# RGD-PIPELINE: ftp-file-extracts
# MODULE: strains build 2022-07-07
# GENERATED-ON: 2023/11/25
# PURPOSE: information about active rat strains extracted from RGD database
# CONTACT: rgd.data@mcw.edu
# FORMAT: tab delimited text
# NOTES: multiple values in a single column are separated by ';'
# as of Oct 15, 2021, new columns were added: CITATION_ID, MRATBN_7.2_CHR, MRATBN_7.2_START_POS, MRATBN_7.2_STOP_POS, MRATBN_7.2_METHOD
RGD_ID STRAIN_SYMBOL FULL_NAME ORIGIN SOURCE STRAIN_TYPE LAST_KNOWN_STATUS RESEARCH_USE ALLELES ALLELE_RGD_IDS RGSC_3.4_CHR RGSC_3.4_START_POS RGSC_3.4_STOP_POS RGSC_3.4_METHOD RNOR_5.0_CHR RNOR_5.0_START_POS RNOR_5.0_STOP_POS RNOR_5.0_METHOD RNOR_6.0_CHR RNOR_6.0_START_POS RNOR_6.0_STOP_POS RNOR_6.0_METHOD MRATBN_7.2_CHR MRATBN_7.2_START_POS MRATBN_7.2_STOP_POS MRATBN_7.2_METHOD CITATION_ID
10000 ACI/N A X C 9935, Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR) Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery spontaneous tumors; chronic renal disease; congenital malformations Tnfrsf1a 621237 RRID:RRRC_00142
10001 AVN/Orl Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France. inbred Unknown RRID:RGD_10001
10002 BBDP/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. inbred Unknown RRID:RGD_10002
10003 BBDR/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle. R. H. William Laboratory, University of Washington, Seattle, Washington inbred Unknown RRID:RGD_10003
10004 BC/CpbU Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands. Central Laboratory Animal Institute of Utrecht University, The Netherlands. inbred Unknown RRID:RGD_10004
10005 BDIX/Han unknown unknown inbred Unknown RRID:RGD_10005
10006 BDVII/Cub Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype. Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10006
10008 BN/SsNHsd Obtained by HSD from nucleus colony at NIH Harlan inbred Unknown RRID:RGD_10008
10009 BP/Cub Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10009
10010 BUF/Pit Buffalo inbred Unknown RRID:RGD_10010
10011 COP/OlaHsd These are derived from the original colony which was developed by Dr. W.F. Dunning. Harlan inbred Unknown RRID:RGD_10011
10012 DA/PitN Unknown Unknown inbred Extinct RRID:RRRC_00154
10013 DON/Melb inbred Unknown RRID:RGD_10013
10014 F344/Pit inbred Unknown RRID:RGD_10014
10015 FHH/Eur An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. Erasmus University-Rotterdam inbred Unknown RRID:RGD_10015
10016 GH/Omr Genetically Hypertensive This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. University of Otago Wellcome Med. Res. Inst, New Zealand. inbred Unknown RRID:RGD_10016
10017 GK/KyoSwe Goto Kakizaki Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975). Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden inbred Unknown RRID:RGD_10017
10018 IS/Kyo ishibashi rat Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_10018
10019 LE/Mol Long Evans M & B A/S, Denmark. inbred Unknown RRID:RGD_10019
10020 LEW/Pit Lewis inbred Unknown RRID:RGD_10020
10021 LH/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10021
10022 LN/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10022
10023 LOU/CHan Louvain unknown unknown inbred Unknown RRID:RGD_10023
10024 M520/N To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. NIH Animal Genetic Resource, Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00168
10025 MHS/Gib Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10025
10026 MNR/N Maudsely non-reactive To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00174
10027 MNRA/N To Harrington in 1965 at F25 (Harrington 1981). NIH Animal Genetic Resource inbred Unknown RRID:RGD_10027
10028 MNS/Gib Milan Normotensive Strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10028
10029 MR/Pit As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). inbred Unknown RRID:RGD_10029
10030 NEDH/K Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. Central Institute for Diabetes, Karlsburg, Germany. inbred Unknown RRID:RGD_10030
10031 NP9 From Wistar inbred Unknown RRID:RGD_10031
10032 ODU/N Osaka Dental University From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982). NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00176
10033 OKA/Wsl Professor Herve Bazin, Universite de Louvain, France inbred Unknown RRID:RGD_10033
10034 OM/Ztm Osborne-Mendel unknown unknown inbred Unknown RRID:RGD_10034
10035 P5C inbred Unknown RRID:RGD_10035
10036 PVG/Pit inbred Unknown RRID:RGD_10036
10037 SD/Rij From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984). Harlan Rijswijk inbred Unknown RRID:RGD_10037
10038 SHR/OlaHsd Spontaneously Hypertensive Rat Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10038
10039 SHRSP/Riv Spontaneously Hypertensive Rat, Stroke Prone inbred Unknown RRID:RGD_10039
10040 SR/Jr Salt Resistant Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00056
10041 SS/Jr Salt Sensitive Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982) Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Hmox1 2806 RRID:RRRC_00055
10042 WAG/RijKyo Rij > Kyo (1979, F?, GF) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_10042
10043 WF/Pit Wistar Furth inbred Unknown RRID:RGD_10043
10044 WIST/Nhg Wistar From outbred Wistar stock in 1967. Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany. inbred Unknown Ugt1a1|Abcd2 3935|69244 RRID:RGD_10044
10045 WN/N Inbred Wistar; W/N Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15. NIH Animal Genetic Resource inbred Unknown RRID:RGD_10045
10046 WKY/OlaHsd Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10046
10047 WTC/Kyo WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) RRID:RGD_10047
60984 GH University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). inbred Unknown RRID:RGD_60984
60985 BN BN Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b). Charles River Laboratories inbred Unknown Cd36|Tnfrsf1a 2301|621237 RRID:RGD_60985
60986 BUF/N Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_60986
60987 MHS/N Milan Hypertensive Strain Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Extinct Add1|Add2 2041|2042 RRID:RRRC_00169
60988 LOU/M Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978). inbred Unknown RRID:RGD_60988
60989 BP Strain selected for resistance to Walker 256 tumour. inbred Unknown RRID:RGD_60989
60990 LH/MavRrrc Lyon Hypertensive Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13) RRID:RRRC_00057
60991 LE Long Evans Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984). inbred Unknown RRID:RGD_60991
60992 MNS Milan normotensive strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_60992
60993 FHH Fawn Hooded Hypertensive An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. University of Colorado Health Science Center, Denver, Colorado inbred Unknown RRID:RGD_60993
60994 F344 Fischer Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_60994
60995 DRY Recombinant inbred strain used as normotensive control in studies of hypertension. Sankyo Co., Ltd., Tokyo, Japan inbred Unknown RRID:RGD_60995
60996 DON Donryu rat R. Sato 1950 by inbreeding Japanese albino rats. xx inbred Unknown RRID:RGD_60996
60997 DA DA Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case. inbred Unknown Ednrb|Tnfrsf1a 2536|621237 RRID:RGD_60997
60998 COP This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research. inbred Unknown RRID:RGD_60998
60999 LEW Lewis Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) Harlan Sprague Dawley Inc. Indianapolis, United States inbred Unknown Fgf2|Tnfrsf1a 2609|621237 RRID:RGD_60999
61000 SHR Spontaneously Hypertensive Rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). inbred Unknown Agtr1b|Cd36|Ephx2 2071|2301|620732 RRID:RGD_61000
61001 NEDH Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. inbred Unknown RRID:RGD_61001
61002 BDIX Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_61002
61003 BC Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973. inbred Unknown RRID:RGD_61003
61004 WIST/Zihk From Wistar outbred stock in 1978. inbred Unknown RRID:RGD_61004
61005 OM/N Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61005
61006 PVG PVG Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994). inbred Unknown RRID:RGD_61006
61007 WF Wistar Furth J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995). inbred Unknown RRID:RGD_61007
61008 WAG Wistar Albino Glaxo AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984). inbred Unknown RRID:RGD_61008
61009 AVN Unknown. Keil University from O Stark, Charles University, Prague. inbred Unknown RRID:RGD_61009
61010 SHRSP Spontaneously Hypertensive Rat, Stroke Prone The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994). Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch inbred Unknown RRID:RGD_61010
61011 BB/N BioBreeding rat Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). Unavailable inbred Extinct RRID:RRRC_00144
61013 E3 Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968. inbred Unknown RRID:RGD_61013
61014 OLETF Otsuka Long-Evans Tokushima fatty Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence' Otsuka Research Institute, Tokushima, Japan inbred Unknown RRID:RGD_61014
61015 LN/MavRrrc lyon normotensive (taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00058
61096 SHR/NCruk Spontaneously Hypertensive Rat NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred Unknown RRID:RGD_61096
61097 WKY/NCruk NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred Unknown RRID:RGD_61097
61098 BXH/Ipcv These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_61098
61099 HXB/Ipcv Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. Institute of Physiology, Czech Academy of Sciences, Charles University, Prague recombinant_inbred Unknown RRID:RGD_61099
61100 SHR/Ola Strain originated from an inbred SHR strain from Harlan UK Ltd. Czech Academy of Sciences, Prague, Czech Republic inbred Unknown RRID:RGD_61100
61103 WKY This strain was maintained at Medical College of Ohio, Toledo, Ohio Medical College of Ohio, Toledo, Ohio inbred Unknown Cd36|Nos3 2301|3186 RRID:RGD_61103
61104 LEW/NCrl Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34. Charles River Laboratories USA inbred Unknown RRID:RGD_61104
61105 WKY/NHsd Derived from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. and maintained at Harlan Indianapolis, Indiana U.S.A. EnvigoD8Mit5-D8Mgh6)/Ipcv A segment of chr. 8 is transferred from the normotensive BN-Lx/Cub rat to the SHR/Ola. Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 8 32203394 64762616 1 - by flanking markers 8 33603024 65467051 1 - by flanking markers 8 33558660 65717592 1 - by flanking markers 8 30848154 61290444 1 - by flanking markers RRID:RGD_61106
61107 BB/OK BioBreeding rat This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada. Central Institute for Diabetes, Karlsburg, Germany, National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Diabetes Obesity; Immunology Asns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk5 2162|2280|2332|2481|2794|3082|3726|3807|69430|70514 RRID:RGD_61107
61109 F344/NHsd F344/NHsd Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. Envigo, Envigo aged inbred Unknown RRID:RGD_61109
61110 SHR/Mol Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_61110
61111 DA/Slc dark agouti These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983. National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_61111
61112 13M This is a Leprfa/Leprfa substrain derived from the Zucker rat. Laboratory of Human Behavior and Metabolism, Rockefeller University inbred Unknown RRID:RGD_61112
61113 BN-Lx These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. unknown mutant Unknown RRID:RGD_61113
61114 DA/Bkl Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls. Bantin and Kingman, Fremont, California inbred Unknown RRID:RGD_61114
61115 BN/SsN To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61115
61116 SHRSP/A3 Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan inbred Unknown RRID:RGD_61116
61117 BN-Lx/Cub Brown Norway with polydactyly-luxate These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. Charles University, Department of Biology, Prague inbred Unknown RRID:RGD_61117
61118 BUF/Mna Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer; Urology Bsis 2221 RRID:RGD_61118
61119 WKY/NCrlCrlj Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR strain. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo (as of 2023-05-30) RRID:RGD_61119
61498 BN/NHsdMcwi Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115) PhysGen inbred Live Animals; Cryorecovery RRID:RGD_61498
61499 SS/JrHsdMcwi Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115). PhysGen inbred Live Animals; Cryorecovery RRID:RGD_61499
61517 FHL/Eur Fawn Hooded Low blood pressure An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage Erasmus University-Rotterdam inbred Unknown RRID:RGD_61517
67934 WOKA Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. inbred Unknown RRID:RGD_67934
67935 WOKW Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_67935
67936 WR Sykora, Rosice (Stark et al 1968b). No further infromation. inbred Unknown RRID:RGD_67936
67937 WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986). inbred Unknown RRID:RGD_67937
67938 Y59 Strain developed in Zagreb, Jugoslavia. inbred Unknown RRID:RGD_67938
67939 YA/N No further information. Unavailable inbred Extinct RRID:RRRC_00191
67940 YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992) inbred Unknown RRID:RGD_67940
67941 Z61 Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours. inbred Unknown RRID:RGD_67941
67942 ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989). inbred Unknown RRID:RGD_67942
67943 SHE/N-cp Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94. unknown inbred Unknown RRID:RGD_67943
67945 IS from a cross between a wild male and a Wistar female, with sib mating since 1968. unknown inbred Unknown RRID:RGD_67945
67948 JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984). inbred Unknown RRID:RGD_67948
67957 APR Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred Unknown RRID:RGD_67957
67958 AS Albino Surgery University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973). National Institute for Medical Research, Mill Hill, UK inbred Unknown RRID:RGD_67958
67959 AS2 Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968). inbred Unknown RRID:RGD_67959
67960 AUG Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England. inbred Unknown RRID:RGD_67960
67962 AN Outbred Wistar Imamichi strain. unknown inbred Unknown RRID:RGD_67962
67965 AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976. recombinant_inbred Unknown RRID:RGD_67965
67966 B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85. inbred Unknown RRID:RGD_67966
67967 B/1N No further information. Unknown inbred Extinct RRID:RGD_67967
67971 BBZ Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3 inbred Unknown RRID:RGD_67971
67974 BDE Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring. inbred Unknown RRID:RGD_67974
67975 BDI Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67975
67976 BDII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67976
67977 BDIII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67977
67978 BDIV Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67978
67981 BDV Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67981
67983 BDVI Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67983
67984 BDVII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) inbred Unknown RRID:RGD_67984
67986 BDVIII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown RRID:RGD_67986
67987 BDX Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown Lypd3 69053 RRID:RGD_67987
67988 BEG from a cross between SC and TE. inbred Unknown RRID:RGD_67988
67989 BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973. inbred Unknown RRID:RGD_67989
67990 BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992) inbred Unknown RRID:RGD_67990
67991 BIL/1 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67991
67993 BIL/2 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67993
68000 BIRMB same as BIRMA. inbred Unknown RRID:RGD_68000
68001 BLK/N This strain has an agouti mutation Unknown inbred Extinct Asip 2003 RRID:RGD_68001
68007 BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions. inbred Unknown RRID:RGD_68007
68008 BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966). inbred Unknown RRID:RGD_68008
68011 C No further information. inbred Unknown RRID:RGD_68011
68012 CAP Polish Academy of Sciences, Krakow (Stark et al 1968a). inbred Unknown RRID:RGD_68012
68013 CAR/N Hunt-Hoppert caries resistant; CA/R Hunt 1937, developed for resistance to dental caries (Hunt et al 1955). NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68013
68014 CAS Hunt 1937, developed for high incidence of dental caries. inbred Unknown RRID:RGD_68014
68015 CBH Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded). inbred Unknown RRID:RGD_68015
68018 CPB-WE Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands. inbred Unknown RRID:RGD_68018
68019 CRDH Cohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995). Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_68019
68020 CWS R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open. inbred Unknown RRID:RGD_68020
68022 DB No further information. inbred Unknown RRID:RGD_68022
68023 DEBR Dundee experimental bald rat The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains. inbred Unknown RRID:RGD_68023
68026 DSS/1N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct RRID:RRRC_00155
68027 DSS/2N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct RRID:RRRC_00156
68028 DSS/3N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct RRID:RRRC_00157
68029 DXE-1 Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover) recombinant_inbred Unknown RRID:RGD_68029
68031 ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). Taisho Pharmaceutical Co. Ltd inbred Unknown RRID:RGD_68031
68032 EXBH Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990) inbred Unknown RRID:RGD_68032
68034 F6R Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985). inbred Unknown RRID:RGD_68034
68035 FCH Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol. inbred Unknown RRID:RGD_68035
68036 FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics. inbred Unknown Rab38ru 1600311 RRID:RGD_68036
68038 FHL see FHH. inbred Unknown RRID:RGD_68038
68040 FNL Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH). inbred Unknown RRID:RGD_68040
68041 G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977) inbred Unknown RRID:RGD_68041
68042 GEPR Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a). inbred Unknown RRID:RGD_68042
68044 GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973). inbred Unknown RRID:RGD_68044
68046 HCS Harvard to Liverpool, UK in 1960. inbred Unknown RRID:RGD_68046
68047 HMT Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor". inbred Unknown RRID:RGD_68047
68048 HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus. inbred Unknown RRID:RGD_68048
68049 HXB-1-43/Ipcv Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands recombinant_inbred Unknown RRID:RGD_68049
68050 IIM Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study. inbred Unknown RRID:RGD_68050
68051 INR/N Harrington 1962 from a stock selected by CS Hall for low open field defaecation. Unknown inbred Extinct RRID:RRRC_00160
68052 IR Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981). inbred Unknown RRID:RGD_68052
68057 K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973). inbred Unknown RRID:RGD_68057
68058 KGH/PitN Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). Unknown inbred Extinct RRID:RRRC_00162
68059 KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980). inbred Unknown RRID:RGD_68059
68060 KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977) inbred Unknown RRID:RGD_68060
68061 KYN/Hok Makino, Hokkaido University 1960 from stock the carrying the National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68061
68062 LA/N from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68062
68063 LA/N-cp The corpulent (LA/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_68063
68065 LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993) inbred Unknown RRID:RGD_68065
68066 LEC In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975. inbred Unknown RRID:RGD_68066
68067 LEJ/Hok Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68067
68068 LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980). inbred Unknown Ckb 2357 RRID:RGD_68068
68069 LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980). inbred Unknown RRID:RGD_68069
68070 LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984) inbred Unknown RRID:RGD_68070
68071 LER/N Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology. Unavailable inbred Extinct RRID:RRRC_00164
68072 LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1 inbred Unknown RRID:RGD_68072
68073 LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan inbred Unknown RRID:RGD_68073
