred. National BioResource Project for the Rat in Japan congenic 2304075 ACI.BUF-Pur1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic 2304076 WKY.BUF-Ten1 Ten2/Mna This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) and Ten2 (on chr. 13) has been transferred. National BioResource Project for the Rat in Japan congenic 2304077 WKY.BUF-Pur1s/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic 2304078 ACI.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic 2304079 WKY.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic 2304080 ACI.BUF-Aftm1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. National BioResource Project for the Rat in Japan congenic 2304081 WKY.BUF-Pur1w/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic 2304082 WKY.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic 2304083 ACI.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic 2304093 SHRSP.WKY-(D1Rat106-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic 2304094 SHRSP.WKY-(D1Smu12-D1Rat44)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304095 W-Tg(Plcb2-WGA,-EGFP)F1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic 2304096 SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic 2304097 SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304098 SHRSP.WKY-(D1Smu13-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic 2304099 SHRSP.WKY-(D1Smu12-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304100 SHRSP.WKY-(D1Rat39-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304101 SHRSP.WKY-(D1Rat43-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304102 SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic 2304104 W-Tg(Plcb2-WGA,-EGFP)M1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic 2304120 SHRSP2/Ta Kyo > Ta (1972) National BioResource Project for the Rat in Japan inbred 2304121 DA.WF-(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic 2304122 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic 2304123 DA.WF-(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic 2304124 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic 2304125 DRH.F344-Drh1/Shigm The DRH is an inbred rat strain established by selective breeding of the 3-Me-DAB resistant progeny of closed colony Donryu rats over 20 generations. Genetic analysis shows that two semidominant QTLs, Drh1 and Drh2, are responsible for strong resistance to chemical-induced hepatocarcinogenesis in DRH rats. Inbred DRH and F344 rats were purchased from SEAC Yoshitomi Co. DRH. National BioResource Project for the Rat in Japan congenic 2304200 W-Tg(CAG-ABO*A)32Jmsk This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304201 F344-Galntl6^{Tn(sb-T2/Bart3)2.311Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2304202 F344-RGD1565323^{Tn(sb-T2/Bart3)2.312Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2304203 W-Tg(CAG-DsRed2/GFP)1Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304204 W-Tg(CAG-ABO*B)13Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304205 W-Tg(Alb-DsRed2)34Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304206 W-Tg(CAG-DsRed2/GFP)15Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304207 F344-Lzic^{Tn(sb-T2/Bart3)2.309Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2304208 F344-Rapgef4^{Tn(sb-T2/Bart3)2.314Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2304209 F344-Rorb^{Tn(sb-T2/Bart3)2.304Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2304210 W-Tg(Alb-DsRed2)42Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304211 W-Tg(CAG-cre)81Jmsk This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304212 F344-RGD1563503^{Tn(sb-T2/Bart3)2.313Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2304213 F344-Leprel2^{Tn(sb-T2/Bart3)2.310Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2304214 W-Tg(CAG-ABO*B)2Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304215 F344-Tg(XPO1)1Hik F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) National BioResource Project for the Rat in Japan transgenic 2304221 WTC-swh/Kyo The rat showed abnormal hair texture and mammary gland hypoplasia was occurred in the WTC.ZI-Atrn^zi colony at the National Cancer Center Research Institute in 1998. After elimination of zi allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. National BioResource Project for the Rat in Japan mutant 2304222 WIAR/Iar Wistar-Imamichi Strain developed by the depositor National BioResource Project for the Rat in Japan inbred 2304241 F344-Tg(CXCR4)1Hik Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj. National BioResource Project for the Rat in Japan transgenic 2304242 WTC-Kcnq1^dfkKyo Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrn^zi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1^dfk/Kyo rat is a mutant for circling behavior. although the Atrn^zi allele of WTC.ZI-Atrn^zi congenic rats was eliminated, the circling behavior remained. National BioResource Project for the Rat in Japan mutant 2304277 SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304278 DA-Tg(Alb-HSVtk)5Jmsk This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in this transgenic rats causes hepatitis. National BioResource Project for the Rat in Japan transgenic 2304279 W-Tg(MT2A-Myc)1Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic 2304280 SHR/Shi Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2304281 SERC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant 2304282 IEW/Ihr mutant of Ihara epileptic rat. National BioResource Project for the Rat in Japan inbred 2304283 SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304284 SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304285 BDIX/NemOda Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2304286 DMYC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan coisogenic 2304287 ACI.F344-(D16Rat17-D16Rat15)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain. National BioResource Project for the Rat in Japan congenic 2304288 ACI.BUF-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304289 SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304290 BUF.ACI-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304291 LEW-Tg(CAG-EGFP)1Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic 2304292 LEW-Tg(Gt(ROSA)26Sor-luc)21Jmsk This strain expresses luciferase ubiquitously driven by the gene trap ROSA 26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304293 F344.LEC-xhs1/1Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selectied with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic 2304294 MPOD/Kyo Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait. National BioResource Project for the Rat in Japan mutant 2304295 SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304296 KB/Oda Maintained by crossing heterozygotes of the albino locus (segregating inbred strain). National BioResource Project for the Rat in Japan segregating_inbred 2304297 TM.KDP-Cblb/Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic 2304298 SD-Tg(Tuba1a-EYFP)Okn This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter. National BioResource Project for the Rat in Japan transgenic 2304299 LEW-Tg(Alb-GFP)6Jmsk This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304300 W-Tg(S100b-EGFP)Scell Developed by microinjecting the transgene into Wistar rats National BioResource Project for the Rat in Japan transgenic 2304301 SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304302 SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304303 W-Tg(MT2A-Myc)2Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic 2304304 SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304305 DOB/Oda This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000. National BioResource Project for the Rat in Japan inbred 2304306 BUF.ACI-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304307 ACI.BUF-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304308 ICR/Ihr A new strain of rat with an inherited cataract National BioResource Project for the Rat in Japan inbred 2304309 SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304310 SD-Tg(Nes/Hspa1b-EGFP)Okn This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter. National BioResource Project for the Rat in Japan transgenic 2304311 LEW-Tg(Gt(ROSA)26Sor-lacZ)44Jmsk This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2304312 SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304313 SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304314 BDIX.Cg-Tal/NemOda Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic 2304315 SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2304316 F344.LEC-xhs1/2Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selectied with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic 2304329 WKY/Ezo Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2304330 SD-Tg(HRAS)128Ncu This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. National BioResource Project for the Rat in Japan transgenic 2304331 F344-Tg(CCR5)1Hik Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2304332 HER/Wkmt Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2305934 F344-Spta1^{Tn(sb-T2/Bart3)2.315Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2305935 F344-Rtn4^{Tn(sb-T2/Bart3)2.316Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2305939 SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305940 SHRSP-Chr 7^WKY/Tkyo Chromosome 7 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2305941 SHR-Chr 15^WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic 2305942 SHR-Chr 3^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic 2305943 SHRSP-Chr 15^WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2305944 SHRSP-Chr 4^WKY/Tkyo Chromosome 4 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2305945 SHRSP-Chr 13^WKY/Tkyo Chromosome 13 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2305946 SHR-Chr 1^WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic 2305947 SHR-Chr 19^WKY/Tkyo Chromosome 19 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic 2305948 SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305949 SHRSP-Chr 1^WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic 2305966 SHR.SHRSP-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305967 SHR.SHRSP-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305968 SHRSP.WKY-(D1Wox18-D1Rat39)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305969 SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305970 DA-Tg(Alb-TTR*V30M)7Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2305971 SHRSP.SHR-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305972 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305973 SHRSP.SHR-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305974 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305975 SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305976 DA-Tg(Alb-TTR*V30M)9Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2305977 ACI.F344-(D16Rat12-D16Mco2)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2305978 LEW-Tg(Gt(ROSA)26Sor-DsRed*)7Jmsk This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic 2305979 WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305987 F344.OLETF-(D7Mgh16-D7Wox46)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305988 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305989 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Z-Lepr^fa/Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305990 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305991 (F344.OLETF-(D7Mgh16-D7Mgh20)/Tj X F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305992 F344.OLETF-(D7Mit16-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305993 F344.OLETF-(D14Rat23)(D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305994 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305995 F344.OLETF-(D7Got130-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305996 F344.Cg-Lepr^fa(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305997 (F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/2Tj x F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305998 F344.Cg-Lepr^fa(D8Rat54-D8Mgh17)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2305999 F344.OLETF-(D7Mgh16-D7Rat70)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306000 F344.OLETF-(D7Rat70-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306001 F344.OLETF-(D7Rat176-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306002 F344.OLETF-(D14Rat23)(D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306003 F344.OLETF-(D7Wox46-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306004 F344.OLETF-(D7Mgh16-D7Mit16)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306013 F344.OLETF-(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306014 F344.OLETF-(D8Rat54-D8Mgh17)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306015 F344.OLETF-(D12Wox5-D12Rat21)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306016 F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306017 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306018 F344.OLETF-(D9Mgh8-D9Mit2)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306019 F344.OLETF-(D1Mit20-D1Mgh26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306020 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306021 SHR-Chr 2^WKY/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan consomic 2306022 KCI/Kyo Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003. National BioResource Project for the Rat in Japan mutant 2306023 F344-Tg(CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306024 FOK/Ncu Furuyama rat These are resistant to hot environment. National BioResource Project for the Rat in Japan inbred 2306025 WMN/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2306026 F344.OLETF-(D16Wox4-D16Rat13)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306027 WM/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2306028 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306029 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306030 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306033 SHR.Cg-Lepr^cp/NDmcr Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. National BioResource Project for the Rat in Japan congenic 2306034 NER.F344-(D1Mgh6-D1Rat132)(D5Rat100-D5Rat234)/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306035 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)/Kyo This double congenic strain was established by crossing F344.NER-(D1Mgh6-D1Rat73)/Kyo and F344.NER-(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan congenic 2306036 F344-Apc^m1Kyo F344/NSlc rats that have an induced mutation in the Apc gene National BioResource Project for the Rat in Japan mutant 2306037 F344-Tg(CD4)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306041 F344-Scn1a^m2Kyo Established by ENU mutagenesis. A point mutation in Scn1a gene. National BioResource Project for the Rat in Japan mutant 2306042 F344-Scn1a^m1Kyo Established by ENU mutagenesis. A point mutation in Scn1a gene. National BioResource Project for the Rat in Japan mutant 2306043 SHR/4Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure National BioResource