68074 LETO THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome. inbred Unknown RRID:RGD_68074
68077 LL/MavRrrc Lyon hypotensive Lyon Low-Tensive. See LH Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00059
68079 LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_68079
68082 LUDW Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU. inbred Unknown RRID:RGD_68082
68083 LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover) recombinant_inbred Unknown RRID:RGD_68083
68084 M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum. inbred Unknown RRID:RGD_68084
68085 M17 AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum. inbred Unknown RRID:RGD_68085
68086 M520 Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992). inbred Unknown RRID:RGD_68086
68087 MAXX From a cross of BNxLEW with subsequent inbreeding. inbred Unknown RRID:RGD_68087
68088 MF Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred Unknown RRID:RGD_68088
68091 MLCS Milan low-calpastatin strain From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy recombinant_inbred Unknown RRID:RGD_68091
68097 MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977). inbred Unknown RRID:RGD_68097
68098 MW Munich Wistar Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS. unknown inbred Unknown RRID:RGD_68098
68099 MWF From outbred Wistar rats selected for large numbers of superficial glomeruli. inbred Unknown RRID:RGD_68099
68100 NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990). inbred Unknown RRID:RGD_68100
68103 NER noda epileptic rat From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has. inbred Unknown RRID:RGD_68103
68104 NIG-III/Hok From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68104
68106 NSD/N NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68106
68107 NZR Subline of AS2 separated at F32. inbred Unknown RRID:RGD_68107
68109 ODUS As for ODU, but maintained at Osaka Dental University. inbred Unknown RRID:RGD_68109
68113 OXYR/Nov Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68113
68114 OXYS/Nov Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68114
68115 P77PMC Wistar rats from Beijing Medical College in 1977. inbred Unknown RRID:RGD_68115
68116 PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction. inbred Unknown RRID:RGD_68116
68117 PETH/N Royal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68117
68118 PKD PKD Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. Central Institute for Laboratory Animal Breeding, Hanover, Germany inbred Unknown RRID:RGD_68118
68119 PSDO/N Reserved symbol for strain in development now at F6 (NIH 1989). Unavailable inbred Extinct RRID:RRRC_00178
68121 R Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R. inbred Unknown RRID:RGD_68121
68122 RCS/N Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline. Unavailable inbred Extinct RRID:RRRC_00180
68123 RHA/N Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68123
68124 RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991). inbred Unknown RRID:RGD_68124
68125 RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991). inbred Unknown RRID:RGD_68125
68126 RLA/N Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains. inbred Unknown RRID:RGD_68126
68127 RP/AEurRij Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). inbred Unknown RRID:RGD_68127
68128 S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating. inbred Unknown RRID:RGD_68128
68129 SBH Sabra hypertensive Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics). Barzilai Medical Center, Ashkelon, Israel inbred Unknown RRID:RGD_68129
68130 SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984). inbred Unknown RRID:RGD_68130
68131 SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360) inbred Unknown RRID:RGD_68131
68133 SDJ/Hok Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Slc2a2 3705 RRID:RGD_68133
68134 SDNK Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan. inbred Unknown RRID:RGD_68134
68136 SEL Dunning 1948. Probably extinct. inbred Unknown RRID:RGD_68136
68137 SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. inbred Unknown Grk2|Grk3 2062|2063 RRID:RGD_68137
68140 SPRD/Hsd Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony. Harlan outbred Unknown RRID:RGD_68140
68143 TA Outbred Wistar Imamichi. inbred Unknown RRID:RGD_68143
68144 TE Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987). inbred Unknown RRID:RGD_68144
68145 TF From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988). inbred Unknown RRID:RGD_68145
68146 THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990). inbred Unknown RRID:RGD_68146
68147 THE/Utp Tsukuba high-emotional rat Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_68147
68148 TLE/Utp Tsukuba low-emotional rat Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior RRID:RGD_68148
68149 TM Tester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication). Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan inbred Unknown RRID:RGD_68149
68150 TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown RRID:RGD_68150
68151 TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown RRID:RGD_68151
68152 TO/Hok Tokyo rat A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68152
68154 TOM Toma Institute, Japan (Ikadai, personal communication, 1991) inbred Unknown RRID:RGD_68154
68155 TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). inbred Unknown RRID:RGD_68155
68156 TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown RRID:RGD_68156
68157 TS3/N Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). Unavailable inbred Extinct RRID:RRRC_00185
68158 TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991). inbred Unknown RRID:RGD_68158
68160 TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991) inbred Unknown RRID:RGD_68160
68161 TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985). inbred Unknown RRID:RGD_68161
68162 TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991) inbred Unknown RRID:RGD_68162
68163 U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990). inbred Unknown RRID:RGD_68163
68164 UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68164
68165 UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68165
68166 W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977). inbred Unknown RRID:RGD_68166
68167 W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany. inbred Unknown RRID:RGD_68167
68168 WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983. inbred Unknown RRID:RGD_68168
68169 WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977). inbred Unknown RRID:RGD_68169
68171 WBB/1N No further information Unavailable inbred Extinct RRID:RRRC_00186
68172 WBB/2N No further information. Unavailable inbred Extinct RRID:RRRC_00187
68173 WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived. inbred Unknown RRID:RGD_68173
68174 WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot. inbred Unknown RRID:RGD_68174
68175 WDF Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus. inbred Unknown RRID:RGD_68175
68176 WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred Unknown RRID:RGD_68176
68177 WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred Unknown RRID:RGD_68177
68178 WELS Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984) inbred Unknown RRID:RGD_68178
68180 WIN WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986). inbred Unknown RRID:RGD_68180
68183 WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992) inbred Unknown RRID:RGD_68183
68184 WKAH/Hok Wistar-King Aptekman Hokkaido King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_68184
68185 WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA. inbred Unknown RRID:RGD_68185
68186 WKHA/N From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. Unavailable inbred Extinct RRID:RRRC_00188
68187 WKHT/N From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). Unavailable inbred Extinct RRID:RRRC_00189
68188 WKS National Institute of Genetics, Mishima, Japan. inbred Unknown RRID:RGD_68188
68189 HTX/Hcj D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30. Department of Pharmacology, University of Florida, Gainesville. inbred Unknown RRID:RGD_68189
69369 SS From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension. Brookhaven National Laboratories, Upton, New York inbred Unknown RRID:RGD_69369
69638 BN/Ka Brown Norway Katholiek (kininogen or kinin deficient) Kitasato University, Kanagawa, Japan. Kitasato University, Kanagawa, Japan. inbred Unknown RRID:RGD_69638
69643 F344/DuCrlCrlj This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Cardio Hypertension RRID:RGD_69643
70410 AA Alko, Alcohol Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70410
70411 ANA Alko, Non-Alcohol Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70411
70413 WBB inbred Unknown RRID:RGD_70413
70416 ACH Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research. inbred Unknown RRID:RGD_70416
70417 A28807/N Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RRRC_00141
70418 A35322 Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990. inbred Unknown RRID:RGD_70418
70419 A7322 Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus. inbred Unknown RRID:RGD_70419
70420 A990 Curtiss 1921 at Columbia University Institute for Cancer Research. inbred Unknown RRID:RGD_70420
70421 AAW Atomic Energy Commission, Melbourne (Adams et al 1984). inbred Unknown RRID:RGD_70421
70422 ABH Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan. Nishimura, Hammatsu University School of Medicine, Japan. inbred Unknown RRID:RGD_70422
70423 ACP Dunning to National Cancer Institute 1967 at F54. inbred Unknown RRID:RGD_70423
70424 AGA Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. inbred Unknown RRID:RGD_70424
70425 AGUS Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26. inbred Unknown RRID:RGD_70425
70426 ALB/N Albany Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70426
70427 AM Torres, Rio de Janeiro, from outbred stock. inbred Unknown RRID:RGD_70427
70428 AMDIL Torres, Rio de Janeiro, from outbred stock inbred Unknown RRID:RGD_70428
70429 AO From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995). inbred Unknown RRID:RGD_70429
70440 BIRMA AM Mandl 1952 from Albino rats purchased from Birmingham market. inbred Unknown RRID:RGD_70440
70446 LIH/Lac Liverpool Hooded "Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981). unknown inbred Unknown RRID:RGD_70446
70447 MNR Maudsely non-reactive PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982). unknown inbred Unknown RRID:RGD_70447
70448 MNRA Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981). inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00692
70449 MR/N Maudsely reactive Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70449
70450 NBR Poiley 1966 from heterogeneous stock inbred Unknown RRID:RGD_70450
70451 OKA From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days. inbred Unknown RRID:RGD_70451
70452 OM Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center outbred Unknown RRID:RGD_70452
70453 SR Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen. inbred Unknown RRID:RGD_70453
70454 WKY/N National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-01) RRID:RRRC_00190
70455 WKYO/Kyo Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_70455
70456 WM Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951. inbred Unknown RRID:RGD_70456
70457 WMS Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF inbred Unknown RRID:RGD_70457
70459 ZDF Vancouver diabetic fatty Zucker "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b). Animal Model Core Facility, University of California at Davis inbred Unknown RRID:RGD_70459
70508 SD Sprague-Dawley This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock. outbred Unknown Aqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f1 2141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892 RRID:RGD_70508
70509 F344/NRrrc Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Sperm Cdkn2a|Gfap|Tnfrsf1a 2323|2679|621237 RRID:RRRC_00158
625624 LETsc2Eker/Hin Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan mutant Unknown Tsc2|Tsc2Eker 3908|12791989 10 13848210 13883189 7 10 13778990 13813725 7 10 13962006 13996684 7 10 13621135 13655773 7 RRID:RGD_625624
625659 DRH/Seac Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_625659
628372 ACI.FHH-(D1Mit34-D1Rat156)/Eur The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI. Animal Research Center of the Erasmus University, Rotterdam, The Netherlands congenic Unknown 1 230963695 253410500 1 - by flanking markers 1 252776360 279213254 1 - by flanking markers 1 245529606 245529710 1 - by flanking markers 1 225126575 225126682 1 - by flanking markers RRID:RGD_628372
628486 NER/Kyo Noda epileptic rat, GMS Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_628486
628525 Ni/Hin Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream Clea Japan Inc. Shiga inbred Unknown RRID:RGD_628525
628907 SHR.BN-RT1n This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. congenic Unknown RRID:RGD_628907
628908 SHR.BN-(D1Mit3-Igf2)/Ipcv Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Igf2|Sa|Scnn1b|Scnn1g 2870|3616|3640|3641 1 146971846 202915231 1 - by flanking markers 1 162692213 222733868 1 - by flanking markers 1 156446196 215839081 1 - by flanking markers 1 144267353 197831802 1 - by flanking markers RRID:RGD_628908
628909 SHR.BN-(D13Arb5-Ren1)/Ipcv Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 13 25430110 64281346 1 - by flanking markers 13 14281836 72173144 1 - by flanking markers 13 9016742 67207219 1 - by flanking markers 13 5994668 62022792 1 - by flanking markers RRID:RGD_628909
629459 ZUC-LeprfaSteJrpz-/- Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology. Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA mutant Unknown RRID:RGD_629459
629462 ZUC-LeprfaSte-/- This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. University of California Davis, Davis, CA mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RRRC_00839
629463 ZUC-Lepr+Ste This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype. University of California Davis, Davis, CA mutant Unknown Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_629463
629464 ZUC-Leprfa This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions. mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RGD_629464
629465 SHR/NCrlCrlj NIH derived strain maintained at the Charles River, Japan. Charles River Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cardio Hypertension RRID:RGD_629465
629481 SHR.WKY-(D1Wox33-D1Got194) This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, France congenic Unknown 1;2 160754901;198300754 208638156;198300855 1 - by flanking markers;1 - by flanking markers 1;2 174300636;224991853 228298222;224991955 1 - by flanking markers;1 - by flanking markers 1 221363524 221363653 1 - by flanking markers 1 203293397 203293528 1 - by flanking markers RRID:RGD_629481
629482 WKY.SHR-(D1Wox19-D1Mit2)/Njs Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY University of Leicester, Leicester, UK congenic Unknown 1 134980526 185691036 1 - by flanking markers 1 204942418 204942572 1 - by flanking markers 1 197963658 197963812 1 - by flanking markers 1 181133855 181134010 1 - by flanking markers RRID:RGD_629482
629484 LEW-tl The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1|Csf1tl 621063|12910954 RRID:RGD_629484
629485 LE/Stm The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_629485
629486 PVG/OlaHsd black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992 Envigo inbred Cryorecovery RRID:RGD_629486
629487 SHR.WKY-(D1Wox19-D1Wox34)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR University of Leicester, Leicester, UK congenic Unknown 1 168382195 185691036 1 - by flanking markers 1 182435050 204942572 1 - by flanking markers 1 175447029 197963812 1 - by flanking markers 1 164747424 181134010 1 - by flanking markers RRID:RGD_629487
629488 SI-Tg(Ednrb)Ywa transgenic spotting lethal A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals. University of Texas Southwestern Medical Center, Dallas, Texas transgenic Unknown Ednrb|Ednrbsl 2536|10755424 RRID:RGD_629488
629489 Eker-Tg(Tsc2)5Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_629489
629490 DA.F344-Aia1/1 genomic segments with region of interest from chr 20 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 20 2790511 32560683 1 - by flanking markers 20 5249981 36993999 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_629490
629491 DA.F344-Aia1/2 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 36592628 85014222 1 - by flanking markers 4 37534124 151090861 1 - by flanking markers 4 37685175 86438507 1 - by flanking markers 4 39505275 85379614 1 - by flanking markers RRID:RGD_629491
629492 Sl Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat. Institute of Animal Reproduction, Omiya, Japan mutant Unknown Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_629492
629493 DA.F344-Aia1/3 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 54879077 54879214 1 - by flanking markers 4 55118586 55118722 1 - by flanking markers 4 55375865 55376001 1 - by flanking markers 4 56698790 56698927 1 - by flanking markers RRID:RGD_629493
629494 DA.F344-Aia1/4 genomic segments with region of interest from chr 10 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_629494
629495 WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Freie Universitdt Berlin, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 177313819 185690396 1 - by flanking markers 1 195736433 204941832 1 - by flanking markers 1 188794419 197963072 1 - by flanking markers 1 173421600 181133270 1 - by flanking markers RRID:RGD_629495
629499 BXS/Ipcv These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. Czechoslovak Academy of Sciences, Prague recombinant_inbred Unknown RRID:RGD_629499
629500 LEXF/Stm Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating. Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred Unknown RRID:RGD_629500
629501 SD-Tg(Ren2)27 This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. Center for Genome Research, University of Edinburgh, UK transgenic Unknown Agtr1b|Ace 2071|2493 RRID:RGD_629501
629502 SHR.BN-(Il6-Npy) This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes MRC Clinical Centre, London, UK congenic Unknown Il6|Npy 2901|3197 4 456799 78045187 1 - by flanking markers 4 3095536 144240956 1 - by flanking markers 4 3043231 79565059 1 - by flanking markers 4 5214602 78888495 1 - by flanking markers RRID:RGD_629502
629503 SHR.BN-(D19Rat57-D19Mit7)/Ipcv The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Agt 2069 19 57234802 57235101 1 - by flanking markers 19 59599823 70892142 1 - by flanking markers 19 48798983 60220581 1 - by flanking markers 19 44306955 55283277 1 - by flanking markers RRID:RGD_629503
629504 WKY.SHR-(D1Mit3-D1Rat57)/Iwai Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 146971846 177313977 1 - by flanking markers 1 162692213 195736590 1 - by flanking markers 1 156446196 188794576 1 - by flanking markers 1 144267353 173421758 1 - by flanking markers RRID:RGD_629504
629505 SS.MNS-(D10Mit11-D10M11Mit119)/Mco fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_629505
629506 LEW-tl.BN-(D2Arb16-D2Wox8) LEW.tl carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1 621063 2 198312439 212776982 1 - by flanking markers 2 225003539 237636701 1 - by flanking markers 2 205572952 219581453 1 - by flanking markers 2 190602746 204499414 1 - by flanking markers RRID:RGD_629506
629509 FHH/EurMcwi An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. PhysGen, Rat Resource and Research Center inbred Live Animals; Cryorecovery RRID:RRRC_00293
629510 SS.BN-(D12Arb13-D12Rat79)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic Live Animals 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_629510
629511 SS-Chr 2BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629511
629512 FHH-Chr 12BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629512
629513 SS-Chr 4BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629513
629514 SS-Chr 6BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629514
629515 SS-Chr 7BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629515
629516 SS-Chr 8BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629516
629517 SS-Chr YBN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629517
629518 SS-Chr 9BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629518
629519 SS.BN-(D13Mgh13-D13Mit4)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic Unknown 13 90551150 90551272 1 - by flanking markers 13 41256240 97381801 1 - by flanking markers 13 36147533 92916783 1 - by flanking markers 13 31241331 86800898 1 - by flanking markers RRID:RGD_629519
629520 FHH-Chr 1BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629520
629521 SS-Chr 11BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629521
629522 SS-Chr 20BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629522
629523 SS-Chr 13BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_629523
629524 SS-Chr 16BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629524
629525 SS-Chr 18BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_629525
629548 SHR.BN-(D1Mit3-Igf2)/1lpcv SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_629548
629578 SS.LEW-(D5Rat130-D5Mco10)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio. congenic Unknown 5 32701659 168174140 1 - by flanking markers 5 36590997 171686754 1 - by flanking markers 5 31926122 168109659 1 - by flanking markers 5 31663789 161481680 1 - by flanking markers RRID:RGD_629578
631158 DXE1/Ztm DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631158
631160 DXE2/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631160
631161 DXE3/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631161
631163 LE/BluGill This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock. University of Illinois at Urbana-Champaign inbred Unknown RRID:RGD_631163
631182 DA/BklArbN This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding. NIH, Arthritis and Rheumatism Branch, Bethesda MD inbred Extinct RRID:RRRC_00091
631219 SDT/Jcl Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. CLEA Japan, Inc inbred Live Animals (as of 2021-04-23) RRID:RGD_631219
631220 SS.LEW-(D10Mco1-D10Mco31)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10 69986912 84284667 1 - by flanking markers 10 68786307 83220224 1 - by flanking markers 10 69123603 83411656 1 - by flanking markers 10 66743655 80537228 1 - by flanking markers RRID:RGD_631220
631275 WKY/Cfd WKY/Cfd Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631275
631276 WKHA/Cfd WKHA/Cfd Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631276
631278 SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Gstm1|Vcam1|S1pr1 2633|2755|3952|61958 2 46542246 210636169 1 - by flanking markers 2 65576721 235592880 1 - by flanking markers 2 46537589 217498710 1 - by flanking markers 2 46123260 202447032 1 - by flanking markers RRID:RGD_631278
631279 SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst 2633 2 46542246 66680209 1 - by flanking markers 2 65576721 86560306 1 - by flanking markers 2 46537589 66828236 1 - by flanking markers 2 46123260 66118463 1 - by flanking markers RRID:RGD_631279
631280 WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Pklr 3336 2 66680022 181223505 1 - by flanking markers 2 86560119 207874394 1 - by flanking markers 2 66828049 188458034 1 - by flanking markers 2 66118275 174551863 1 - by flanking markers RRID:RGD_631280
631281 WKY.SHRSP-(Fst-Pklr)/Gcrc Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Pklr 2633|3336 2 46542246 181223505 1 - by flanking markers 2 65576721 207874394 1 - by flanking markers 2 46537589 188458034 1 - by flanking markers 2 46123260 174551863 1 - by flanking markers RRID:RGD_631281
631282 DA.F344-(D10Arb20-D10Arb22)/Arb This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_631282
631283 DA.F344-(D10Arb21-D10Arb22)/Arb This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 14721135 14721325 1 - by flanking markers 10 14644150 107484761 1 - by flanking markers 10 14827894 107857673 1 - by flanking markers 10 14487011 104060283 1 - by flanking markers RRID:RGD_631283
631285 IER/Ihr A mutant rat strain which is a useful model for human cataract. Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Ophthalmology RRID:RGD_631285
631286 WKY/Izm Wistar-Kyoto WKY strain from the Izumo colony National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_631286
631294 F344.GK-(D1Arb42a-D1Rat90)/Swe This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden congenic Unknown Cyp2c12 2470 1 267110921 267111153 1 - by flanking markers 1 266156838 289137268 1 - by flanking markers 1 258709726 281795785 1 - by flanking markers 1 238699859 259647894 1 - by flanking markers RRID:RGD_631294
631571 SS.LEW-(D1Uia8-D1Mco38)/Jr Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 110818690 110818887 1 - by flanking markers 1 117836211 117836407 1 - by flanking markers 1 116680361 116680557 1 - by flanking markers 1 110159449 110159650 1 - by flanking markers RRID:RGD_631571
631572 SBH/Ygl Sabra hypertension prone Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred Unknown RRID:RGD_631572
631573 SBN/Ygl Sabra hypertension resistant Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred Unknown RRID:RGD_631573
631574 Wild/K Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany. Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany wild Unknown RRID:RGD_631574
631576 LEW/CrlCrlj Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34. Charles River, Atsugi, Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Immunology; Osteosis RRID:RGD_631576
631577 SHR/Izm Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan inbred Live Animals Cardio Hypertension RRID:RGD_631577
631578 SHR.BN-(D2Rat171-D2Arb24)/Ipcv This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic. congenic Unknown 2 116874922 221284686 1 - by flanking markers 2 135770850 248088631 1 - by flanking markers 2 116075644 228737869 1 - by flanking markers 2;9 112456140;67703258 212696837;67703293 1 - by flanking markers;1 - by flanking markers RRID:RGD_631578
631579 LEW/OlaHsd Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands. Harlan France inbred Unknown RRID:RGD_631579
631581 LEW.1F Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1f haplotype into the LEW stock Zentralinstitut fur versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_631581
631582 SS.WKY-(Mme-D2Wox18)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 174727552 1 - by flanking markers 2 173193501 201402094 1 - by flanking markers 2 153799203 181987474 1 - by flanking markers 2 147686913 168355276 1 - by flanking markers RRID:RGD_631582
631583 SS.WKY-(D2Mgh8-D2Mgh9)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_631583
631585 SS.LEW-(D16Mit2-D16Rat12)/Ayd This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_631585
631586 SS.MNS-(D10Mco14-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown 10 45105978 102587587 1 - by flanking markers 10 44914976 101157704 1 - by flanking markers 10 45157430 101482600 1 - by flanking markers 10 43593509 98003205 1 - by flanking markers RRID:RGD_631586
631587 SS.MNS-(D10M11Mit119-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown Ace 2493 10 69986912 102587587 1 - by flanking markers 10 68786307 101157704 1 - by flanking markers 10 69123603 101482600 1 - by flanking markers 10 66743655 98003205 1 - by flanking markers RRID:RGD_631587
631588 SS.MNS-(D10Mit11-Vamp2)/Mco Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 101848683 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_631588
631589 SHR.WKY-(D1Wox34-D1Rat164)/Njs Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 168382195 170218440 1 - by flanking markers 1 182435050 184213712 1 - by flanking markers 1 175447029 177235302 1 - by flanking markers 1 164747424 166533203 1 - by flanking markers RRID:RGD_631589
631590 SHR.WKY-(D1Wox34-Sah)/Njs Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Acsm3 62086 1 168382195 178081751 1 - by flanking markers 1 182435050 196475596 1 - by flanking markers 1 175447029 189541233 1 - by flanking markers 1 164747424 174159966 1 - by flanking markers RRID:RGD_631590
631591 WKY.SHR-(D1Rat56-D1M7Mit206)/Njs Congenic substrain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 172926151 172926455 1 - by flanking markers 1 191393321 191393468 1 - by flanking markers 1 184419946 184420093 1 - by flanking markers 1 169112897 169113045 1 - by flanking markers RRID:RGD_631591
631592 WKY.SHR-(D1Rat236-D1M7Mit206)/Njs Congenic substrain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 155183458 155183662 1 - by flanking markers 1 169098399 169098603 1 - by flanking markers 1 162891429 162891633 1 - by flanking markers 1 152234464 152234669 1 - by flanking markers RRID:RGD_631592
631593 LEW/Rj Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). Hopital Purpan, Toulouse Cedex, France inbred Unknown RRID:RGD_631593
631594 BN/Rj Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, France inbred Unknown RRID:RGD_631594
631595 LEW.1AV1.DA-(D10Rat92-D10Rat135)/Ubc LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain. Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 108776963 1 - by flanking markers 10 77132487 108145987 1 - by flanking markers 10 77269759 108540162 1 - by flanking markers 10 74585846 104670812 1 - by flanking markers RRID:RGD_631595
631596 LEW.1AV1.DA-(D10Rat92-D10Wox17)/Ubc Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2. Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 91168491 1 - by flanking markers 10 77132487 89831596 1 - by flanking markers 10 77269759 90042115 1 - by flanking markers 10 74585846 87055282 1 - by flanking markers RRID:RGD_631596
631597 LEW.1AV1.DA-(D10Wox17-D10Rat135)/Ubc Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic Unknown 10 91168332 108776963 1 - by flanking markers 10 89831438 108145987 1 - by flanking markers 10 90041957 108540162 1 - by flanking markers 10 87055121 104670812 1 - by flanking markers RRID:RGD_631597
631598 LEW.1AV1.DA-(D10Got154-D10Rat135)/Ubc Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic Unknown 10 101532360 108776963 1 - by flanking markers 10 100150192 108145987 1 - by flanking markers 10 100460820 108540162 1 - by flanking markers 10 97010147 104670812 1 - by flanking markers RRID:RGD_631598
631599 SHRSP/Izm Strain has been maintained at Kyoto University. National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension; Neurobiology RRID:RGD_631599
631600 WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany. congenic Unknown Mt1-ps1 3118 1 126938969 185690396 1 - by flanking markers 1 134116233 204941832 1 - by flanking markers 1 133076978 197963072 1 - by flanking markers 1 125611501 181133270 1 - by flanking markers RRID:RGD_631600
631601 WKY.SHRSP-(Asgr1-Vamp2)/Bbb Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki Max-Delbruck Center for Molecular Medicine, Germany congenic Unknown Asgr1|Vamp2 2160|3949 10 55848264 56903173 1 - by flanking markers 10 55418231 56411205 1 - by flanking markers 10 55675171 56666086 1 - by flanking markers 10 53793581 54779642 1 - by flanking markers RRID:RGD_631601
631602 BN/Elh These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony. Department of Surgery and Biochemistry, University of Otago inbred Unknown RRID:RGD_631602
631603 WKY/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631603
631604 SHR/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631604
631605 SS.LEW-(D10Arb9-D10Got101)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic Unknown 10 65068360 77547622 1 - by flanking markers 10 65339106 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_631605
631606 SS.MNS-(D10Rat13-D10Mit11)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic Unknown 10 97152234 101848683 1 - by flanking markers 10 95701164 95701443 1 - by flanking markers 10 95967019 95967298 1 - by flanking markers 10 92698959 92699242 1 - by flanking markers RRID:RGD_631606
631607 SS.WKY-(D2N35-Mme)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 153114515 1 - by flanking markers 2 173193501 173278946 1 - by flanking markers 2 153799203 153880910 1 - by flanking markers 2 147686913 147803808 1 - by flanking markers RRID:RGD_631607
631610 SS.LEW-(D1Rat39-D1Rat131)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 125983422 145648920 1 - by flanking markers 1 133172202 159182239 1 - by flanking markers 1 132134307 152871103 1 - by flanking markers 1 124668437 142990467 1 - by flanking markers RRID:RGD_631610
631691 SHRSP/A3Izm Substrain originates from the SHRSP/Izm strain. Research Institute, International Medical Center of Japan inbred Unknown RRID:RGD_631691
631693 WKY.SHRSP-(Shbg-Atp1b2)/Bbb This strain has the blood pressure locus from chr 10 Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Atp1b2|Shbg 2171|3671 10 56418323 56435654 1 - by flanking markers 10 55951260 55983036 1 - by flanking markers 10 56205622 56237354 1 - by flanking markers 10 54318698 54350409 1 - by flanking markers RRID:RGD_631693
631694 WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 1 126938969 185923619 1 - by flanking markers 1 134116233 205161264 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 1 125611501 125611741 1 - by flanking markers RRID:RGD_631694
631695 SS/JrRkb This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany. inbred Unknown RRID:RGD_631695
631696 SHR/FubRkb Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. Freie Universitat Berlin inbred Unknown RRID:RGD_631696
631697 BBDP/Hri This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Hagedorn Research Institute, Gentofte, Denmark inbred Unknown RRID:RGD_631697
631698 BN/Mol This strain is maintained at the Mollegaard breeding center. Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_631698
631699 BB.SHR-(D6Rat184-D6Rat101)/K Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. University of Greifswald, Germany congenic Unknown 6 121381065 135964844 1 - by flanking markers 6 130448688 144756005 1 - by flanking markers 6 121224054 135658578 1 - by flanking markers 6 116506292 130245370 1 - by flanking markers RRID:RGD_631699
631700 BB.SHR-(Gnal-D18Mit9)/K Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long. Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany congenic Unknown Gnal 2715 18 63595606 80370517 1 - by flanking markers 18 61991738 79748387 1 - by flanking markers 18 62805406 80696375 1 - by flanking markers 18 60622311 77209844 1 - by flanking markers RRID:RGD_631700
631703 SS.LEW-(D10Rat207-D10Mgh1)/Ayd Congenic strain originated from an inbred SS strain Research Centre-CHUM congenic Unknown 10 89896421 89896564 1 - by flanking markers 10 88662536 88662678 1 - by flanking markers 10 88865454 88865596 1 - by flanking markers 10 85887040 85887185 1 - by flanking markers RRID:RGD_631703
631844 Iusm:HAD1 high-alcohol-drinking These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631844
631845 Iusm:LAD1 low-alcohol-drinking These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631845
631846 F344.GK-(D1Mgh10-D1Rat90)/Swe Congenic strain originated from an inbred F344/Mcwi strain Karolinska Institute congenic Unknown 1 204280278 267111153 1 - by flanking markers 1 223910550 289137268 1 - by flanking markers 1 217054291 281795785 1 - by flanking markers 1 199050459 259647894 1 - by flanking markers RRID:RGD_631846
631847 F344.GK-(D1Mit7-D1Mgh25)/Swe Congenic strain originated from an inbred F344 strain Karolinska Institute congenic Unknown 1 235677487 240980321 1 - by flanking markers 1 257430524 262617374 1 - by flanking markers 1 250195095 250195290 1 - by flanking markers 1 229550480 229550676 1 - by flanking markers RRID:RGD_631847
631848 SHR/OlaIpcv These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain. Czech Academy of Sciences, Prague, Czech Republic inbred Unknown Sbf1m1Ipcv 10002755 RRID:RGD_631848
634359 WF.WKY-(D5Pas1-D5Uwm37)/Uwm WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region. University of Wisconsin-Madison congenic Unknown 5 26938679 130527490 1 - by flanking markers 5 30952629 132652105 1 - by flanking markers 5 26251767 128812854 1 - by flanking markers 5 26141669 123935338 1 - by flanking markers RRID:RGD_634359
634363 LEW/NIcoCrlf A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred Unknown RRID:RGD_634363
634364 SHR/NIcoCrlf A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred Unknown RRID:RGD_634364
634365 SS/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634365
634366 SR/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634366
634367 BN/CrlCrlj 1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Ophthalmology; Immunology RRID:RGD_634367
634369 WBN/KobSlc wistar bonn/kobori This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1. National BioResource Project for the Rat in Japan inbred Live Animals Diabetes Obesity; Ophthalmology RRID:RGD_634369
634370 F344.GK-(D1Mgh10-D1Rat119)/Swe GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain. Karolinska Institute congenic Unknown 1 204280278 242586311 1 - by flanking markers 1 223910550 264429516 1 - by flanking markers 1 217054291 256949019 1 - by flanking markers 1 199050459 236036450 1 - by flanking markers RRID:RGD_634370
634372 GHS SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain. Department of Medicine and Physiology, University of Rochester, Rochester, New York inbred Unknown RRID:RGD_634372
634373 DA/ZtmRhd DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634373
634374 E3/ZtmRhd E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634374
634376 LEA/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_634376
634377 BN/Sea BN/Sea This inbred strain was obtained from Sea life Supply Sea Life Supply, Sand City, CA Sea Life Supply inbred Unknown RRID:RGD_634377
634380 iP/Iusm inbred alcohol-preferring These were inbred alcohol-preferring rats developed from outbred alcohol-preferring rats (Iusm:P) at generation 30 at Indiana University for high-alcohol-preferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634380
634381 iNP/Iusm alcohol-nonpreferring These were inbred alcohol-nonpreferring rats developed from outbred alcohol-nonpreferring rats (Iusm:NP) at generation 30 at Indiana University for high-alcohol-nonpreferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634381
634382 SHR.BN-(D5Wox12-D5Wox20)/Ipcv This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 5 147065698 147065912 1 - by flanking markers 5 149494416 149494629 1 - by flanking markers 5 145726049 145726262 1 - by flanking markers 5 139989554 139989768 1 - by flanking markers RRID:RGD_634382
634743 BIL University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_634743
724569 MWF/FubRkb Munich Wistar Fromter The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm). Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724569
724570 LEW/Rkb The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany. Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724570
724571 MITE/Mna This strain was established from captured Japanese wild rats. Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan inbred Unknown RRID:RGD_724571
724572 SS.LEW-(D10Wox51-D10Rat27)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 71294871 77092169 1 - by flanking markers 10 70062921 74127968 1 - by flanking markers 10 70428844 75983805 1 - by flanking markers 10 68011827 73453136 1 - by flanking markers RRID:RGD_724572
724573 SS/JrTol Dahl salt-sensitive (SS/Jr) rats In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet. Housed at the University of Toledo College of Medicine and Life Sciences. inbred Live Animals (as of 2021-06-08) RRID:RGD_724573
724574 SHR/NHsd SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) Envigo inbred Unknown RRID:RGD_724574
724575 SS.LEW-(D10Rat17-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 95066219 95066632 1 - by flanking markers 10 93641751 93641934 1 - by flanking markers 10 93886117 93886300 1 - by flanking markers 10 90627439 90627625 1 - by flanking markers RRID:RGD_724575
724576 KDP/Tky Komeda diabetes-prone rat This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_724576
724577 SS.LEW-(D10Rat27-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 77091834 87834315 1 - by flanking markers 10 74127825 86759484 1 - by flanking markers 10 75983662 86962563 1 - by flanking markers 10 73452992 84007272 1 - by flanking markers RRID:RGD_724577
728133 BN-RT1n/Rj This coisogenic strain was produced by selecting BN rats with the RT1n allele. The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728133
728134 SS.LEW-(D1Rat35-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 157498254 1 - by flanking markers 1 131958920 171330794 1 - by flanking markers 1 130917121 165129939 1 - by flanking markers 1 123479780 154464242 1 - by flanking markers RRID:RGD_728134
728135 SS.LEW-(D5Uwm14-D5Uwm31)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 48908533 48908825 1 - by flanking markers 5 52440414 52440705 1 - by flanking markers 5 47842131 47842422 1 - by flanking markers 5 47002982 47003274 1 - by flanking markers RRID:RGD_728135
728137 SS.LEW-(D10Rat141-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 19 38295381 38295550 1 - by flanking markers 19 51402312 51402480 1 - by flanking markers 10;19 91548145;40571888 91548388;40572056 1 - by flanking markers;1 - by flanking markers 19 36511450 36511619 1 - by flanking markers RRID:RGD_728137
728138 SS.MNS-(Mme-Gca)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme|Npr1 2167|3098|3195 2 153031724 182740242 1 - by flanking markers 2 173193501 209287892 1 - by flanking markers 2 153799203 189857032 1 - by flanking markers 2 147686913 175950118 1 - by flanking markers RRID:RGD_728138
728139 WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown RRID:RGD_728139
728140 SS.LEW-(D10Rat11-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10;19 100633512;38295381 100633982;38295550 1 - by flanking markers;1 - by flanking markers 10;19 99184058;51402312 99184250;51402480 1 - by flanking markers;1 - by flanking markers 10;19 99492217;40571888 99492409;40572056 1 - by flanking markers;1 - by flanking markers 10;19 96120911;36511450 96121100;36511619 1 - by flanking markers;1 - by flanking markers RRID:RGD_728140
728142 BN.SHR-(Il6-Cd36)/Cub This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Cd36|Il6 2301|2901 4 456799 13554416 1 - by flanking markers 4 3095536 14166434 1 - by flanking markers 4 3043231 14191498 1 - by flanking markers 4 5214602 17410084 1 - by flanking markers RRID:RGD_728142
728143 SS.LEW-(D1Mco38-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 110818690 157498254 1 - by flanking markers 1 117836211 171330794 1 - by flanking markers 1 116680361 165129939 1 - by flanking markers 1 110159449 154464242 1 - by flanking markers RRID:RGD_728143
728144 BN.PD-(D8Rat39-D8Rat35)/Cub This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 8 49035642 64617259 1 - by flanking markers 8 48981076 65325374 1 - by flanking markers 8 50356432 50356607 1 - by flanking markers 8 46358478 46358654 1 - by flanking markers RRID:RGD_728144
728145 SS.LEW-(D5Rat130-D5Rat108)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_728145
728146 F344.BN-(D3Mgh13-D3Mgh7)/Dlw This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 3 112319451 112319585 1 - by flanking markers 3 11139240 123812293 1 - by flanking markers 3 5775856 117288411 1 - by flanking markers 3 10549351 112272465 1 - by flanking markers RRID:RGD_728146
728147 BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_728147
728148 SS.LEW-(D16Uia2-D16Rat12)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_728148
728151 UPL/Ncc The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony. Hiroshima University, School of Medicine, Hiroshima, Japan inbred Unknown RRID:RGD_728151
728152 SS.LEW-(D1Rat196-D1Mgh7)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 106445306 1 - by flanking markers 1 59282428 114601028 1 - by flanking markers 1 58354072 113593716 1 - by flanking markers 1 57336763 106047988 1 - by flanking markers RRID:RGD_728152
728153 SS.LEW-(D1Rat196-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 157498254 1 - by flanking markers 1 59282428 171330794 1 - by flanking markers 1 58354072 165129939 1 - by flanking markers 1 57336763 154464242 1 - by flanking markers RRID:RGD_728153
728155 BBDR.BBDP-(D4Mit6-D4Mit7)/1Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_728155
728156 SS.LEW-(D5Mco34-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 168173895 168174140 1 - by flanking markers 5 171686510 171686754 1 - by flanking markers 5 168109415 168109659 1 - by flanking markers 5 161481433 161481680 1 - by flanking markers RRID:RGD_728156
728157 SS.LEW-(D5Rat130-D5Mit19)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 140744137 1 - by flanking markers 5 36590997 142892672 1 - by flanking markers 5 31926122 139102349 1 - by flanking markers 5 31663789 133752767 1 - by flanking markers RRID:RGD_728157
728158 SS.LEW-(D5Uia4-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 144865363 168174140 1 - by flanking markers 5 147288554 171686754 1 - by flanking markers 5 143523348 168109659 1 - by flanking markers 5 137790781 161481680 1 - by flanking markers RRID:RGD_728158
728159 SS.LEW-(D1Mco36-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 146189942 1 - by flanking markers 1 131958920 160138947 1 - by flanking markers 1 130917121 153834227 1 - by flanking markers 1 123479780 143506731 1 - by flanking markers RRID:RGD_728159
728161 PD/Cub polydactylous Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred Unknown RRID:RGD_728161
728162 SS.LEW-(D1Mco87-D1Rat71)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 145648742 206567907 1 - by flanking markers 1 159182062 226102807 1 - by flanking markers 1 152870926 219232156 1 - by flanking markers 1 142990289 201278233 1 - by flanking markers RRID:RGD_728162
728163 SS.LEW-(D1Uia2-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_728163
728165 SS.LEW-(D1Rat196-D1Mco36)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 122992360 1 - by flanking markers 1 59282428 130268180 1 - by flanking markers 1 58354072 129209407 1 - by flanking markers 1 57336763 121834139 1 - by flanking markers RRID:RGD_728165
728166 WKY.SHRSP-(D1Rat112-D1Wox29)/Izm A segment from SHRSP/Izm was transferred on a WKY/Izm background Shimane Medical University, Izumo, Japan congenic Unknown 1 124614679 206574346 1 - by flanking markers 1 131822204 226109267 1 - by flanking markers 1 130779148 219238616 1 - by flanking markers 1 123350408 201284693 1 - by flanking markers RRID:RGD_728166
728167 SS.LEW-(Nos2-D10M11Mit119)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Nos2 3185 10 65036884 65072453 1 - by flanking markers 10 65423626 65456957 1 - by flanking markers 10 66188290 66221621 1 - by flanking markers 10 63815308 63851208 1 - by flanking markers RRID:RGD_728167
728168 WOK The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany Diabetes Research Center, Karlsberg, Germany inbred Unknown RRID:RGD_728168
728170 SS.MNS-(Mme-D2Mit14)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme 2167|3098 2 153031724 197256313 1 - by flanking markers 2 173193501 224018437 1 - by flanking markers 2 153799203 204585731 1 - by flanking markers 2 147686913 189599348 1 - by flanking markers RRID:RGD_728170
728171 LEW-RT11/Rj This coisogenic strain was produced by selecting LEW rats with the RT11 allele. The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728171
728172 SS.MNS-(D2Mit6-Adh1)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Adh1c|Agtr1b|Atp1a1 2044|2071|2167 2 77630629 235811584 1 - by flanking markers 2 98037122 262102977 1 - by flanking markers 2 78321410 243562243 1 - by flanking markers 2 76539322 226808892 1 - by flanking markers RRID:RGD_728172
728183 WF/N To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_728183
728184 SHRSP/A3N To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517) NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-04-21) RRID:RGD_728184
728185 N:NIH Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. Unavailable outbred Extinct RRID:RRRC_00237
728186 LEW/SsN To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728186
728187 ACI/N-j Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728187
728188 LOU/MN To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-09-04) RRID:RGD_728188
728189 SHR/N-di Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728189
728190 RCS-rdy-c Albino retinal dystrophy This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728190
728191 LOU/CN To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728191
728192 RCS-rdy-p This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728192
728193 N:SD Sprague-Dawley To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred Extinct RRID:RRRC_00239
728194 SHR/N To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728194
728195 SHR/N-cp The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis. Rat Resource and Research Center congenic Cryopreserved Embryo (as of 2021-01-20) RRID:RRRC_00231
728196 RHA/N-j Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728196
728197 RCS-rdy-+ This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728197
728198 BHE/N Bureau of Home Economics To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728198
728199 RHA Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728199
728200 ACI/N-di Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728200
728358 SB This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear. R. Kalman, Authority for Animal Facilities outbred Unknown RRID:RGD_728358
728383 UPL/Cas Upjohn Pharmaceuticals Limited In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating. National BioResource Project for the Rat in Japan inbred Unknown Gja8m1Cas 13524999 RRID:RGD_728383
728384 SS.LEW-(D10Rat24-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79229067 87834315 1 - by flanking markers 10 78194957 86759484 1 - by flanking markers 10 78343027 86962563 1 - by flanking markers 10 75631887 84007272 1 - by flanking markers RRID:RGD_728384
728385 WF.COP-(D2Rat2-D2M13Mit286)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 14747814 14747981 1 - by flanking markers 2 14095321 14095488 1 - by flanking markers 2 14237830 14237997 1 - by flanking markers 2 16491740 16491908 1 - by flanking markers RRID:RGD_728385
728386 SS.LEW-(D10Rat119-D10Rat133)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 65668639 1 - by flanking markers 10 53273326 64823355 1 - by flanking markers RRID:RGD_728386
728387 WF.COP-(D2Mit29-D2Uwm13)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 11957973 1 - by flanking markers 2 5396621 11387756 1 - by flanking markers 2 5417336 11522696 1 - by flanking markers 2 7887772 13840758 1 - by flanking markers RRID:RGD_728387
728388 SS.LEW-(D10Rat119-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 53675478 1 - by flanking markers 10 53273326 53273444 1 - by flanking markers RRID:RGD_728388
728389 WF.COP-(D2Mit29-D2Rat201)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 49691646 1 - by flanking markers 2 5396621 68633866 1 - by flanking markers 2 5417336 50260392 1 - by flanking markers 2 7887772 49657252 1 - by flanking markers RRID:RGD_728389
728391 WF.COP-(D2Rat253-D2Uwm17)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 25663274 32051637 1 - by flanking markers 2 44171519 50382003 1 - by flanking markers 2 25012974 31224929 1 - by flanking markers 2 26559817 32374088 1 - by flanking markers RRID:RGD_728391
728392 RHA/N-di Roman high avoidance-di mutation Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728392
728393 SS.LEW-(D10Got125-D10Rat120)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 86983905 92373412 1 - by flanking markers 10 85965754 91041690 1 - by flanking markers 10 86168841 91270722 1 - by flanking markers 10 83212828 88132643 1 - by flanking markers RRID:RGD_728393
728394 SS.LEW-(D10Rat55-D10Rat13)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 97152587 1 - by flanking markers 10 87933406 95701443 1 - by flanking markers 10 88140923 95967298 1 - by flanking markers 10 85160679 92699242 1 - by flanking markers RRID:RGD_728394
728395 SS.LEW-(D10Rat55-D10Rat120)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 92373412 1 - by flanking markers 10 87933406 91041690 1 - by flanking markers 10 88140923 91270722 1 - by flanking markers 10 85160679 88132643 1 - by flanking markers RRID:RGD_728395
728396 SS.LEW-(D10Mco15-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 98392296 98392508 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_728396
731185 MWF/Fub Munich Wistar Fromter Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731185
731186 SHR/Fub Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731186
731187 Iusm:HAD2 high-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731187
731188 Iusm:LAD2 low-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731188
731189 SHRSP.WKY-(Klk1-D1Rat116)/Izm A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan congenic Unknown RRID:RGD_731189
731190 SS.LEW-(D1Rat211-D1Rat18)/Mco A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17;1 1147796;43747374 1148037;43747532 1 - by flanking markers;1 - by flanking markers 1 35077728 50297622 1 - by flanking markers 1 33667777 49454378 1 - by flanking markers 1 31050840 49268520 1 - by flanking markers RRID:RGD_731190
731191 SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_731191
731192 SS.LEW-(D3Rat52-D3Rat130)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 44551542 1 - by flanking markers 3 19410399 55227748 1 - by flanking markers 3 14090411 48562146 1 - by flanking markers 3 18311454 47233430 1 - by flanking markers RRID:RGD_731192
731193 DA.PVG-(D4Rat141-D4Mgh11) PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 151158666 171204531 1 - by flanking markers 4 210231569 230565226 1 - by flanking markers 4 146942075 168047091 1 - by flanking markers 4 148090542 167139601 1 - by flanking markers RRID:RGD_731193
731194 SS.LEW-(D3Chm64-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 52127226 121619110 1 - by flanking markers 3 62850379 133513825 1 - by flanking markers 3 56217734 127023997 1 - by flanking markers 3 54740735 121056321 1 - by flanking markers RRID:RGD_731194
731195 DA.E3-(D14Wox8-D14Rat64)/Rhd The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. Medical Inflammation Research, BMC, University of Lund, Lund, Sweden congenic Unknown 14 68573958 68574165 1 - by flanking markers 14 67969510 67969716 1 - by flanking markers 14 67944692 67944898 1 - by flanking markers 14 63618971 63619178 1 - by flanking markers RRID:RGD_731195
734471 SS.LEW-(D1Mgh7-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 106445165 227693454 1 - by flanking markers 1 114600888 249451438 1 - by flanking markers 1 113593576 242177304 1 - by flanking markers 1 106047847 221920075 1 - by flanking markers RRID:RGD_734471
734472 SS.LEW-(D1Mco2-D1Wox6)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 131956599 131956825 1 - by flanking markers 1 58687835 138778112 1 - by flanking markers 1 57761120 137787460 1 - by flanking markers 1 56732484 56732668 1 - by flanking markers RRID:RGD_734472
734473 SS.LEW-(D17Mco3-D17Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 17 28967455 70289318 1 - by flanking markers 17 24748228 66699053 1 - by flanking markers 17 22774867 64946465 1 - by flanking markers 17 23080368 59555289 1 - by flanking markers RRID:RGD_734473
734474 SS.LEW-(D5Mit9-D5Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 62555131 168174140 1 - by flanking markers 5 66128197 171686754 1 - by flanking markers 5 61612600 168109659 1 - by flanking markers 5 60293434 161481680 1 - by flanking markers RRID:RGD_734474
734475 DA/OlaHsd Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965. Envigo inbred Unknown RRID:RGD_734475
734476 Crl:CD(SD) Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. Charles River Laboratories outbred Unknown RRID:RGD_734476
734478 F344/DuCrl This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960. Charles River Laboratories inbred Unknown RRID:RGD_734478
734479 SS.LEW-(D1Mco2-D1Rat49)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 58687835 171330794 1 - by flanking markers 1 57761120 165129939 1 - by flanking markers 1 56732484 154464242 1 - by flanking markers RRID:RGD_734479
734480 SS.LEW-(D10Mit10-D10Mgh1)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 102587587 1 - by flanking markers 10 27082535 101157704 1 - by flanking markers 10 27237530 101482600 1 - by flanking markers 10 26521957 98003205 1 - by flanking markers RRID:RGD_734480
734481 SS.LEW-(D1Mco2-D1Mco35)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 238358625 238358813 1 - by flanking markers 1 58687835 259930393 1 - by flanking markers 1 57761120 252708858 1 - by flanking markers 1 56732484 231916666 1 - by flanking markers RRID:RGD_734481
734482 SS.LEW-(D1Rat45-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 146189650 227693454 1 - by flanking markers 1 160138797 249451438 1 - by flanking markers 1 153834077 242177304 1 - by flanking markers 1 143506580 221920075 1 - by flanking markers RRID:RGD_734482
734483 SS.LEW-(D1Rat42-D1Wox10)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 135418152 220639653 1 - by flanking markers 1 142342107 244066407 1 - by flanking markers 1 141381406 236763528 1 - by flanking markers 1 133587283 214537671 1 - by flanking markers RRID:RGD_734483
734526 OLETF/Got Otsuka Long Evans Tokushima Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan inbred Unknown RRID:RGD_734526
734527 OLETF.F344-(D1Rat169-D1Rat459)/Got Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 229876870 267593558 1 - by flanking markers 1 251652807 289700417 1 - by flanking markers 1 244401175 282365384 1 - by flanking markers 1 224054293 260122809 1 - by flanking markers RRID:RGD_734527
734528 OLETF.BN-(D1Rat76-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 230411091 267593558 1 - by flanking markers 1 252243728 289700417 1 - by flanking markers 1 244992467 282365384 1 - by flanking markers 1 224569538 260122809 1 - by flanking markers RRID:RGD_734528
734531 OLETF.F344-(D1Rat306-D1Rat461)/Got Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 248583506 266234812 1 - by flanking markers 1 268967725 288207792 1 - by flanking markers 1 280850604 280850810 1 - by flanking markers 1 258843780 258843987 1 - by flanking markers RRID:RGD_734531
734758 DA/Ham Dark-agouti Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). Shizuoka Laboratory Animal Center Hamamatsu, Japan inbred Unknown RRID:RGD_734758
734759 SHRSP/Gcrc Spontaneously hypertensive rat, stroke prone SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734759
734760 WKY/Gcrc Wistar-Kyoto WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734760
734761 WF/Kga Wistar-Furth Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan). Kagoshima University Dental School, Kagoshima, Japan inbred Unknown RRID:RGD_734761
737657 LEW.1AV1 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. National Veterinary Institute, Uppsala, Sweden congenic Extinct RRID:RRRC_00201
737658 PVG.1AV1 Piebald-Virol-Glaxo Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany Harlan UK, Blackthorn, Bicester, UK congenic Unknown RRID:RGD_737658
737690 F344/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River, Calco, Italy inbred Unknown RRID:RGD_737690
737691 BN/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River Laboratories Italy inbred Unknown RRID:RGD_737691
737703 LEW-Tg(HLA-B*0702,B2M)120-4TrgTg/Tg Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08) RRID:RRRC_00042
737857 DA.PVG.1AV1-(D4Rat155-D4Rat84) Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 185398415 185398530 1 - by flanking markers 4 47848402 246313537 1 - by flanking markers 4 48053950 182171018 1 - by flanking markers 4 49524674 180699135 1 - by flanking markers RRID:RGD_737857
737858 DA.PVG.1AV1-(D4Rat155-Spr) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown Spr 3753 4 119365578 119369308 1 - by flanking markers 4 47848402 181496612 1 - by flanking markers 4 48053950 116916073 1 - by flanking markers 4 49524674 117676292 1 - by flanking markers RRID:RGD_737858
737859 DA.PVG.1AV1-(D4Mgh17-D4Rat56) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 116611031 143663540 1 - by flanking markers 4 177782842 204673386 1 - by flanking markers 4 113100978 113247809 1 - by flanking markers 4 114921280 114921417 1 - by flanking markers RRID:RGD_737859
737861 DA.PVG.1AV1-(D4Rat63-D4Rat203) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 4 153274175 158112799 1 - by flanking markers RRID:RGD_737861
737862 SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737862
737863 SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP University of Glasgow, Glasgow, UK congenic Unknown Gstm1 2755 2 141259937 210636169 1 - by flanking markers 2 161271919 235592880 1 - by flanking markers 2 141583337 217498710 1 - by flanking markers 2 136445150 202447032 1 - by flanking markers RRID:RGD_737863
737864 SS.SR-(D13Mit9-D13Mit1)/Jr Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain. J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic Unknown 13 25430110 55033994 1 - by flanking markers 13 14281836 63533335 1 - by flanking markers 13 9016742 58537177 1 - by flanking markers 13 5994668 53050594 1 - by flanking markers RRID:RGD_737864
737865 WKY.SHRSP-(D2Rat14-D2Mgh12) A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_737865
737866 WKY.SHRSP-(D2Rat14-D2Mit5) A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737866
737867 SS.SR-(D13N1-D13Mit1)/Jr Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 13 25430110 38985930 1 - by flanking markers 13 14281836 48881269 1 - by flanking markers 13 9016742 43785939 1 - by flanking markers 13 5994668 37902821 1 - by flanking markers RRID:RGD_737867
737868 SS.SR-(Syt2-D13Mit1)/Jr Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Syt2 3804 13 25430110 47699094 1 - by flanking markers 13 14281836 56630530 1 - by flanking markers 13 9016742 51577824 1 - by flanking markers 13 5994668 46197976 1 - by flanking markers RRID:RGD_737868
737869 OLETF.BN-(D1Rat461-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 266234605 267593558 1 - by flanking markers 1 288207586 289700417 1 - by flanking markers 1 280850604 282365384 1 - by flanking markers 1 258843780 260122809 1 - by flanking markers RRID:RGD_737869
737870 DA.E3-(D20Wox3-D20Mgh4)/Rhd A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 3660646 6880472 1 - by flanking markers 20 6935875 7910747 1 - by flanking markers 20 4855475 5875448 1 - by flanking markers 20 3621656 6691706 1 - by flanking markers RRID:RGD_737870
737871 DA.E3-(D12Got46-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23362298 23845733 1 - by flanking markers 12 27316608 30964880 1 - by flanking markers 12 25307118 29014362 1 - by flanking markers 12 22297209 22692658 1 - by flanking markers RRID:RGD_737871
737872 DA.E3-(D4Mit16-D4Mgh11)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 4 130228504 171204531 1 - by flanking markers 4 192286223 230565226 1 - by flanking markers 4 127777294 168047091 1 - by flanking markers 4 128289450 167139601 1 - by flanking markers RRID:RGD_737872
737873 DA.E3-(D6Wox5-D6Rat90)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6 117361909 117362003 1 - by flanking markers 6 126582753 126582846 1 - by flanking markers 6 117355600 117355693 1 - by flanking markers 6 112636280 112636374 1 - by flanking markers RRID:RGD_737873
737885 RHA/Kun Roman high avoidance Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands inbred Unknown RRID:RGD_737885
737886 BDX/Cub Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737886
737887 AO/OlaHsd These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Envigo inbred Cryorecovery RRID:RGD_737887
737888 LEW/NHsdCpb These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737888
737889 LEW/Ipcv These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands unknown inbred Unknown RRID:RGD_737889
737891 Crl:SD Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory. Charles River Laboratories, Inc., Wilmington, MA outbred Unknown RRID:RGD_737891
737892 ACI/SegHsd This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc. Envigo inbred Unknown Carcinogenesis; Estrogen-induced pituitary growth; Transplant immunology RRID:RGD_737892
737893 F344/Ztm Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737893
737894 LEW/Orl Substrain of Lewis rats, maintained in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737894
737895 WKY/Ztm Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737895
737896 BN/Maas Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737896
737897 ACI/Kun Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737897
737898 WOKA/K Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany inbred Unknown RRID:RGD_737898
737899 BN/Cub Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737899
737900 WF/Ztm Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737900
737901 LH/Ztu A substrain of LH unknown inbred Unknown RRID:RGD_737901
737902 BDIX/Orl Substrain of BDIX, now maintained in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737902
737903 Hsd:SD Sprague Dawley Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony. Envigo outbred Unknown RRID:RGD_737903
737904 U/A Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737904
737905 LEW/Maas Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. University of Limburg, Netherlands inbred Unknown RRID:RGD_737905
737906 MWF/Hsd Munich Wistar Fromter Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley Harlan inbred Unknown (as of 2020-04-03) RRID:RGD_737906
737907 SS.SR-Inha/Jr A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA congenic Unknown RRID:RGD_737907
737908 WF/NHsd Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley. Envigo inbred Cryopreserved Embryo (as of 2022-03-24) RRID:RGD_737908
737909 R/A Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737909
737910 ARISTORAT/Wsl Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737910
737911 BUF/Ztm Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737911
737912 SS/JrIpcv strain originated from Dr. John P. Rapp, Medical College of Ohio, USA Czech Academy of Sciences inbred Unknown RRID:RGD_737912
737913 E3/Ztm Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737913
737914 SDL/Ipcv Substrain of SDL unknown inbred Unknown RRID:RGD_737914
737915 R/AWa Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dept of Genetics, Agricultural University, Wageningen, The Netherlands inbred Unknown RRID:RGD_737915
737916 DZB/Gro Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737916
737917 WF/Mol Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737917
737918 BN/Orl Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737918
737919 LEW/Han Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737919
737920 BH/Ztm Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737920
737921 BDIV/lfz Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971) unknown inbred Unknown RRID:RGD_737921
737922 LEW/SsNHsd Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015. ENVIGO inbred Unknown RRID:RGD_737922
737923 SHR/Maas Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737923
737924 WAG/Rij Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979 Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737924
737925 BN/Gro Substrain of BN, from Billingham and Silvers 1958, to U of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737925
737926 F344/NCrl Derived from NIH stock in 1992 by SASCO. To Charles River in 1996. Charles River Laboratories inbred Unknown RRID:RGD_737926
737927 ALC/Colle Substrain of ALC unknown inbred Unknown RRID:RGD_737927
737928 BN/NHsdCpb Substrain of BN, from Billingham and Silvers 1958 Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737928
737929 Crl:WI Wistar rats To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis. Charles River Laboratories outbred Unknown RRID:RGD_737929
737930 LEW/Ztm LEW/Ztm This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany Tierlaboratorium der Medizinischen Hochschule Hannover, Germany inbred Unknown Ncf1 61307 RRID:RGD_737930
737931 GC/Kun inbred Unknown RRID:RGD_737931
737932 LEW/Crl Lewis Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34. Charles River Laboratories inbred Unknown RRID:RGD_737932
737933 SD/A Sprague-Dawley stock initiated by R. Dawley in 1925 The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737933
737934 BN/RijKun Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737934
737935 LEW/Nhg Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany inbred Unknown RRID:RGD_737935
737936 SR/JrIpcv Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962) Baylor College of Medicine, Houston, TX inbred Unknown RRID:RGD_737936
737937 SDH/Ztu unknown unknown inbred Unknown RRID:RGD_737937
737938 AUG/OlaHsd Substrain of AUG, derived from US August substrains in 1951 Envigo inbred Cryorecovery RRID:RGD_737938
737939 BBWB/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737939
737940 PAR/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737940
737941 LEP/Cub Substrain of LEP, from Charles University cross of outbred animals Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737941
737942 LE/Ztm Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737942
737943 R/AEurRij Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737943
737944 BN/RijN Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Extinct RRID:RGD_737944
737945 BN/Han Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737945
737946 WAG/OlaHsd Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737946
737947 BDII/Ztm Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971) Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737947
737948 BDE/Ztm Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737948
737949 A2/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737949
737950 DA/Ztm Substrain of DA/OlaHsd, to Hannover after 1965 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737950
737951 CAP/Kuv unknown Dr. HU Wottge, Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737951
737952 ACI/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737952
737953 LEW/Gut Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany unknown source inbred Unknown RRID:RGD_737953
737954 AS/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737954
737955 Hooded/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737955
737956 WF/Gut substrain of Wistar Furth stock, from J Furth in 1945 unknown inbred Unknown RRID:RGD_737956
737957 WOKW/K Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991 Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany; National BioResource Project for the Rat in Japan inbred Unknown Diabetes Obesity; Metabolism RRID:RGD_737957
737958 CHOC/Cub unknown Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737958
737959 RNU/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737959
737960 Hsd:WI Wistar These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan. Envigo outbred Unknown RRID:RGD_737960
737961 SR/JrMol Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737961
737962 SPRD/Ztm Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737962
737963 LEW/Cub Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737963
737964 BN/OlaHsd Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis Harlan inbred Unknown RRID:RGD_737964
737965 AGUS/OlaHsd Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968 Harlan inbred Unknown RRID:RGD_737965
737966 LEW/Kuv Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737966
737967 BS/Ztm Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737967
737968 BN/Gut Substrain of BN, from Billingham and Silvers 1958 unknown inbred Unknown RRID:RGD_737968
737969 NAR/SaU non-albumin rat Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht Dept of Laboratory Animal Science, University of Utrecht, The Netherlands inbred Unknown RRID:RGD_737969
737970 AMORAT/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium inbred Unknown RRID:RGD_737970
737971 SHRSP/Rivm unknown National Institute of Public Health and Environmental Protection, The Netherlands inbred Unknown RRID:RGD_737971
737972 BN/Crl Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976. Charles River Laboratories inbred Unknown RRID:RGD_737972
738038 HEP high ethanol preferring High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France inbred Unknown RRID:RGD_738038
738120 LEW-Tg(HLA-B*2705m1,B2M)133-1TrgTg/Tg This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20) RRID:RRRC_00043
738122 SD-Tg(UBC-EGFP)1BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00052
1298093 LEW/NHsd Descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. Maintained at Harlan-Sprague Dawley (Indianapolis, Indiana) . Envigo inbred Unknown RRID:RGD_1298093
1299868 SS.SR-(D7Uia1-D7Mco7)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 113014423 1 - by flanking markers 7 112367543 116100169 1 - by flanking markers 7 112429186 112429483 1 - by flanking markers 7 103146217 103146515 1 - by flanking markers RRID:RGD_1299868
1299869 SS.SR-(Cyp11b1)/Jr Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1299869
1299870 SS.LEW-(D5Uia8-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 121964356 134872385 1 - by flanking markers 5 124025017 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299870
1299871 DA.F344-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299871
1299872 DA.F344-(D8Arb15-D8Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 8 71843628 124310337 1 - by flanking markers 8 77653284 127239929 1 - by flanking markers 8 73320439 128033168 1 - by flanking markers 8 68133439 119085047 1 - by flanking markers RRID:RGD_1299872
1299873 SS.LEW-(D5Mco34-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 134871897 134872385 1 - by flanking markers 5 137107818 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299873
1299874 OLETF.F344-(D1Rat166-D1Rat90)/Tj Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol. Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1299874
1299875 DA.F344-(D7Rat22-D7Mit2)/Nsi Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 123191874 1 - by flanking markers 7 125794079 125794357 1 - by flanking markers 7 126080176 126080454 1 - by flanking markers 7 116294265 116294546 1 - by flanking markers RRID:RRRC_00679
1299876 SS.LEW-(D5Rat54-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 126386030 134872385 1 - by flanking markers 5 128816449 137108002 1 - by flanking markers 5 124957483 133313852 1 - by flanking markers 5 120182440 128034027 1 - by flanking markers RRID:RGD_1299876
1299877 DA.F344-(D10Rat204-D10Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 10 95695076 95695218 1 - by flanking markers 10 94240348 107484761 1 - by flanking markers 10 107857524 107857673 1 - by flanking markers 10 104060133 104060283 1 - by flanking markers RRID:RGD_1299877
1299878 DA.F344-(D4Arb30-D4Arb4)/Arb The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 73972453 154937227 1 - by flanking markers 4 216606296 216606455 1 - by flanking markers 4 150682435 150682594 1 - by flanking markers 4 151805502 151805662 1 - by flanking markers RRID:RGD_1299878
1299879 SS.SR-(D7Mco7-D7Wox19)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 113044000 113044249 1 - by flanking markers 7 116151764 116152012 1 - by flanking markers 7 116249395 116249643 1 - by flanking markers 7 106839225 106839474 1 - by flanking markers RRID:RGD_1299879
1299880 F344.DA-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299880
1299881 SS.LEW-(D5Wox3-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 99080786 134872385 1 - by flanking markers 5 101964092 137108002 1 - by flanking markers 5 97921932 133313852 1 - by flanking markers 5 94858972 128034027 1 - by flanking markers RRID:RGD_1299881
1300432 HAA/FDSC Hatano High Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300432
1300433 LAA/FDSC Hatano Low Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation. Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300433
1300439 SD-Tg(UBC-EGFP)2BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00065
1302359 HsdFcen:SD These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown RRID:RGD_1302359
1302360 W/HsdFcen These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown RRID:RGD_1302360
1302372 SDDIO/Rrrc This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00044
1302373 SDDR/Rrrc This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00045
1302377 SPRD-Anks6PKD/Rrrc From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07) Anks6PKD 11534996 5 63633540 63674953 7 5 67163440 67204853 7 5 62642974 62684387 7 5 61309183 61350596 7 RRID:RRRC_00046
1302416 ACI.DA-(D10Rat2-D10Rat19)/Arb A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd. Center for Genomics and Human Genetics, Manhasset, New York congenic Unknown RRID:RGD_1302416
1302597 LEXF7C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302597
1302598 FXLE26/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302598
1302599 WKY/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302599
1302600 HTX/Kyo hydrocephalus texas 1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1302600
1302601 FXLE23/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302601
1302602 FXLE12/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302602
1302603 FXLE25/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302603
1302604 LEXF4/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302604
1302605 LEXF2A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302605
1302606 SHRSP/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302606
1302607 FXLE21/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302607
1302608 CXH6/Tj Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302608
1302610 KMI/Tky miniature rat ishikawa Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College. National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis Prkg2 3401 RRID:RGD_1302610
1302611 FXLE24/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302611
1302612 LEXF10C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302612
1302613 BN/fMaiHok Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302613
1302614 WKY/NMna Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302614
1302615 FXLE14/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302615
1302616 LEXF10B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302616
1302617 LEXF6B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302617
1302618 LEXF9/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302618
1302619 FXLE16/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-16) Diabetes Obesity; Cancer RRID:RGD_1302619
1302620 SHR/Kyo spontaneous hypertension rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12) Cardio Hypertension RRID:RGD_1302620
1302621 LEXF10A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302621
1302622 WF/Kop Inbred originated from Kagoshima University, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1302622
1302623 TM/Kyo tester moriyama rat Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 . National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Hematology Rab38ru 1600311 1 144783919 144864573 7 1 158385888 158466621 7 1 152072764 152072764 8 1 142182614 142182614 8 RRID:RGD_1302623
1302624 RICO/Ngs Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Ophthalmology RRID:RGD_1302624
1302625 F344.OLETF-(D16Wox4-D16Rat13)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_1302625
1302626 BN.UPL-(D2Rat134-D2Rat2)/Cas Strain originated from Hiroshima University, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology 2 14747814 190963154 1 - by flanking markers 2 14095321 217785884 1 - by flanking markers 2 14237830 198298901 1 - by flanking markers 2 16491740 183719262 1 - by flanking markers RRID:RGD_1302626
1302627 F344/NSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302627
1302628 ACIS/Hok Spontaneous mutation from ACI/Hok in 1981. National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302628
1302629 WKY.SHRSP-(D1Rat49-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302629
1302630 F344.OLETF-(D10Wox7-D10Wox6)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_1302630
1302631 BN/SsNSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Immunology RRID:RGD_1302631
1302632 WKY.SHRSP-(D1Smu11-D1Arb21)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302632
1302633 FXLE20/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302633
1302634 BB/WorTky BioBreeding rat Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1302634
1302635 F344.OLETF-(D12Rat8-D12Rat16)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 12 23934730 31489223 1 - by flanking markers 12 27805580 36160041 1 - by flanking markers 12 25799119 34265075 1 - by flanking markers 12 22779459 30427275 1 - by flanking markers RRID:RGD_1302635
1302636 WKY.SHRSP-(D1Wox29-D1Arb21)/Izm This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1302636
1302637 LAA Hatano Low Avoidance Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302637
1302638 LEXF11/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302638
1302639 KHR/Kyo kaken hairless rat Kaken hairless rat were detected by Kimura from Gunn National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 7 1 114661970 114987433 7 1 107116278 107446093 7 RRID:RGD_1302639
1302640 ACI/Tj Strain originated from The University of Tokushima, Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302640
1302641 LEXF1A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302641
1302642 LEA/Hkm Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302642
1302643 ACI/NKyo august copenhagen irish NIH (1988, F143) > Kyo (F43) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Reproduction RRID:RGD_1302643
1302644 CXA5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302644
1302645 DMY/Kyo demyelination rat From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Mrs2dmyKyo 12793071 17 47124915 47142840 7 17 43932146 43951399 7 17 42064271 42083602 7 17 40063924 40087073 7 RRID:RGD_1302645
1302646 LEXF2C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302646
1302647 F344.OLETF-(D5Rat166-D5Rat90)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Unknown 5 137718909 139664499 1 - by flanking markers 5 140063670 141938308 1 - by flanking markers 5 136271682 138128882 1 - by flanking markers 5 130881210 132691399 1 - by flanking markers RRID:RGD_1302647
1302648 LEC/Hok Long Evans Cinnamon At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991. National BioResource Project for the Rat in Japan mutant Unknown (as of 2016-12-01) Cancer; Immunology Atp7bhts 11532742 16 74607988 74680080 7 16 74495179 74575822 7 16 74865516 74944935 7 16 69952286 70024404 7 RRID:RGD_1302648
1302649 LEXF7B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302649
1302650 F344.OLETF-(D9Mgh8-D9Rat15)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 9 33374546 62634991 1 - by flanking markers 9 40808491 71887966 1 - by flanking markers 9 41139089 70686886 1 - by flanking markers 9 36840385 65383934 1 - by flanking markers RRID:RGD_1302650
1302651 CXA1/Tj Strain originated from the The University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302651
1302652 LEXF7A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302652
1302653 LEXF8A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302653
1302654 F344.OLETF-(D7Mgh16-D7Mgh20)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 103612739 123191874 1 - by flanking markers 7 106942155 125794357 1 - by flanking markers 7 106995385 126080454 1 - by flanking markers 7 98011396 116294546 1 - by flanking markers RRID:RGD_1302654
1302655 TO/Hkm Strain originated from the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302655
1302656 LEA/Hok Long Evans Agouti Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2). National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) RRID:RGD_1302656
1302657 DOP/Nem dilute-opisthotonus (dop) Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established. National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Myo5a 3143 RRID:RGD_1302657
1302658 LEJ/Hkm Strain originated at the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302658
1302659 CXH5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302659
1302660 RCS/Kyo royal college of surgeons rat From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Ophthalmology Mertkrdy 40902839 3 116308387 116416414 7 3 128669534 128777078 7 3 121235230 121340932 7 3 115939351 116045141 7 RRID:RGD_1302660
1302661 F344.OLETF-(D14Rat23-D14Rat12)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_1302661
1302662 CXH2/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302662
1302663 F344.OLETF-(D11Rat4-D11Rat1)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 11 64573222 84443333 1 - by flanking markers 11 66731054 89693367 1 - by flanking markers 11 65352097 86593596 1 - by flanking markers 11 62790342 82450994 1 - by flanking markers RRID:RGD_1302663
1302664 WNA/Nshm Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302664
1302665 FXLE13/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302665
1302666 LEXF1C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302666
1302667 F344.OLETF-(D5Mgh5-D5Mgh23)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_1302667
1302668 IS-Tlk/Kyo tail anomaly lethal kyoto Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto) National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_1302668
1302669 HAA Hatano High Avoidance Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302669
1302670 ACI/NSlc Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302670
1302671 WM/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302671
1302672 W/Kyo Hok>Hkm>Kyo National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302672
1302673 FXLE15/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302673
1302674 VF/Kyo vacuole formation rat The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10) Neurobiology RRID:RGD_1302674
1302675 WKY.SHRSP-(D1Smu13-D1Smu11)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302675
1302676 NER/Slc noda epileptic rat Strain is from Japan SLC, Inc. Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Neurobiology RRID:RGD_1302676
1302677 NIG-III/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302677
1302678 NAR/Slc non albumin rat Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Hematology RRID:RGD_1302678
1302679 TRMR/Kyo tremor resistant Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM. National BioResource Project for the Rat in Japan segregating_inbred Unknown Aspa 621693 RRID:RGD_1302679
1302680 SHR/Ta Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302680
1302681 WKY.SHRSP-(D1Smu11-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302681
1302682 FXLE18/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302682
1302683 FXLE22/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302683
1302684 F344/NHok Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302684
1302685 F344.OLETF-(D14Rat8-D14Rat26)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_1302685
1302686 F344/Stm Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302686
1302687 WKAH/HkmSlc Wistar King A, Hokkaido Strain originated from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302687
1302688 ACI/NMna This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302688
1302689 WKY.SHRSP-(Ntrk3-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302689
1302690 FXLE19/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302690
1302691 ALB/Hok Albany Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Dentistry RRID:RGD_1302691
1302692 WKY.SHRSP-(D1Wox18-D1Rat44)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302692
1302693 KZ-LeprfaTky A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980. National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Metabolism Lepr 3001 RRID:RGD_1302693
1302694 WKA/Seac Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302694
1302695 SER/Kyo spontaneously epileptic rat Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn|Aspa 69063|621693 RRID:RGD_1302695
1302696 FH/HamSlc fawn hooded rat Strain originated at Japan SLC, Inc., Shizuoka , Japan. National BioResource Project for the Rat in Japan mutant Live Animals Cardio Hypertension RRID:RGD_1302696
1302697 KND/Tky komeda non-diabetic rat Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity RRID:RGD_1302697
1302698 SDR/Slc Spontaneous dwarf rat The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04) Metabolism Gh1sdr 12880380 10 95692240 95694117 7 10 94237414 94239391 7 10 94486878 94486878 8 10 91228776 91228776 8 RRID:RRRC_00066
1302699 LEXF8D/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302699
1302700 HOB/Snk hobble rat HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Unc5c|Unc5chob 735109|12802353 2 239365109 239721231 7 2 265573406 265926229 7 2 247045813 247397483 7 2 230180353 230535219 7 RRID:RGD_1302700
1302701 LEW/SsNSlc Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals (as of 2020-08-26) Immunology RRID:RGD_1302701
1302702 TRM/Kyo tremor rat In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010) National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) Neurobiology Aspa|Hcn1A354V 621693|13464319 RRID:RGD_1302702
1302703 WKY.SHRSP-(D1Wox29-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302703
1302704 WKY.SHRSP-(D1Wox29-D1Rat199)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302704
1302705 WKY.SHRSP-(D1Wox29-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302705
1302706 F344.OLETF-(D5Rat32-D5Rat26)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 5 119332868 139659574 1 - by flanking markers 5 121495621 141933383 1 - by flanking markers 5 117554114 138123957 1 - by flanking markers 5 113558156 132686472 1 - by flanking markers RRID:RGD_1302706
1302707 LEXF3/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302707
1302708 FXLE17/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302708
1302709 WKY/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302709
1302710 LEXF2B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302710
1302711 ExHC/Seac Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993 National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302711
1302712 ZIMY/Kyo Zitter Masao Yamada ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17) Neurobiology Atrn 69063 3 118539268 118701177 7 3 129934303 130067267 7 3 123434409 123567922 7 3 118110320 118244326 7 RRID:RGD_1302712
1302713 F344.OLETF-(D8Rat58-D8Mgh17)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 8 19796514 48675424 1 - by flanking markers 8 21850030 48631820 1 - by flanking markers 8 50007641 50007776 1 - by flanking markers 8 46008836 46008974 1 - by flanking markers RRID:RGD_1302713
1302714 KZC/Tky Komeda Zucker Creeping rat Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Reln 3553 RRID:RGD_1302714
1302715 WKY.SHRSP-(D1Wox18-D1Wox29)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302715
1302716 OM/NSlc Osborne-Mendel rat The Instutite of Medical Science, The University of Tokyo to Slc (1985) National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302716
1302717 ACI/NHok NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135 National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302717
1302718 HWY/Slc hairless wistar yagi Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Dermatology RRID:RGD_1302718
1302719 DON/Kyo Donryu rat Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302719
1302720 CXH10/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302720
1302721 LEC/Tj Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Cancer Atp7bhts 11532742 16 74607988 74680080 7 16 74495179 74575822 7 16 74865516 74944935 7 16 69952286 70024404 7 RRID:RGD_1302721
1302722 PVG/Seac Piebald Virol Glaxo Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302722
1302723 LEXF5/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302723
1302724 SHR/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302724
1302726 ZI/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrnzi 40902832 3 118539268 118701177 7 3 129934303 130067267 7 3 123434409 123567922 7 3 118110320 118244326 7 RRID:RGD_1302726
1302727 SHRSR/Ta Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302727
1302728 MES/Slc Matsumoto Eosinophilia Shinshu Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999) National BioResource Project for the Rat in Japan mutant Live Animals Hematology Cybam1Sdi 13209000 19 52713150 52721609 7 19 65959818 65967224 7 19 55252024 55252027 8 19 50489921 50489924 8 RRID:RGD_1302728
1302729 LEA/Tj Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer RRID:RGD_1302729
1302795 HTG Prague hypertriglyceridemic These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding. Institute of Physiology, Academy of Sciences Prague, Czech Republic inbred Unknown RRID:RGD_1302795
1302921 F344-Tg(NPHS2-HBEGF)Wig hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs. Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan transgenic Unknown RRID:RGD_1302921
1303393 LEC/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_1303393
1304487 BBDR/Wor Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies. inbred Unknown RRID:RGD_1304487
1331811 LEW.BN-(D10Rat32-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1331811
1331812 LEW.BN-(D10Rat83-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46860047 65668639 1 - by flanking markers 10 46728252 64823355 1 - by flanking markers 10 46955258 46955430 1 - by flanking markers 10 45393829 45394002 1 - by flanking markers RRID:RGD_1331812
1331813 BN.GK-(D8Rat29-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 74769551 87069779 1 - by flanking markers 8 76345502 89012772 1 - by flanking markers 8 89482236 89482480 1 - by flanking markers 8 82872062 82872307 1 - by flanking markers RRID:RGD_1331813
1331814 BN.GK-(D8Got302-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 48185711 87069779 1 - by flanking markers 8 48160321 89012772 1 - by flanking markers 8 49533872 89482480 1 - by flanking markers 8 45539309 82872307 1 - by flanking markers RRID:RGD_1331814
1331815 LEW/Mol LEW/Mol This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe) Mollegaard Breeding Center Ltd., Denmark inbred Unknown Ncf1 61307 RRID:RGD_1331815
1331816 DA.ACI-(D10Rat2-D10Rat29)/Kini (DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology; Immunology 10 68842878 68843272 1 - by flanking markers 10 67642121 110568670 1 - by flanking markers 10 67988035 110992275 1 - by flanking markers 10 107057622 107057807 1 - by flanking markers RRID:RGD_1331816
1331817 BN.LEW-(D10Rat32-D10Mgh4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 96799937 1 - by flanking markers 10 53381898 95372987 1 - by flanking markers 10 53630865 95638337 1 - by flanking markers 10 51779662 92369470 1 - by flanking markers RRID:RGD_1331817
1331818 LEW.BN-(D10Rat43-D10Mco4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 42042465 1 - by flanking markers 10 22266756 41793199 1 - by flanking markers 10 22402817 41976505 1 - by flanking markers 10 22918268 40741723 1 - by flanking markers RRID:RGD_1331818
1331819 F344/Eer F344/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331819
1331820 LEW.BN-(D10Got9-D10Rat2)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 5641331 5641541 1 - by flanking markers 10 4578252 110568670 1 - by flanking markers 10 5760565 110992275 1 - by flanking markers 10 5684047 107057807 1 - by flanking markers RRID:RGD_1331820
1331821 LEW.BN-(D10Wox26-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 30343658 46737218 1 - by flanking markers 10 30131785 46592053 1 - by flanking markers 10 30303447 46835685 1 - by flanking markers 10 29659462 45274336 1 - by flanking markers RRID:RGD_1331821
1331822 DA.ACI-(D10Rat2-D10Rat6) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 106310811 106310957 1 - by flanking markers 10 104746165 110568670 1 - by flanking markers 10 105077900 110992275 1 - by flanking markers 10 101435864 107057807 1 - by flanking markers RRID:RGD_1331822
1331823 LEW.BN-(D10Rat43-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 77092169 1 - by flanking markers 10 22266756 74127968 1 - by flanking markers 10 22402817 75983805 1 - by flanking markers 10 22918268 73453136 1 - by flanking markers RRID:RGD_1331823
1331824 DA.ACI-(D10Rat219-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 68842878 81986757 1 - by flanking markers 10 67642121 80884595 1 - by flanking markers 10 67988035 81042642 1 - by flanking markers 10 78306880 78307017 1 - by flanking markers RRID:RGD_1331824
1331826 LEW.BN-(D10Mgh7-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 77092169 1 - by flanking markers 10 55720558 74127968 1 - by flanking markers 10 55978483 75983805 1 - by flanking markers 10 54098674 73453136 1 - by flanking markers RRID:RGD_1331826
1331827 DA.ACI-(D10Rat10-D10Rat142) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 92448353 100301488 1 - by flanking markers 10 91113514 98868127 1 - by flanking markers 10 91345679 99171690 1 - by flanking markers 10 88207600 95803900 1 - by flanking markers RRID:RGD_1331827
1331828 DA.ACI-(D10Rat12-D10Rat144) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 86290650 99198997 1 - by flanking markers 10 85276455 97759008 1 - by flanking markers 10 85487741 98044833 1 - by flanking markers 10 82538790 94725019 1 - by flanking markers RRID:RGD_1331828
1331829 BN.LEW-(D9Got8-D9Got200)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 9 3811425 3811711 1 - by flanking markers 9 2597055 9698468 1 - by flanking markers 9 2657610 10706733 1 - by flanking markers 9 1185844 4302019 1 - by flanking markers RRID:RGD_1331829
1331830 F344.BN-(D5Rat1-D5Mit5)/Dlw This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 5 35911094 109163425 1 - by flanking markers 5 39876314 112058005 1 - by flanking markers 5 35225432 108092802 1 - by flanking markers 5 34730116 104251008 1 - by flanking markers RRID:RGD_1331830
1331831 LEW.BN-(D10Rat173-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 37505289 65668639 1 - by flanking markers 10 37209026 64823355 1 - by flanking markers 10 37435916 37436126 1 - by flanking markers 10 36244402 36244613 1 - by flanking markers RRID:RGD_1331831
1331832 BN.LEW-(D10Rat72-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 46737218 1 - by flanking markers 10 46591952 46592053 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1331832
1331833 DA.ACI-(D10Rat15-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 68842878 96667338 1 - by flanking markers 10 67642121 95243104 1 - by flanking markers 10 67988035 95508221 1 - by flanking markers 10 92238327 92238497 1 - by flanking markers RRID:RGD_1331833
1331834 BN.LEW-(D10Rat100-D10Rat126)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 26434477 26434620 1 - by flanking markers 10 26363403 42526523 1 - by flanking markers 10 26517020 42716241 1 - by flanking markers 10 25790546 41482228 1 - by flanking markers RRID:RGD_1331834
1331836 WKY/Eer WKY/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331836
1354669 BN/OrlIcoCrlf Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991. Charles River France inbred Unknown RRID:RGD_1354669
1354670 F344/IcoCrlf These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France. Charles River France inbred Unknown RRID:RGD_1354670
1357172 WF.BBDR-(D4Arb29-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 121645621 1 - by flanking markers 4 63250011 183837621 1 - by flanking markers 4 63537179 63537431 1 - by flanking markers 4 64528739 64528994 1 - by flanking markers RRID:RGD_1357172
1357173 SS.MNS-(Vamp2-D10M11Mit84)/Mco This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 55852132 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_1357173
1357174 BBDR.BBDP-(D4Mit6-D4Mit24)/Rhw S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein. Department of Medicine University of Washington, Seattle, Washington congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RGD_1357174
1357175 F344.DR-(D4Mit6-D4Mit24)-Tg(Gimap5)Mcwi Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(D4Mit6-D4Mit24) Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin transgenic Unknown RRID:RGD_1357175
1357176 WF.BBDR-(D4Arb29-D4Rat96)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 65434807 1 - by flanking markers 4 63250011 65397196 1 - by flanking markers 4 63537179 65577249 1 - by flanking markers 4 64528739 66609456 1 - by flanking markers RRID:RGD_1357176
1357177 F344.DR(DP)-(D4Mit6-D4Mit24)/Rhw The lymphopenia locus from BBDR.BBDP-(D4Mit6-D4Mit24) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding. Department of Medicine University of Washington, Seattle, Washington, Rat Resource & Research Center congenic Cryopreserved Embryo 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RRRC_00082
1357178 CD Cohen diabetic rat Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357178
1357179 SS.WKY-(D2N35-Mme),MNS-(D10Mit11-D10M11Mit119)/Mco SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F1 were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1357179
1357180 SS.LEW-(D8Chm14-D8Rat16)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Grik4 2734 8 45510258 98878889 1 - by flanking markers 8 45279673 100781055 1 - by flanking markers 8 46804134 101305168 1 - by flanking markers 8 42903043 94388843 1 - by flanking markers RRID:RGD_1357180
1357181 CDR/Ygl Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel inbred Unknown RRID:RGD_1357181
1357182 Eker-Tg(Tsc2)28Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_1357182
1357183 SS.MNS-(D10Mco10-Aldoc)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown Nos2 3185 10 6849272 65072453 1 - by flanking markers 10 5706467 65456957 1 - by flanking markers 10 6908932 66221621 1 - by flanking markers 10 6813971 63851208 1 - by flanking markers RRID:RGD_1357183
1357184 Crl:ZUC-Leprfa Zucker rats The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_1357184
1357185 RHA.Gunn-Ugt1a1j/N RHA/N rats were crossed with Gunn rats. F1 hybrids were intercrossed for 12 cycles while selecting for jaundice loci. Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA congenic Unknown RRID:RGD_1357185
1357186 Gunn-Ugt1a1j/BluHsd Gunn rat This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan mutant Unknown Ugt1a1j 13432064 9 87091241 87098362 7 9 94982916 94990037 7 9 95300017 95300017 8 9 88805660 88805660 8 RRID:RGD_1357186
1357187 WF.BBDR-(D4Rat16-D4Got39)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 56704967 1 - by flanking markers 4 56868238 56868336 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357187
1357189 SS.LEW-(D8Rat56-D8Rat51)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 8 8294860 29559867 1 - by flanking markers 8 9505886 30947391 1 - by flanking markers 8 9531047 30918267 1 - by flanking markers 8 8462195 28243068 1 - by flanking markers RRID:RGD_1357189
1357190 SS.MNS-(Adh1-D2Mit5)/Mco This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Adh1c 2044 2 235799396 235811584 1 - by flanking markers 2 262090818 262102977 1 - by flanking markers 2 243550655 243562243 1 - by flanking markers 2 226797303 226808892 1 - by flanking markers RRID:RGD_1357190
1357191 CDS/Ygl Cohen diabetic-sensitive rat Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357191
1357192 WF.BBDR-(D4Got39-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 121645621 1 - by flanking markers 4 56868238 183837621 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357192
1357193 WF.BBDR-(D4Got51-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 70123187 121645621 1 - by flanking markers 4 136548956 183837621 1 - by flanking markers 4 71744558 71744763 1 - by flanking markers 4 71241724 71241930 1 - by flanking markers RRID:RGD_1357193
1357194 WF.BBDR-(D4Rat96-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65434709 121645621 1 - by flanking markers 4 65397099 183837621 1 - by flanking markers 4 65577152 65577249 1 - by flanking markers 4 66609358 66609456 1 - by flanking markers RRID:RGD_1357194
1357195 SS.MNS-(Aldoc-D10Mco1)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Nos2 3185 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 10 61345276 61345413 1 - by flanking markers RRID:RGD_1357195
1357196 WF.BBDR-(D4Arb29-D4Rat265)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 82266081 1 - by flanking markers 4 63250011 148715224 1 - by flanking markers 4 63537179 84053053 1 - by flanking markers 4 64528739 83007655 1 - by flanking markers RRID:RGD_1357196
1357345 DA/K Dark Agouti/Karlsburg Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_1357345
1357346 BB.SHR-(D4Mit6-Spr)/K BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany congenic Unknown Npy|Spr 3197|3753 4 75732943 119369308 1 - by flanking markers 4 141978848 181496612 1 - by flanking markers 4 77307388 116916073 1 - by flanking markers 4 76647384 117676292 1 - by flanking markers RRID:RGD_1357346
1357417 SD-Tg(Npy)400Mcwi 14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene. Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1357417
1357953 WAG/RijHfr Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France) Envigo (Harlan France) inbred Unknown RRID:RGD_1357953
1357954 F344/NHfr Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France. Harlan France inbred Unknown RRID:RGD_1357954
1357955 WF/NHfr Wistar-Furth Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France. Harlan France inbred Unknown RRID:RGD_1357955
1357957 LEW/HanHfr Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015 ENVIGO France inbred Unknown The LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE RRID:RGD_1357957
1357958 BN/RijHfr Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France. Harlan France inbred Unknown RRID:RGD_1357958
1357959 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin congenic Live Animals Ctsc|Grm5|Nox4|Rab38|Tyr 2445|2746|620600|628752|1589755 1 157084760 158516775 1 - by flanking markers 1 150775310 152202960 1 - by flanking markers 1 140879679 142314355 1 - by flanking markers RRID:RGD_1357959
1357960 LE/CpbHfr Substrain of LE which was bred at Harlan CPB now at Harlan France. Envigo (Harlan France) inbred Unknown RRID:RGD_1357960
1357974 BB.SHR-(D4Got41-Gimap5)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Gimap5 628871 4 60262965 76843214 1 - by flanking markers 4 60179409 143073003 1 - by flanking markers 4 60439127 78386683 1 - by flanking markers 4 61697658 77701025 1 - by flanking markers RRID:RGD_1357974
1357975 SS.LEW-(D1Mco4-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 29841428 43747532 1 - by flanking markers 1 33073397 50297622 1 - by flanking markers 1 31647701 49454378 1 - by flanking markers 1 29038037 49268520 1 - by flanking markers RRID:RGD_1357975
1357976 BB.SHR-(D4Got41-D4Rat171)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 4 60262965 87996003 1 - by flanking markers 4 60179409 154162556 1 - by flanking markers 4 60439127 89342035 1 - by flanking markers 4 61697658 88217207 1 - by flanking markers RRID:RGD_1357976
1357977 SS.LEW-(D1Mco8-D1Rat213)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 32329137 81548909 1 - by flanking markers 1;9 84537073;7947583 84537228;7947744 1 - by flanking markers;1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_1357977
1357978 SS.MNS-(D2Mit6-D2Rat303)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 131522430 1 - by flanking markers 2 98037122 155130826 1 - by flanking markers 2 78321410 135646395 1 - by flanking markers 2 76539322 127460910 1 - by flanking markers RRID:RGD_1357978
1357979 SS.MNS-(Mme-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Mme 3098 2 153031724 179302663 1 - by flanking markers 2 173193501 206015340 1 - by flanking markers 2 153799203 186612024 1 - by flanking markers 2 147686913 172711135 1 - by flanking markers RRID:RGD_1357979
1357980 BB.SHR-(D4Got41-Tacr1)/K Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Metabolism Tacr1 3811 4 60262965 116780394 1 - by flanking markers 4 60179409 178095041 1 - by flanking markers 4 60439127 113416139 1 - by flanking markers 4 61697658 115089733 1 - by flanking markers RRID:RGD_1357980
1357981 SS.LEW-(D3Mco21-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 68499987 121619110 1 - by flanking markers 3 79183926 133513825 1 - by flanking markers 3 72672290 127023997 1 - by flanking markers 3 70348525 121056321 1 - by flanking markers RRID:RGD_1357981
1357982 SS.LEW-(D3Rat52-D3Chm63)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 51161895 1 - by flanking markers 3 19410399 61857467 1 - by flanking markers 3 14090411 55245509 1 - by flanking markers 3 18311454 53781346 1 - by flanking markers RRID:RGD_1357982
1357983 SS.LEW-(D1Mco75-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 43747374;2897342 43747532;2897591 1 - by flanking markers;1 - by flanking markers 1 36805624 50297622 1 - by flanking markers 1 35406399 49454378 1 - by flanking markers 1 32765502 49268520 1 - by flanking markers RRID:RGD_1357983
1357984 SS.MNS-(D2Mit6-D2Rat166)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 145701148 1 - by flanking markers 2 98037122 165313939 1 - by flanking markers 2 78321410 145903673 1 - by flanking markers 2 76539322 140636154 1 - by flanking markers RRID:RGD_1357984
1357985 LOU/Ins originated from Universite Catholique de Louvain. INSERM, C.H.U. Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_1357985
1357986 SS.LEW-(D1Uia8-D1Rat211)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 1147796 1148037 1 - by flanking markers 1 35077728 35077968 1 - by flanking markers 1 33667777 33668017 1 - by flanking markers 1 31050840 31051081 1 - by flanking markers RRID:RGD_1357986
1357987 SS.LEW-(D1Uia8-D1Rat18)/Mco A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 43747374 43747532 1 - by flanking markers 1 50297465 50297622 1 - by flanking markers 1 49454221 49454378 1 - by flanking markers 1 49268362 49268520 1 - by flanking markers RRID:RGD_1357987
1357988 SS.LEW-(D3Rat52-D3Rat17)/Ayd A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 121619110 1 - by flanking markers 3 19410399 133513825 1 - by flanking markers 3 14090411 127023997 1 - by flanking markers 3 18311454 121056321 1 - by flanking markers RRID:RGD_1357988
1357994 SHR/NCrl To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension. Charles River Laboratories inbred Live Animals (as of 2020-01-23) RRID:RGD_1357994
1358112 WKY/NCrl Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11 Charles River Laboratories inbred Unknown RRID:RGD_1358112
1358114 SS-Chr 5BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358114
1358150 SS.LEW-(D16Rat12-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 350232 1 - by flanking markers 16 751266 1084414 1 - by flanking markers 16 756352 1090164 1 - by flanking markers 16 88524 380356 1 - by flanking markers RRID:RGD_1358150
1358151 FHH-Chr 8BN/Mcwi A FHH genomic background with a BN chromosome 8 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358151
1358152 SS-Chr 14BN/Mcwi A SS genomic background with a BN chromosome 14 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358152
1358153 COP/CrCrl Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998. Charles River Laboratories inbred Unknown RRID:RGD_1358153
1358154 SS-Chr 3BN/Mcwi A SS genomic background with a BN chromosome 3 introgressed. PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358154
1358155 SS.LEW-(D10Rat119-D10Mgh1)(D16Rat21-D16Rat112)/Ayd This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (D10Rat119-D10Mgh1)and (D16Rat21-D16Rat112) from the LEW strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown RRID:RGD_1358155
1358156 SS.MNS-(D2Rat183-D2Chm113)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 144136724 145774334 1 - by flanking markers 2 163731761 165386311 1 - by flanking markers 2 144313532 145975996 1 - by flanking markers 2 139096736 140708949 1 - by flanking markers RRID:RGD_1358156
1358157 FHH-Chr 7BN/Mcwi A FHH genomic background with a BN chromosome 7 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358157
1358158 FHH-Chr 16BN/Mcwi A FHH genomic background with a BN chromosome 16 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358158
1358159 FHH-Chr 6BN/Mcwi A FHH genomic background with a BN chromosome 6 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358159
1358160 SS.BN-(D8Rat163-D8Rat81)/Mcwi A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81. PhysGen congenic Unknown 8 31508524 124926877 1 - by flanking markers 8 32911182 127854519 1 - by flanking markers 8 32888352 128653291 1 - by flanking markers 8 30188867 119698120 1 - by flanking markers RRID:RGD_1358160
1358161 SS.LEW-(D16Rat38-D16Chm66)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 3080748 8612621 1 - by flanking markers 16 3405986 11276947 1 - by flanking markers 16 3439525 9316554 1 - by flanking markers 16 2995225 8336378 1 - by flanking markers RRID:RGD_1358161
1358162 SS-Chr 12BN/Mcwi A SS genomic background with a BN chromosome 12 introgressed. PhysGen consomic Live Animals RRID:RGD_1358162
1358163 SS-Chr 15BN/Mcwi A SS genomic background with a BN chromosome 15 introgressed. PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1358163
1358164 FHH-Chr 17BN/Mcwi A FHH genomic background with a BN chromosome 17 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358164
1358165 SS.MNS-(D2Chm51-D2Rat341)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 151616735 155664303 1 - by flanking markers 2 171854997 177018102 1 - by flanking markers 2 152460836 157650873 1 - by flanking markers 2 146368688 150090572 1 - by flanking markers RRID:RGD_1358165
1358166 SS.LEW-(D16Mit3-D16Rat112)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 47434384 1 - by flanking markers 16 773329 47069744 1 - by flanking markers 16 778415 47346612 1 - by flanking markers 16 110590 44236047 1 - by flanking markers RRID:RGD_1358166
1358167 SS.MNS-(D2Wox27-Adh1)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Adh1c 2044 2 202186267 235811584 1 - by flanking markers 2 228956554 262102977 1 - by flanking markers 2 209489455 243562243 1 - by flanking markers 2 194352314 226808892 1 - by flanking markers RRID:RGD_1358167
1358168 SS.LEW-(D16Mit2-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 4304517 1 - by flanking markers 16 751266 5038806 1 - by flanking markers 16 756352 5098704 1 - by flanking markers 16 88524 4227730 1 - by flanking markers RRID:RGD_1358168
1358169 SS.MNS-(D2Chm25-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Chm90-D2Wox37)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 179302663 1 - by flanking markers 2 199188066 206015340 1 - by flanking markers 2 179779225 186612024 1 - by flanking markers 2 166144095 172711135 1 - by flanking markers RRID:RGD_1358169
1358170 FHH-Chr 5BN/Mcwi A FHH genomic background with a BN chromosome 5 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358170
1358171 SS-Chr 17BN/Mcwi A SS genomic background with a BN chromosome 17 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358171
1358172 SS.MNS-(D2Chm25-Fgg)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Fgg 2613 2 172459883 174734594 1 - by flanking markers 2 199188066 201409143 1 - by flanking markers 2 179779225 181994523 1 - by flanking markers 2 166144095 168362325 1 - by flanking markers RRID:RGD_1358172
1358173 FHH-Chr 11BN/Mcwi A FHH genomic background with a BN chromosome 11 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358173
1358174 SS-Chr 19BN/Mcwi A SS genomic background with a BN chromosome 19 introgressed. PhysGen, Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00601
1358175 FHH-Chr 20BN/Mcwi A FHH genomic background with a BN chromosome 20 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358175
1358176 FHH-Chr 18BN/Mcwi A FHH genomic background with a BN chromosome 18 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358176
1358177 SS.MNS-(D2Chm25-D2Mit14)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 197256313 1 - by flanking markers 2 199188066 224018437 1 - by flanking markers 2 179779225 204585731 1 - by flanking markers 2 166144095 189599348 1 - by flanking markers RRID:RGD_1358177
1358178 SS-Chr 10BN/Mcwi A SS genomic background with a BN chromosome 10 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358178
1358179 FHH-Chr 13BN/Mcwi A FHH genomic background with a BN chromosome 13 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1358179
1358180 FHH-Chr 19BN/Mcwi A FHH genomic background with a BN chromosome 19 introgressed. PhysGen, Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00581
1358258 RCS/LavRrrc royal college of surgeons rat Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00314
1358259 RCS-p+/LavRrrc This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00315
1358277 RCS-rdy+/LavRrrc Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16) RRID:RRRC_00317
1358278 RCS-rdy+p+/LavRrrc Developed by crossing a pink-eyed control(RCS-rdy+/Lav x black-eyed dystrophic(RCS-p+/Lav) The F12 progeny was backcrossed to RCS-rdy+/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) RRID:RRRC_00316
1358298 SD-Tg(Rho*P23H)1LavRrrc This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Live Animals (as of 2021-05-07) Rho 11239 RRID:RRRC_00639
1358299 SD-Tg(Rho*P23H)2Lav This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358299
1358300 SD-Tg(Rho*P23H)3Lav This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00641
1358302 SD-Tg(Rho*S334X)3Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center transgenic Unknown RRID:RRRC_00643
1358303 SD-Tg(Rho*S334X)4Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00645
1358304 SD-Tg(Rho*S334X)5Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358304
1358305 SD-Tg(Rho*S334X)7Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358305
1358306 SD-Tg(Rho*S334X)9Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358306
1358632 MR/Har Maudsely reactive This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-20) RRID:RRRC_00691
1358633 MNRA/Har Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred Unknown RRID:RGD_1358633
1358918 W-Plp1md/Nya W-Plp1md Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. Division of Laboratories and Research, New York State Department of Health, Albany, New York mutant Unknown Plp1|Plp1md 3354|12802346 X 124488627 124503639 7 X 107379831 107394881 7 X 107505372 107505372 8 X 100195051 100195051 8 RRID:RGD_1358918
1358919 F344/Seac Inbred strain originated from F344 rats SEAC Yoshitomi Co., Fukuoka, Japan inbred Unknown RRID:RGD_1358919
1358921 WF.DA-(D19Mit1-D19Mit6)/Kop Congenic strain originated from a parental DA/Slc strain. kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nqo1 2503 19 26536747 41612881 1 - by flanking markers 19 35433730 54715514 1 - by flanking markers 19 24455726 43907843 1 - by flanking markers 19 24817978 39654489 1 - by flanking markers RRID:RGD_1358921
1358922 BB.WOKW-(D4Got41-Fabp1)/K Congenic strain originated from a BB/OK parental strain. Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany congenic Unknown Fabp1 2590 4 60262965 104415981 1 - by flanking markers 4 60179409 163844105 1 - by flanking markers 4 60439127 99066957 1 - by flanking markers 4 61697658 103194791 1 - by flanking markers RRID:RGD_1358922
1358923 LE-Mbpmd A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks. Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada mutant Unknown Mbp|Mbpmd 3054|12802351 18 78943608 79057329 7 18 78385304 78504226 7 18 79326738 79437310 7 18 75855878 75966404 7 RRID:RGD_1358923
1358989 WKY.SHR-(D2Rat174-D2Rat28)(D2Rat161-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown RRID:RGD_1358989
1358990 DA.F344-(D10Mit9-D10Rat24)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 79229233 1 - by flanking markers 10 31740635 78195122 1 - by flanking markers 10 31919397 78343192 1 - by flanking markers 10 31224026 75632053 1 - by flanking markers RRID:RGD_1358990
1358991 F344.HTX-(D11Rat4-D11Arb4)/Hcj Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown 11 64573222 68235010 1 - by flanking markers 11 66731054 72739915 1 - by flanking markers 11 65352097 69649936 1 - by flanking markers 11 62790342 66422377 1 - by flanking markers RRID:RGD_1358991
1358992 SHR.WKY-(D2Rat40-D2Rat50) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 163154227 200390471 1 - by flanking markers 2 189197858 227035367 1 - by flanking markers 2 169852670 207612467 1 - by flanking markers 2 157142078 192625452 1 - by flanking markers RRID:RGD_1358992
1358993 WKY.SHR-(D2Rat161-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 238140155 1 - by flanking markers 2 138120195 264423808 1 - by flanking markers 2 118446646 245893748 1 - by flanking markers 2 114837527 229059787 1 - by flanking markers RRID:RGD_1358993
1358994 SHR.WKY-(D2Rat161-D2Rat241) This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 217985582 1 - by flanking markers 2 138120195 242993417 1 - by flanking markers 2 118446646 118446793 1 - by flanking markers 2 114837527 114837675 1 - by flanking markers RRID:RGD_1358994
1358995 F344.OLETF-(D1Rat166-D1Rat90)/Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1358995
1358996 SHR.WKY-(D2Rat10-D2Mgh13) This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 35874553 244809764 1 - by flanking markers 2 54092967 270992875 1 - by flanking markers 2 34967269 252466565 1 - by flanking markers 2 36023184 235501121 1 - by flanking markers RRID:RGD_1358996
1358997 WKY.SHR-(D2Rat241-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 217985399 238140155 1 - by flanking markers 2 242993235 264423808 1 - by flanking markers 2 245893572 245893748 1 - by flanking markers 2 229059610 229059787 1 - by flanking markers RRID:RGD_1358997
1358998 BUF/NHsd Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan. Harlan inbred Unknown RRID:RGD_1358998
1358999 WKY.SHR-(D2Rat174-D2Rat28) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 107574826 1 - by flanking markers 2 83930202 126824737 1 - by flanking markers 2 60746052 107083569 1 - by flanking markers 2 59744817 104815148 1 - by flanking markers RRID:RGD_1358999
1359000 DA.F344-(D10Arb27-D10Rat6)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 69160380 106310957 1 - by flanking markers 10 67971352 104746310 1 - by flanking markers 10 68305037 105078045 1 - by flanking markers 10 65927233 101436010 1 - by flanking markers RRID:RGD_1359000
1359001 WKY.SHR-(D2Rat42-D2Rat139) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 180768203 232533087 1 - by flanking markers 2 207416346 258769070 1 - by flanking markers 2 188013923 240243929 1 - by flanking markers 2 174110900 223490532 1 - by flanking markers RRID:RGD_1359001
1359002 NTac:WKY The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony. Taconic outbred Unknown RRID:RGD_1359002
1359003 LEW/Jr This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_1359003
1359004 DA.F344-(D10Mit9-D10Rat11)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 100633982 1 - by flanking markers 10 31740635 99184250 1 - by flanking markers 10 31919397 99492409 1 - by flanking markers 10 31224026 96121100 1 - by flanking markers RRID:RGD_1359004
1359005 SHR.WKY-(D2Rat15-D2Rat50) This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 46251938 200390471 1 - by flanking markers 2 66171293 227035367 1 - by flanking markers 2 47783949 207612467 1 - by flanking markers 2 47137898 192625452 1 - by flanking markers RRID:RGD_1359005
1359006 WKY.SHR-(D2Rat27-D2Rat243) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 96481750 221307793 1 - by flanking markers 2 116297660 248110514 1 - by flanking markers 2 96556622 228759752 1 - by flanking markers 2 94359407 212719943 1 - by flanking markers RRID:RGD_1359006
1359007 WKY.SHR-(D2Rat174-D2Rat62) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 228664122 1 - by flanking markers 2 83930202 254867363 1 - by flanking markers 2 60746052 236318668 1 - by flanking markers 2 59744817 219753474 1 - by flanking markers RRID:RGD_1359007
1359008 F344.HTX-(D11Rat4-D11Arb4)(D17Rat23-D17Rat154)/Hcj Double congenic strain originated from a cross between single congenic strains F344.HTX-(D11Rat4-D11Arb4)/Hcj and F344.HTX-(D17Rat23-D17Rat154)/Hcj. Department of Pharmacology, University of Florida, Gainesville congenic Unknown RRID:RGD_1359008
1359009 WKY.SHR-(D2Rat174-D2Rat185) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 238140155 1 - by flanking markers 2 83930202 264423808 1 - by flanking markers 2 60746052 245893748 1 - by flanking markers 2 59744817 229059787 1 - by flanking markers RRID:RGD_1359009
1359010 WF.BBDR-ART2a/Wor Wistar Furth Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 u/u , ART2a. University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605 congenic Unknown RRID:RGD_1359010
1547865 FHH-Chr 3BN/Mcwi A FHH genomic background with a BN chromosome 3 introgressed. PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1547865
1547866 F344/Jcl Inbred strain originated from F344 CLEA Japan, Inc inbred Live Animals (as of 2021-04-22) RRID:RGD_1547866
1547867 FHH-Chr 4BN/Mcwi A FHH genomic background with a BN chromosome 4 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547867
1547868 FHH-Chr 2BN/Mcwi A FHH genomic background with a BN chromosome 2 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547868
1547869 ACI/Eur August x Copenhagen Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands inbred Unknown RRID:RGD_1547869
1547870 FHH-Chr 14BN/Mcwi A FHH genomic background with a BN chromosome 14 introgressed. PhysGen consomic Live Animals RRID:RGD_1547870
1547871 ACI.FHH-(D1Rat324-D1Rat156)/Eur Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229301063 253410500 1 - by flanking markers 1 251109240 279213254 1 - by flanking markers 1 243853559 243853760 1 - by flanking markers 1 223506828 223507030 1 - by flanking markers RRID:RGD_1547871
1547872 FHH-Chr XBN/Mcwi FHH-Chr XBN/Mcwi A FHH genomic background with a BN chromosome X introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547872
1547873 FHH-Chr 15BN/Mcwi A FHH genomic background with a BN chromosome 15 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547873
1547874 FHH-Chr YBN/Mcwi FHH-Chr YBN/Mcwi A FHH genomic background with a BN chromosome Y introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547874
1547875 ACI.FHH-(D17Rat117-D17Arb5)(D17Rat180-D17Rat51)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 17 31007408 69257442 1 - by flanking markers 17 27537443 67580933 1 - by flanking markers 17 25609692 65831023 1 - by flanking markers 17 24982652 58691962 1 - by flanking markers RRID:RGD_1547875
1547876 FHH-Chr 10BN/Mcwi A FHH genomic background with a BN chromosome 10 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1547876
1549794 SS.LEW-(D2Rat199-D2Mco17)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2;4 41032071;157987925 76020140;157987994 1 - by flanking markers;1 - by flanking markers 2;4 60242455;221211532 95618891;221211601 1 - by flanking markers;1 - by flanking markers 2;4 41179255;154125111 75896315;154125180 1 - by flanking markers;1 - by flanking markers X;2;4 46603085;41243963;154786975 46603120;74997963;154787045 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_1549794
1549795 SS.LEW-(D2Rat199-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 41032071 106236206 1 - by flanking markers 2 60242455 125885146 1 - by flanking markers 2 41179255 106156987 1 - by flanking markers 2 41243963 103519040 1 - by flanking markers RRID:RGD_1549795
1549796 BN/2Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16 National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo RRID:RGD_1549796
1549797 BUF.ACI-(D16Rat31-D16Arb1)/Ncc This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method. National BioResource Project for the Rat in Japan congenic Unknown 16 8340080 8340453 1 - by flanking markers 16 11019972 11020174 1 - by flanking markers 16 9055590 9055792 1 - by flanking markers 16 8082906 8083107 1 - by flanking markers RRID:RGD_1549797
1549798 BB.PVG-RT1u/a/Tky A congenic strain with the genetic background of the BB/WorTky strain (RT1.Bu,Du ) onto which the MHC locus of PVG.R23 strain (RT1.B,D) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1549798
1549799 BB.SHR-(D6Rat184-D6Rat3)/K Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Metabolism 6 121381065 145279536 1 - by flanking markers 6 130448688 154782041 1 - by flanking markers 6 121224054 145868598 1 - by flanking markers 6 116506292 138922889 1 - by flanking markers RRID:RGD_1549799
1549800 BN/KunKtsSlc Kitasato University School of Medicine to Slc (2001) This strain is no longer available from NBRP-Rat (June 2022). mutant Unknown (as of 2022-06-09) Metabolism RRID:RGD_1549800
1549801 BN/Seac Seac Yoshitomi, LTD, Fukuoka, Japan Seac Yoshitomi, LTD, Fukuoka, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Behavior; Ophthalmology RRID:RGD_1549801
1549802 BN/1Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15 National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1549802
1549803 ACI-Lystbg-Kyo/Kyo Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999. National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Hematology RRID:RGD_1549803
1549804 BUF/NacJcl CLEA Japan, Inc., Tokyo Japan Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan inbred Unknown RRID:RGD_1549804
1549805 BUF.Cg-Foxn1rnu/Mna BUF/Mna, NN1H-Rnu/Rnu National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Urology RRID:RGD_1549805
1549806 BUF.ACI-(D3Rat56-D3Rat83)/Ncc This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 3 3577905 42635088 1 - by flanking markers 3 2612834 52104192 1 - by flanking markers 3 2631421 46996487 1 - by flanking markers 3 8227194 45391731 1 - by flanking markers RRID:RGD_1549806
1549808 SS.LEW-(Prlr-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown Prlr 3407 2 59507966 106236206 1 - by flanking markers 2 84360850 125885146 1 - by flanking markers 2 60131410 106156987 1 - by flanking markers 2 59134147 103519040 1 - by flanking markers RRID:RGD_1549808
1549809 BN/KtsSlc Kitasato University School of Medicine to Slc (2002) This strain is no longer available from NBRP-Rat (June 2022). inbred Unknown (as of 2022-06-09) Immunology RRID:RGD_1549809
1549810 AI/Msik amelogenesis imperfecta rat This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry RRID:RGD_1549810
1549811 ACI/NJcl ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan. Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1549811
1549813 F344.ACI-Lmx1aqc/Kyo Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, âqueue courteâ in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner. Institute of Laboratory Animals at Kyoto University, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12) Apoa2|Selp|Lmx1a 2131|3656|1304784 13 79886614 87116372 1 - by flanking markers 13 87308435 94225670 1 - by flanking markers 13 82428914 89598805 1 - by flanking markers 13 76476229 83646358 1 - by flanking markers RRID:RGD_1549813
1554301 WKHA/Bord Strain was originated from WHHA/Edh at the University of Vermont College of Medicine Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France inbred Unknown RRID:RGD_1554301
1554302 HOB-Unc5chob/Snk hobble rat Homozygous hobble rats that were taken from the inbred hobble rat colony. National BioResource Project for the Rat in Japan mutant Unknown Unc5c|Unc5chob 735109|12802353 2 239365109 239721231 7 2 265573406 265926229 7 2 247045813 247397483 7 2 230180353 230535219 7 RRID:RGD_1554302
1554303 CVD/Opu Cerebellar vermis defect rat Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates. Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan mutant Unknown Unc5c 735109 2 239365109 239721231 7 2 265573406 265926229 7 2 247045813 247397483 7 2 230180353 230535219 7 RRID:RGD_1554303
1554304 GAERS/Mave Genetic Absence Epilepsy Rats from Strasbourg 30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1554304
1554305 DA-Tg(CAG-lacZ)30Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RRRC_00295
1554306 GK/Slc Goto Kakizaki Rat Spontaneous mutant GK rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan mutant Live Animals Diabetes Obesity RRID:RGD_1554306
1554307 W-Tg(LAC3)Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase. YS New Technology Institute, Tochigi, Japan transgenic Unknown RRID:RGD_1554307
1554308 Gunn-Ugt1a1j/Slc Gunn Segregated inbred Gunn rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan segregating_inbred Live Animals Neurobiology; Metabolism Ugt1a1j 13432064 RRID:RGD_1554308
1554309 W-Tg(CAG-GFP)184Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00259
1554310 DA-Tg(CAG-lacZ)19Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00294
1556748 F344/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_1556748
1558660 SHRSP/Tkyo Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558660
1558661 WKY/Tkyo Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558661
1558662 SHR/Tkyo Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558662
1559030 LEC-Tg(ATP7B)Tohm A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1559030
1559031 NE/Mave The control strain of GAERS, free of any spontaneous spike and wave discharges. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1559031
1559032 SS.LEW-(D17Rat65-D17Chm2)/Ayd This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 82247891 93930006 1 - by flanking markers 17 76483116 88435496 1 - by flanking markers 17 74823053 86731080 1 - by flanking markers 17 70973784 82479847 1 - by flanking markers RRID:RGD_1559032
1559033 SS.LEW-(D17Rat65-Prl)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown Prl 3403 17 44699101 93930006 1 - by flanking markers 17 41720751 88435496 1 - by flanking markers 17 39814236 86731080 1 - by flanking markers 17 37859999 82479847 1 - by flanking markers RRID:RGD_1559033
1559034 SS.LEW-(D17Chm14-D17Rat97)/Ayd This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 80182186 1 - by flanking markers 17 60264084 74265481 1 - by flanking markers 17 58467778 72580782 1 - by flanking markers 17 62109333 68784138 1 - by flanking markers RRID:RGD_1559034
1559035 SS.LEW-(D17Chm14-D17Rat181)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 38257211 80182186 1 - by flanking markers 17 35100574 74265481 1 - by flanking markers 17 33208959 72580782 1 - by flanking markers 17 31896010 68784138 1 - by flanking markers RRID:RGD_1559035
1559036 LEW/Jms Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) RRID:RRRC_00054
1559037 SS.LEW-(D17Chm9-D17Rat97)/Ayd This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 83074398 1 - by flanking markers 17 60264084 77361330 1 - by flanking markers 17 58467778 75705622 1 - by flanking markers 17 62109333 71774817 1 - by flanking markers RRID:RGD_1559037
1559039 ODS/Shi Osteogenic disorder Shionogi Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. Shionogi & Co., Ltd. Japan mutant Unknown RRID:RGD_1559039
1559040 MD/Tama myelin deficient rat X-linked mutant of the Wistar rat. National BioResource Project for the Rat in Japan mutant Live Animals Neurobiology; Development RRID:RGD_1559040
1559041 SHRSP/Ngsk Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension; Osteosis RRID:RGD_1559041
1559042 SHR/Nig Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Pharmacology RRID:RGD_1559042
1559043 MV/Opu myelin vacuolation rat The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrnmv 40902835 3 118539268 118701177 7 3 129934303 130067267 7 3 123434409 123567922 7 3 118110320 118244326 7 RRID:RGD_1559043
1559044 SS.SR-(D3Mco19-D3Mco5)/Jr A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Edn3 2534 7;3 23312460;147799021 23312636;167653069 1 - by flanking markers;1 - by flanking markers 7;3 27325365;158391833 27325541;183008351 1 - by flanking markers;1 - by flanking markers 3;7 153327515;27206010 153327695;27206186 1 - by flanking markers;1 - by flanking markers 3;7 145871677;21089863 145871858;21090040 1 - by flanking markers;1 - by flanking markers RRID:RGD_1559044
1559045 LEW/Crlc LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada Charles River Laboratories, La Salle, Quebec, Canada inbred Unknown RRID:RGD_1559045
1559046 SHR-Chr YW/K Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996. National BioResource Project for the Rat in Japan consomic Unknown RRID:RGD_1559046
1559047 SHRSP/Ezo Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension RRID:RGD_1559047
1559048 SHR.ODS-Gulood/Shi A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Osteosis Gulo 620701 RRID:RGD_1559048
1566430 SimTac:LE Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock. Taconic outbred Unknown RRID:RGD_1566430
1566431 BN/MolTac The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003. Taconic inbred Unknown RRID:RGD_1566431
1566432 WKY/NMolTac Wistar Kyoto The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit. Taconic inbred Unknown RRID:RGD_1566432
1566433 HanTac:WH In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000. Taconic outbred Unknown RRID:RGD_1566433
1566434 NTac:SHR Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. Taconic outbred Unknown RRID:RGD_1566434
1566437 SS-Chr XBN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_1566437
1566438 DA/MolTac Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004. Taconic inbred Unknown RRID:RGD_1566438
1566439 F344/NTac Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH. Taconic inbred Unknown RRID:RGD_1566439
1566440 NTac:SD Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies. Taconic outbred Unknown RRID:RGD_1566440
1566443 LEW/MolTac Lewis Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived. Taconic inbred Unknown RRID:RGD_1566443
1566444 MolTac:SD The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993. Taconic outbred Unknown RRID:RGD_1566444
1566445 ACI.BN-(D5Mgh17-D5Rat205)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Extinct 5 14730738 14730949 1 - by flanking markers 5 19190627 19190837 1 - by flanking markers 5 14408903 14409113 1 - by flanking markers 5 14529225 14529436 1 - by flanking markers RRID:RGD_1566445
1566447 GK/MolTac Goto-Kakizaki The Goto-Kakizaki inbred model was developed by Tohoku University in 1975. Aarhus University Hospital in Denmark received stock in 1994. M&B A/S (now Taconic Europe) received stock from Aarhus in 1997. The rats were derived by embryo transfer in 2005 at Taconic US. inbred Unknown RRID:RGD_1566447
1566448 FHH-Chr 9BN/Mcwi A FHH genomic background with a BN chromosome 9 introgressed. PhysGen consomic Cryopreserved Sperm RRID:RGD_1566448
1566453 SD-Tg(HIV-LacZ)AngRrrc Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00049
1566454 BDIV/Zte BDIV/Zte derived from Berlin-Druckrey strain BDIV Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566454
1566455 HTX/HcjRrrc Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00050
1566456 BDIX/Zte derived from Berlin-Druckrey strain BDIX Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566456
1566457 SPRD Sprague-Dawley From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990). unknown inbred Unknown RRID:RGD_1566457
1566458 F344-Tg(ROSA26-ALPP)EpsRrrc F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP). Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 RRID:RRRC_00048
1566459 F344-Tg(ROSA26-EGFP)Eps F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP). Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin transgenic Unknown RRID:RGD_1566459
1566460 SD-Tg(ICAM2-DAF)AngRrrc Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00051
1578692 BN.LEW-(D10Rat32-D10Rat116)/Ciml Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 54220239 1 - by flanking markers 10 53381898 53807373 1 - by flanking markers 10 53630865 54057745 1 - by flanking markers 10 51779662 52200160 1 - by flanking markers RRID:RGD_1578692
1578693 LEW.BN-(D10Mco17-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578693
1578694 AT Alcohol-Tolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00076
1578695 SHA/BruRrrc Syracuse High Avoidance Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00068
1578696 LAS1 Low Alcohol Sensitive strain 1 Selectively bred for 24 generations for low sensitivity to ethanol then inbred. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00080
1578697 BN.LEW-(D10Rat32-D10Rat31)/Ciml Congenic strain was bred from BN.LEW-(D10Rat32-D10Rat221)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53616237 53786515 1 - by flanking markers 10 53216481 53382065 1 - by flanking markers 10 53465198 53631032 1 - by flanking markers 10 51611529 51779830 1 - by flanking markers RRID:RGD_1578697
1578698 LAS2 Low Alcohol Sensitive strain 2 Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00081
1578699 BG anemic Belgrade These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00072
1578700 HAS1 High Alcohol Sensitive strain 1 Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00077
1578701 HAS2 High Alcohol Sensitive strain 2 Selectively bred for high ethanol sensitivity for 24 generations, then inbred. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00079
1578702 LEW.BN-(D10Rat32-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1578702
1578703 SLA/BruRrrc Syracuse Low Avoidance Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00069
1578704 WLP Warsaw Low Prefering These were bred from albino stock of Wistar rats as lines that had low ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578704
1578705 LEW.BN-(D10Arb4-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 65668639 1 - by flanking markers 10 46591952 64823355 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1578705
1578706 LEW.BN-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578706
1578708 LEW.BN-(D10Mgh7-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 56171177 1 - by flanking markers 10 55720558 55720772 1 - by flanking markers 10 55978483 55978697 1 - by flanking markers 10 54098674 54098889 1 - by flanking markers RRID:RGD_1578708
1578709 IA incisor absent These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00064
1578710 LEW.1AR1-iddm/Ztm arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.AaB/DuCu) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany coisogenic Unknown Dock8m1Ztm 13830868 RRID:RGD_1578710
1578711 LEW.BN-(D10Mco17-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 65668639 1 - by flanking markers 10 44914976 64823355 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578711
1578712 BN.LEW-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578712
1578713 BN/Ztm substrain of BN Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany inbred Unknown RRID:RGD_1578713
1578714 BN.LEW-(D10Mco17-D10Rat80)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 61798393 1 - by flanking markers 10 44914976 61030524 1 - by flanking markers 10 45157430 61300905 1 - by flanking markers 10 43593509 59378278 1 - by flanking markers RRID:RGD_1578714
1578715 ANT Alcohol-Nontolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Gabra6 61861 RRID:RRRC_00078
1578716 LEW.1AR1/Ztm Lewis strain containing MHC haplotype RT1.AaB/DuCu Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany congenic Unknown RRID:RGD_1578716
1578717 WHP Warsaw High Prefering These were bred from albino stock of Wistar rats as lines that had ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578717
1579677 FHH-Maddm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Maddm1Mcwi 1578796 3 75498321 75541073 7 3 86669054 86711776 7 3 79960301 80003023 7 3 77114330 77157865 7 RRID:RGD_1579677
1579678 ACI.FHH-(D3Wox2-D3Rat59)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Live Animals; Cryopreserved Sperm 3 46419462 163443738 1 - by flanking markers 3 57173123 176609927 1 - by flanking markers 3 50533100 170534769 1 - by flanking markers 3 49162911 161299569 1 - by flanking markers RRID:RGD_1579678
1579680 Wild/Tku Wild These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed. Caught in Tokyo wild Unknown RRID:RGD_1579680
1579681 BN-Birc3m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. PhysGen mutant Extinct (as of 2016-10-24) Birc3m1Mcwi 1578788 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1579681
1579682 FHH-Tlr4m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tlr4m1Mcwi 1578785 5 83564100 83577735 7 5 86690670 86704302 7 5 82587424 82601056 7 5 80145867 80159501 7 RRID:RRRC_00411
1579683 FHH-Ghsrm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm1Mcwi 1578794 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00405
1579684 FHH-Slc8a2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc8a2m1Mcwi 1578786 1 76473938 76498624 7 1 79296259 79320746 7 1 78029555 78054042 7 1 76816583 76852928 7 RRID:RRRC_00404
1579685 FHH-Tgfbr2m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tgfbr2m2Mcwi 1578782 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RRRC_00400
1579686 GH/OmrMcwi This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then. PhysGen inbred Live Animals; Cryopreserved Embryo RRID:RGD_1579686
1579687 FHH-Procm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Procm1Mcwi 1578790 18 24563368 24573715 7 18 24633206 24643623 7 18 24918402 24928822 7 18 23764367 23774816 7 RRID:RRRC_00410
1579688 BN-Tgfbr2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. PhysGen mutant Extinct (as of 2017-01-26) Tgfbr2m1Mcwi 1578800 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RGD_1579688
1579689 FHH-F10m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m1Mcwi 1578783 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00401
1579690 FHH-Slc27a5m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated. PhysGen mutant Extinct (as of 2017-01-26) Slc27a5m1Mcwi 1578799 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1579690
1579691 SS.SHR-(D11Mgh3-D11Rat31)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 11 8176272 68234949 1 - by flanking markers 11 10373455 72739854 1 - by flanking markers 11 6673351 69649875 1 - by flanking markers 11 8200022 66422316 1 - by flanking markers RRID:RGD_1579691
1579692 FHH-Lcatm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm1Mcwi 1578793 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00402
1579693 T2DN/Mcwi Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin inbred Unknown RRID:RGD_1579693
1579694 FHH-Egln3m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Egln3m1Mcwi 1578781 6 74451038 74476506 7 6 84592894 84618360 7 6 75050329 75075795 7 6 71650297 71675766 7 RRID:RRRC_00409
1579695 ACI.FHH-(D1Rat298-D1Rat90)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 225625031 267111153 1 - by flanking markers 1 247303036 289137268 1 - by flanking markers 1 240017117 281795785 1 - by flanking markers 1 219932573 259647894 1 - by flanking markers RRID:RGD_1579695
1579696 SS.SHR-(D6Wox13-D6Rat84)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 6 136451997 136452267 1 - by flanking markers 6 144273721 144273990 1 - by flanking markers 6 136142742 136143011 1 - by flanking markers 6 130729205 130729475 1 - by flanking markers RRID:RGD_1579696
1579697 SS.SHR-(D13Rat63-D13Mit1)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 13 25430110 80482429 1 - by flanking markers 13 14281836 87877411 1 - by flanking markers 13 9016742 82995671 1 - by flanking markers 13 5994668 77046890 1 - by flanking markers RRID:RGD_1579697
1579698 FHH-Adra1am1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Adra1am1Mcwi 1578792 15 46173429 46263198 7 15 48197628 48297316 7 15 43296997 43398314 7 15 40830125 40935902 7 RRID:RRRC_00408
1579699 WKY.WKHA-