Project for the Rat in Japan inbred 2306044 SHRSP/3Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line National BioResource Project for the Rat in Japan inbred 2306045 SHR/2Dmcr Developed by the DEPOSITOR, one of the SHR substrains from B2 line National BioResource Project for the Rat in Japan inbred 2306046 W-Tg(CAG-EGFP)3Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic 2306047 W-Tg(Gnrh1-EGFP)Nphy This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence. National BioResource Project for the Rat in Japan transgenic 2306048 SHR/3Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure National BioResource Project for the Rat in Japan inbred 2306049 SHRSP/4Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis National BioResource Project for the Rat in Japan inbred 2306050 SHRSP/5Dmcr Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis National BioResource Project for the Rat in Japan inbred 2306051 SHRSP/2Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line National BioResource Project for the Rat in Japan inbred 2306058 LEC.W-Tg(CAG-Zfml)30Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306059 DA.Cg-Foxn1^rnu Lyst^bg/Slc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306060 LEC.W-Tg(CAG-Zfml)26Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306061 ACI.BUF-Pur1 Ten2/Mna The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002. National BioResource Project for the Rat in Japan congenic 2306062 W-Tg(Per1-luc)1Oa Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306063 LEC.W-Tg(CAG-Zfml)21Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306064 MPR/Iar Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant 2306070 WIC-Tg(Wap-GH1)1Mni Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306071 F344-Tg(CAG-EGFP)Ncco Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method National BioResource Project for the Rat in Japan transgenic 2306072 ACI.F344-(D16Nkg74)/Nkg A sub congenic strain of ACI/N.F344-(D16Rat12-D16Mco2)/Nkg National BioResource Project for the Rat in Japan congenic 2306073 WIC-Tg(Wap-GH1)2Mni Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306076 ACI.F344-(D16Nkg9-D16Nkg38)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2306077 ACI.F344-(D16Rat64-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating. National BioResource Project for the Rat in Japan congenic 2306078 KFRS4A/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant 2306079 ACI.F344-(D16Nkg87-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat64-D16Nkg105)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2306085 TCR/Ibu Toyoda Circling Rat A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007. National BioResource Project for the Rat in Japan mutant 2306089 ACI.BUF-(D7Wox16-D7Rat69)/Mna The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing. National BioResource Project for the Rat in Japan congenic 2306090 EXHC/Ta Exogenously hypercholesterolemic rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2306098 ACI.F344-(D16Nkg30-D16Mgh6)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2306099 SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306100 SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306101 LEC.BN-(D4Mgh16-D4Rat233)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306102 BN.LEC-(D4Rat128-D4Rat106)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306103 SHRSP/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2306104 BN.LEC-(D4Rat184-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306105 BN.LEC-(D4Rat128-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306106 CLX/Ta Circling behavior linked to the X-chromosome (CLX) Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant 2306107 SD-Tg(Sp6)58Tj The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic 2306108 SHR.WKY-(D3Mit9-D3Wox16)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306109 SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306110 IER/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred 2306111 LEC.BN-(D4Mgh16-D4Rat233)(D4Rat271-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2306112 ZDF-Lepr^faCrlCrlj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant 2306113 SD-Tg(Sp6)6Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306114 SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306115 SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306116 SD-Tg(Sp6)5Tj The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic 2306117 ACI.F344-(D16Nkg9-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2306118 SHR.WKY-(D15Rat95-D15Rat106)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306119 F344-Tg(CD4,CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic 2306120 SHR.WKY-(D4Wox27-D4Rat15)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic 2306276 F344-Exoc4^{Tn(sb-T2/Bart3)2.317Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2306277 F344-Gng12^{Tn(sb-T2/Bart3)2.320Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2306278 F344-AW915325^{Tn(sb-T2/Bart3)2.319Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2306279 F344-Diaph3^{Tn(sb-T2/Bart3)2.318Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2306529 BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Parental strain BBDR.BBDP-(D4Rhw17-ss99306861)(D4Rhw11-D4Rhw10)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic Department of Medicine, University of Washington, Seattle, Washington congenic 2306532 BBDR.F344-(D4Rat27-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw subcongenic lines developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic 2306533 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/2Rhw subcongenic lines generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic 2306534 BBDR.F344-(D4Rat102-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw subcongenic lines identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic 2306535 BBDR.F344-(D4Rat253-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw subcongenic lines identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic 2306536 BBDR.F344-(D4Arb11-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw subcongenic lines generated by intercrossing male BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw and female BBDR/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic 2306537 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/1Rhw subcongenic lines generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic 2306538 BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw subcongenic lines generated by intercrossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation Department of Medicine, University of Washington, Seattle, Washington congenic 2306539 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/3Rhw subcongenic lines developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic 2306540 BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw subcongenic lines developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic 2306541 BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington congenic 2306542 BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw subcongenic lines developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic 2306543 BBDR.F344-(D4Got59-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington congenic 2306544 BBDR.F344-(D4Rat26-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw subcongenic lines developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic 2306709 BBDR.BBDP-(D4Mit6-D4Mit7)/3Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic 2306710 F344-Lmln^{Tn(sb-T2/Bart3)2.322Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2306711 F344-FM117003^{Tn(sb-T2/Bart3)2.321Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2306712 BBDR.BBDP-(D4Mit6-D4Mit7)/2Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic 2306717 BBDP/WorSunn These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada. Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada inbred 2306784 Kini:DA,PVG-G12 Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1^a MHC haplotype were bred to create F₁ generation, 7 couples of F₁ with DA/Han and PVG/OlaHsd females founders generated F₂. F₃ generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line 2306815 SS.SR-(D7Rat67-D7Mco7)/Jr subcongenic strain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic 2306816 SS.SR-(D7Mco19-D7Mco7)/Jr subcongenic strain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic 2306817 SS.SR-(D7Uia1-D7Mco19)/Jr subcongenic strain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic 2306818 SS.SR-(D7Rat131-D7Mco7)/Jr subcongenic strain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic 2306819 SS.SR-(D7Uia1-D7Rat131)/Jr subcongenic strain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic 2306820 SS.SR-(D3Arb14-D3Mco36)/Mco SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic 2306823 SS.SR-(D3Arb14-D3Mco36)(D7Mco19-D7Mco7)/Mco SS.SR-(D3Arb14-D3Mco36)/Mco were crossed with SS.SR-(D7Mco19-D7Mco7)/Jr and then F₁ rats were backcrossed with SS.SR-(D3Arb14-D3Mco36)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred Medical College of Ohio, Toledo, Ohio, USA congenic 2306840 E3.DA-(D4Wox22-D4Got132)(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2306841 E3.DA-(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2306842 E3.DA-(D20Rat45-D20Rat47)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2306874 F344-Intu^{Tn(sb-T2/Bart3)2.324Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2306875 F344-Faslg^{Tn(sb-T2/Bart3)2.325Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2306892 SHR.BN-(D2Rat114-D2Rat123)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic 2306893 SHR.BN-(D16Rat87-D16Mgh1)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic 2306894 SHR.BN-(D4Rat33-D4Rat54)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic 2306895 SHR.BN-(D2Rat226-D2Rat294)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic 2306961 RLA/Verh Roman low avoidance Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred 2306962 RHA/Verh Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred 2307077 HXB4 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307078 HXB27 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307079 HXB3 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307080 HXB20 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307081 HXB31 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307082 HXB18 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307083 HXB10 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307084 HXB24 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307085 HXB17 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307086 HXB7 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307087 SHR.BN-(D18Rat32-D18Rat12)/Ipcv A segment of chr 18 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic 2307088 HXB22 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307089 HXB29 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307090 SHR.BN10/Ipcv A segment of chr 10 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic 2307091 HXB13 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307092 HXB14 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307093 HXB23 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307094 HXB1 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307095 HXB15 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307096 HXB2 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307097 HXB21 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307098 HXB25 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307099 HXB5 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred 2307115 BXH5 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307116 PXO3-2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307117 PXO5-2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307118 PXO9 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307119 PXO7-1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307120 PXO7-2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307121 BXH2 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307122 PXO8-1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307123 BXH13 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307124 BXH10 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307125 PXO6-2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307126 BXH8 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307127 BXH11 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307128 PXO5-1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307129 BXH9 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307130 PXO6-3 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307131 PXO8-2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307132 PXO10 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307133 BXH12-2 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307134 BXH3 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307135 PXO4 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307136 BXH6 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307137 PXO6-1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307138 PXO1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307139 BXH12-1 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307155 SHR/1NCrl To Charles River from NIH in 1973 at F32. MRC Clinical Sciences Centre, College School of Medicine, London, UK inbred 2307156 DA/ZtmKini Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden inbred 2307157 PVG.1AV1/Kini Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic 2307159 SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307160 SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307161 SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307166 SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307167 SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307168 SHRSR/Bbb Spontaneously Hypertensive Rat, Stroke Resistant This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred 2307169 SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic 2307298 BN/HanKini Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred 2307299 ACI/ZtmKini substrain of ACI derived from ACI/Ztm Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred 2307300 LEW.1AV1/Kini Substrain of LEW.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2307301 DA.LEW.RT1f-(D20Wox15-D20Wox13)/Rhd RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Han from LEW.1F/Han with positive selection of microsatellite markers Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden congenic 2307317 MHS Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy outbred 2307318 BDIX/Ifz derived from Berlin-Druckrey strain BDIX Duisburg-Essen University Medical School, Essen, Germany inbred 2307319 MNS/N Milan normotensive strain Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Rat Resource and Research Center inbred 2307355 PXO3-1 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307356 PXO2 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred 2307357 BDV/Ztm Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred 2307358 LUDW/OlaHsd Ludwig Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979. Harlan inbred 2307359 BUF/SimRijHsd Developed by Heston in 1946 from a Buffalo Harlan Sprague Dawley, Inc., Indianapolis, IN inbred 2307360 DA.BI.RT1i-(D20Rat42-D20Rat31)/Rhd RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic 2307441 F344-Cyyr1^{Tn(sb-T2/Bart3)2.328Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2307442 F344-Robo1^{Tn(sb-T2/Bart3)2.327Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen Transposagen mutant 2308816 Crl:WI(Han) Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL. Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system. Charles River Laboratories outbred 2308851 Crl:OP(CD) Obese Prone Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD). Charles River Laboratories outbred 2308852 Crl:LE Long-Evans Rats Originated by Drs. Long and Evans in 1915 by crossing several Wistar outbred 2308853 Crl:OR(CD) Obese Resistant Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets. Charles River Laboratories outbred 2308885 GK/CskCrljCrl The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006. Charles River Laboratories inbred 2308886 SS/HsdMcwiCrl Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001. Charles River Laboratories inbred 2311049 SHROB/KolGmiCrl-Lepr^cp/Crl This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. Charles River Laboratories coisogenic 2311051 SHRSP/A3NCrl Stroke Prone Rats The SHRSP was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. Charles River Laboratories inbred 2311070 BUF/CrCrl Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred 2311071 ZDF-Lepr^fa/Crl A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. Charles River Laboratories coisogenic 2311072 FHH/EurMcwiCrl An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001. Charles River Laboratories inbred 2311073 NBL/CrCrl Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998. Charles River Laboratories inbred 2311074 BDIX/CrCrl Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred 2311078 Crl:CD-Hr^hr CD hairless rats This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic. Charles River Laboratories outbred 2311079 WF/CrCrl J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred 2311082 SS-Chr 13^BN/McwiCrl Developed at the Medical College of Wisconsin. To Charles River in 2003. Charles River Laboratories consomic 2311692 F344-Myo1d^{Tn(sb-T2/Bart3)2.334Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2311693 F344-Tmem22^{Tn(sb-T2/Bart3)2.332Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2311694 F344-LOC685444^{Tn(sb-T2/Bart3)2.333Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2312352 LEW.1N These congenic rats carry the RTlⁿ haplotype on the LEW strain genetic background. Zentralinstitut fur Versuchstierzucht, Hannover, Germany congenic 2312447 SD-Tg(Pmp22)Kan This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library Max Planck Institute for Experimental Medicine, Gottingen, Germany transgenic 2312466 Crl:LIS Lister Hooded Rat These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance. Charles River Laboratories outbred 2312471 Crl:ZUC(Orl)-Lepr^fa The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991. Charles River Laboratories outbred 2312472 Crl:WI(WU) Wistar Wu Rat Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987. Charles River Laboratories outbred 2312473 BDIX/OrlCrl BDIX Rats Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991. Charles River Laboratories inbred 2312474 Crl:OFA(SD) The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968. Charles River Laboratories outbred 2312498 WAG/RijCrl WAG Rats A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993. Charles River Laboratories inbred 2312499 Crl:NIH-Foxn1^rnu Nude Rats The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs. Charles River Laboratories outbred 2312504 Crlj:WI Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981) Charles River Laboratories outbred 2312511 WF/IcoCrl Wistar Rats Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970. Charles River Laboratories inbred 2312512 ZSF1-Lepr^fa Lepr^cp/Crl This hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis. Charles River Laboratories hybrid 2312513 Crlj:DON Dr. Sato(1952) to Nippon Rat to CRLJ(1990) Charles River Laboratories outbred 2312514 Crlj:LEC Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991). Charles River Laboratories outbred 2312518 Crlj:ZUC-Lepr^fa Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000) Charles River Laboratories outbred 2312577 SHR.BN-(D18Rat99-D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic 2312578 SHR.BN-(D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic 2312579 SHR.BN-(D18Rat40-D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic 2312580 SHR.BN-(D18Rat113-D18Rat82)/Ipcv SHR/OlaIpcv were crossed with BN/Crl, F₁ animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes Czech Academy of Sciences, Prague, Czech Republic congenic 2312609 MWF-Chr 8^SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic 2312644 DA.WOKW-(D3Mit10-D3Rat189)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 2312645 DA.WOKW-(D16Rat88-D16Wox7)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 2312646 DA.WOKW-(D5Mgh6-D5Mit5)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 2312647 DA.WOKW-(D3Mgh5-D3Rat1)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 2312648 DA.WOKW-(D10Mgh2-D10Rat4)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic 2312733 BN-Chr 13^SS Chr 18^SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed PhysGen consomic 2313181 LEW.1WR1/WorBrm Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc. Biomedical Research Models, Inc. congenic 2313209 WF.ART2/Wor developed at the Universtiy of Massachusetts, Medical School Universtiy of Massachusetts, Worcester, MA congenic 2313221 SHHF-Lepr^cp/Crl Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. Charles River Laboratories congenic 2313222 BN/HsdMcwiCrl BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River Charles River Laboratories inbred 2313231 LEWBNF1/Crl This hybrid rat is a cross between a LEW female and a BN male rat. Charles River Laboratories hybrid 2313232 WFF344F1/Crl This hybrid rat is a cross between a WF female and a F344 male rat. Charles River Laboratories hybrid 2313342 BN-Chr 17^LH/Mav Chr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic 2313343 LH-Chr 13^BN/Mav Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic 2313384 Wild/Nov These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia inbred 2313463 F344-Ppfia2^{Tn(sb-T2/Bart3)2.339Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGenTransposagen>, mutant 2313464 F344-Large^{Tn(sb-T2/Bart3)2.336Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2313465 F344-Pld5^{Tn(sb-T2/Bart3)2.340Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen,Transposagen mutant 2313466 F344-Agbl4^{Tn(sb-T2/Bart3)2.337Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen mutant 2313588 SD-Tg(Ins2-IAPP)Soel Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter Pfizer, Inc, Groton, Connecticut transgenic 2313693 SHR-Tg(PEPCK-SREBF1)2Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic 2313734 SD-Tg(Insr-shRNA)29Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic 2313735 SD-Tg(Insr-shRNA)14Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic 2313922 F344.LEW-(D10Rat142-D10Rat15)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markers Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic 2313923 LEW.F344-(D10Rat99-D10Rat11)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markers Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic 2313924 LEW-Chr Y^F344/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK consomic 2314001 N:HS Heterogeneous stock Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred 2314009 NMcwi:HS Heterogeneous stock 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generation; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. We use a rotational delay of 1, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc. Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin outbred 2314027 SDT.ZDF-Lepr^fa/Jtt SDT fatty Lepr^fa allele from ZDF was introgressed into SDT rats using the speed congenic method Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan congenic 2314161 F344-Kuru1/Kyo Kuru1 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314162 F344-Oune/Kyo Oune A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314163 F344-Ker/Kyo KER(Kyoto Epileptic Rat), Boo This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant 2314164 F344-Kuru2/Kyo Kuru2 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314165 ACI-Chib/Kyo Chibi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant 2314166 F344-Tbr2/Kyo Tsubura2 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314167 F344-Kmch/Kyo Komachi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant 2314168 F344-Tbr1/Kyo Tsubura1 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314169 WTC.F344-Scn1a^m1Kyo/Kyo This congenic strain was established by backcrossing F344-Scn1a^m1Kyo onto WTC/Kyo. National BioResource Project for the Rat in Japan congenic 2314170 F344-Egr/Kyo EGR (Excessive Grooming Rat), Kaikai, Kyo1897 This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant 2314224 F344.OLETF-(D1Rat166-D1Rat90)/2Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. National BioResource Project for the Rat in Japan congenic 2314225 F344-Chr 15^OLETF/Tj Developed by the depositor National BioResource Project for the Rat in Japan consomic 2314226 W-Tg(WSCD2)3Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314227 W-Tg(WSCD2)4Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314228 W-Tg(WSCD2)5Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314229 F344.OLETF-(D7Uwm22-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic 2314230 F344-Hr^Krh/Kyo Hairless Kyoto, Hanako A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant 2314231 F344.OLETF-(D5Mgh5-D5Mgh23)/2Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic 2314232 W-Tg(WSCD2)1Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314243 SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo Developed by the depositor National BioResource Project for the Rat in Japan congenic 2314244 BCR/Nn In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan mutant 2314245 W-Tg(WSCD2)6Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314246 SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo Developed by the Depositor National BioResource Project for the Rat in Japan congenic 2314247 W-Tg(Prl-EGFP)Yamp A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats National BioResource Project for the Rat in Japan transgenic 2314313 NER.F344-(D5Rat100-D5Rat234)/Kyo The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic 2314314 NER.F344-(D1Mgh6-D1Rat132)/Kyo The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic 2314315 F344.NER-(D5Mgh4-D5Rat36)/Kyo The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic 2314316 F344.NER-(D1Mgh6-D1Rat73)/Kyo The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic 2314317 WTC.GRY-Cacna1a^gry/Kyo Developed by the depositor National BioResource Project for the Rat in Japan congenic 2314339 F344-Inadl^{Tn(sb-T2/Bart3)2.343Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2314340 F344-Acoxl^{Tn(sb-T2/Bart3)2.342Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2314341 F344-Auts2^{Tn(sb-T2/Bart3)2.344Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2314342 F344-LOC290704^{Tn(sb-T2/Bart3)2.341Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant 2314360 ACI.F344-(D16Mit5-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2314361 W-Tg(Slc32a1-YFP*)1Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic 2314362 F344-Hrdk/Kyo Hairless dominant Kyoto Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan mutant 2314363 W-Tg(Slc32a1-YFP*)2Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic 2314364 ACI.F344-(D16Nkg112-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic 2314365 KFRS2/Kyo A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan mutant 2314368 F344-Trdk/Kyo Tremor dominant Kyoto Mutant rat that showed tremor was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan mutant 2314375 LE.AR-Ednrb^Sl/Okkm AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). National BioResource Project for the Rat in Japan congenic 2314376 KFRS4/Kyo A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. National BioResource Project for the Rat in Japan mutant 2314377 KFRS3B/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. National BioResource Project for the Rat in Japan mutant 2314378 AR-Ednrb^SlOkkm Aganglionosis rat Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) National BioResource Project for the Rat in Japan mutant 2314379 KFRS6/Kyo A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant 2314380 SD-Tg(CAG-lacZ)541Htsu Developed by the depositor National BioResource Project for the Rat in Japan transgenic 2314381 KFRS5A/Kyo A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant 2314382 SD-Tg(CAG-HRAS*G12V)250Htsu This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter National BioResource Project for the Rat in Japan transgenic 2314383 KFRS3A/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. National BioResource Project for the Rat in Japan mutant 2314396 LCR/Mco Low-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred 2314397 HCR/Mco High-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred 2314414 LEW-Tg(FH1t(Insr)UTG)87Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic 2314415 LEW-Tg(FH1t(Insr)UTG)4Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic 2314477 LEW-RT1^DA/Rrrc Sprague-Dawley RT1^u haplotype backcrossed onto Lewis inbred strain. Rat Resource and Research Center congenic 2314478 LEW-RT1.B^m1Trg/Rrrc RT1.B ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain. Rat Resource and Research Center mutant 2314492 SBN.SBH-(D1Rat148-D1Rat89)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314493 SBH.SBN-(D1Mgh2-D1Rat74)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314494 SBH.SBN-(D1Rat137-D1Rat123)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314495 SBN.SBH-(D1Rat27-D1Mit7)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314496 SBH.SBN-(D1Mgh2-D1Mgh11)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314497 SBN.SBH-(D1Rat101-D1Rat74)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314498 SBH.SBN-(D1Rat137-D1Rat83)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314499 SBN.SBH-(D1Mgh17-D1Mgh14)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314500 SBH.SBN-(D1Mgh2-D1Rat101)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314501 SBH.SBN-(D1Wox11-D1Rat137)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic 2314530 SS.SHR-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their female F₁ were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic 2314531 SHR.SS-(D13Rat1-D13Mgh6)/Mco SS/Jr females were bred with SHR/NHsd males and their male F₁ were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic 2314532 SHR.SS-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their male F₁ were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic 2314655 HsdBlu:BRAT-Avp^di Brattleboro Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan mutant 2314928 Slc:WST Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain. SLC, Japan outbred 2314934 WST.F344-Ker/Kyo Wistar/ST-Boo This congenic strain was established by backcrossing F344-Ker/Kyo (NBRP No.0458) onto Slc:WST National BioResource Project for the Rat in Japan congenic 2314935 WST.F344-Kmch/Kyo Wistar/ST-Komachi This congenic strain was established by backcrossing F344-Kmch/Kyo (NBRP No.0458) onto Slc:WST. National BioResource Project for the Rat in Japan congenic 2314936 W-Tg(WSCD2)Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic 2314937 F344.OLETF-(D5Mgh20-D5Mgh22)/Tj Developed by the depositor National BioResource Project for the Rat in Japan congenic 2316631 F344.GK-(D1Swe8-D1Gpam-1)/Swe This sub-congenic strain is generated from an F₂- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic 2316632 NEDH/KSim New England Deaconess Hospital Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman Simonsen Laboratories inbred 2316633 F344.GK-(D1Got251-D1Gpam-1)/Swe This sub-congenic strain is generated from an F₂- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic 2316653 SS.LEW-(D1Mco102-D1Got46)/Mco A sub-congenic strain derived from SS.LEW-(D1Uia8-D1Rat18)/Mco contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 2316654 SS.LEW-(D1Mco102-D1Mco129)/1Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 2316655 SS.LEW-(D1Mco102-D1Mco129)/2Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 2316925 SHR.BN-(D3Rat159-D3Rat1)/Mco 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic 2316927 SHR.BN-(D6Rat40-D6Rat170)/Mco 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic 2316928 SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele Medical College of Ohio, Toledo, Ohio, USA congenic 2317196 DA.PVG.1AV1-(D8Rat146-D8Got145) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic 2317197 DA.PVG.1AV1-(D8Rat41-D8Rat24) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic 2317201 DA.PVG.1AV1-(D8Rat24-D8Got145) DA.PVG.1AV1-(D8Rat146-D8Got145) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic 2317278 Taiep/Dun These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin mutant 2317590 DA.PVG.1AV1-(D4Rat23-D4Rat108)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317595 DA.PVG.1AV1-(D4Rat23-D4Mit12)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317596 DA.PVG.1AV1-(D4Rat103-D4Mit12)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317598 DA.PVG.1AV1-(D4Rat231-D4Mit12)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317599 DA.PVG.1AV1-(D4Got211-D4Mit12)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317791 DA.PVG.1AV1-(D4Got64)/Kini Subcongenic strain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2317812 AT.ANT-(D1Rat234-D1Rat228)/Rar F₂ males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested University of Colorado Denver, Colorado congenic 2317813 AT.ANT-(D1Rat234-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317814 AT.ANT-(D1Rat273-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317815 AT.ANT-(D1Rat35-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317816 AT.ANT-(D1Rat234-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317817 AT.ANT-(D1Rat183-D1Rat228)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317818 AT.ANT-(D1Rat273-D1Rat228)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317819 AT.ANT-(D1Rat35-D1Rat228)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317820 AT.ANT-(D1Rat158-D1Rat228)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317822 AT.ANT-(D1Rat35-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317825 AT.ANT-(D1Rat234-D1Rat35)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317827 AT.ANT-(D1Rat234-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic 2317891 SHR-Chr 6^MWF/Rkb SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic 2324631 DA.E3-(D4Wox49-D4Got136)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden. congenic 2325143 SHR/NHsdMco Spontaneously Hypertensive Rat SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred 2325145 LEW/CrlMco Lewis These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred 2325146 MNS/NMco Milan normotensive strain These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred 2325202 SS/JrSeac Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo, Ohio to Seac Yoshitomi, LTD Japan Seac Yoshitomi, LTD Japan inbred 2325206 LEW/Seac Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan Seac Yoshitomi, LTD Japan inbred 2325209 SHRSP/Hos Substrain of SHRSP purchased from Sankyo Lab Service, Japan. Sankyo Lab Service, Japan. inbred 2325724 PVG.LEW-(D1Rat270-D1Rat68)/Kini 63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 2325754 SD-Pax6^Sey Autosomal dominant mutation that arose spontaneously in SD rats Department of Ophthalmology, Okayama University Medical School, Okayama, Japan mutant 2325773 WKY.LEW-(D13Arb10-D13Arb15) Segment of interest from chr 16 of LEW/NHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic 2325774 WKY.LEW-(D13Arb10-D13Arb15)(D16Rat88-D16Rat40) WKY.LEW-(D13Arb10-D13Arb15) were crossed with WKY.LEW-(D16Rat88-D16Rat40), the F₁ were backcrossed to WKY.LEW-(D13Arb10-D13Arb15) and then the offsprings were intercrossed Imperial College, London, UK congenic 2325796 SS.LEW-(D3Rat52-D3Chm57)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat130)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic 2325798 SS.LEW-(D10Got112-Igfbp4)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic 2325801 SS.LEW-(D16Chm36-D16Mit2)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 2325803 SS.LEW-(D16Rat112-D16Chm60)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 4107048 SS.SR-(D7Rat16-D7Rat189)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 4107052 SS.SR-(D7Rat16-D7Mgh5)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 4107055 SS.SR-(D7Rat16-D7Rat176)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 4107057 SS.SR-(D7Mco7-D7Rat81)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic 4107063 SS.LEW-(D1Uia8-D1Rat124)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 4107065 SS.LEW-(D1Uia8-D1Rat213)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic 4139872 SS-Nap5^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. PhysGen Knockouts mutant 4139873 SS-Rag1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. PhysGen Knockouts mutant 4139874 SS-Ets1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. PhysGen Knockouts mutant 4139875 FHH-1^BN-Sorcs1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1^BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. PhysGen Knockouts mutant 4139876 SS-Mmp2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts mutant 4139877 FHH.BN-Rab38^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(Rab38)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. PhysGen Knockouts mutant 4139878 SS-Mmp2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant 4139879 SS-Nap5^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. PhysGen Knockouts mutant 4139880 SS-Ren^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. PhysGen Knockouts mutant 4139881 SS-Nap5^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. PhysGen Knockouts mutant 4139882 SS-Nppa^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. PhysGen Knockouts mutant 4139883 SS-Nox4^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant 4139884 SS-Rag1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. PhysGen Knockouts mutant 4139885 SS-Sh2b3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. PhysGen Knockouts mutant 4139889 BHD/Dspe Birt-Hogg-Dube rat A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony in the Dainippon Pharmaceutical Co., Ltd. and named Nihon rat. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan inbred 4139890 TT/Sgn Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. National BioResource Project for the Rat in Japan mutant 4139891 F344-Chr 3^SDT/Nyo This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background. National BioResource Project for the Rat in Japan consomic 4139892 ALD/Hyo acid lipase deficiency rat In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan inbred 4140402 W-Tg(Gh1as)Nibs The construct which contains of rat growth hormone (Gh1) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat Gh1 cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science. National BioResource Project for the Rat in Japan transgenic 4140403 SD-Tg(Eno2-ATXN3*64Q)29Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic 4140404 ODS/ShiJcl Osteogenic disorder Shionagi rat scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc. Tokyo Japan inbred 4140405 LEXF6A/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred 4140406 SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic 4140407 SDT.BN-Gluco13/Nyo The Gluco13 (Gisdt1) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-Gluco14/Nyo (NBRP No. 0602). National BioResource Project for the Rat in Japan congenic 4140408 LEXF8C/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred 4140409 COP-Chr 16^DA/McoRrrc Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background University of Toledo College of Medicine, Toledo, Ohio consomic 4140410 SD-Tg(Eno2-ATXN3*64Q)16Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic 4140411 SDT.BN-Gluco14/Nyo The Gluco14 (Gisdt2) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN- Gluco13/Nyo (NBRP No. 0601). National BioResource Project for the Rat in Japan congenic 4140412 LEXF1D/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred 4140413 LEXF1B/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred 4140414 WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic 4140415 TRMRC/Kyo The coisogenic control strain for the TRMR strain (NBRP No.0016). National BioResource Project for the Rat in Japan coisogenic 4140416 SD-Tg(Eno2-Vcp)16Kakiz This transgenic strain was generated by microinjection into Slc:SD fertilized eggs. National BioResource Project for the Rat in Japan transgenic 4140469 F344-Kmch/NSlc Komachi from NBRP National BioResource Project for the Rat in Japan mutant 4142540 SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142541 W-Tg(Tek-GFP)1Soh This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. National BioResource Project for the Rat in Japan transgenic 4142542 BN.SDT-Gluco14/Nyo The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo. National BioResource Project for the Rat in Japan congenic 4142543 BN.SDT-Gluco13/Nyo The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. National BioResource Project for the Rat in Japan congenic 4142544 WKY/Kiha In 1974, WKY strain was transferred Dr. Okamoto from Kyoto University to. In Department of Pathology, Kinki University School of Medicine, a rat showing higher serum adiponectin concentration was found. National BioResource Project for the Rat in Japan mutant 4142545 SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142546 AMI/Tj Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan mutant 4142547 SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142548 SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142549 SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142550 SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic 4142799 LEW.SS-(D2Uia5-D2Rat143)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 4142800 LEW.SS-(D18Chm31-D18Mit8)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic 4143165 SD-Tg(Aqp5-GFP)ZboroRrrc Aqp5EGFP This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained. Rat Resource and Research Center transgenic 4143456 BN.GK-(D2Wox30-D2Wox68)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 4143457 BN.GK-(D2Rat40-D2Wox35)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 4143458 BN.GK-(D2Wox49-D2Rat70)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 4143459 BN.GK-(D2Rat40-D2Got149)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic 4145088 SS.BN-(D6Rat119-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 4145089 SS.BN-(D6Rat149-D6Rat18)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 4145090 SS.BN-(D6Rat149-D6Got171)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 4145091 SS.BN-(D6Rat149-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic 4889411 SHRSP.WKY-(D1Smu13-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan congenic 4889414 WKY.SHRSP-(D1Rat171-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan congenic 4889450 DA.PVG.1AV1-(D1Rat248-D1Rat10)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 4889464 GK/Ox Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK inbred 4889499 CDS-Chr 4^CDR/Ygl Homozygous male CDS/Ygl were bred with CDR/Ygl females; F₁ heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889817 SBN-Chr 1^SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F₁ heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889820 SBH-Chr 1^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889822 SBN-Chr 17^SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F₁ heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889875 SBH-Chr 2^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889877 SBH-Chr 20^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889879 SBH-Chr X^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889882 SBH-Chr 17^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic 4889890 DA.PVG.1AV1-(D17Rat8-D17Rat37)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic 4891048 SS.LEW-(D7Rat73-D7Rat128)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 4891051 LEW.SS-(D7Rat73-D7Rat128)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic 4891103 WMI/Eer WKY most immobile 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred 4891107 WLI/Eer WKY least immobile 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred 4891165 Wig/Ymas wiggling These are congenic wiggling rats established by transferring the gene from LEC to Wistar King-Aptekman/Hokkaido (WKAH) strain Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan congenic 4891380 SS.SR-(D9Mco95-D9Mco98)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891383 SS.SR-(D9Mco98-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891386 SS.SR-(D9Mco98-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891388 SS.SR-(D9Mco95-D9Mco100)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891390 SS.SR-(D9Mco95-D9Mco100)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891392 SS.SR-(D9Mco95-D9Mco102)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891394 SS.SR-(D9Mco101-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891396 SS.SR-(D9Mco72-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891400 SS.SR-(D9Mco14-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891402 SS.SR-(D9Mco14-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic 4891404 SS.SR-(D9Mco14-Resp18)/3Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic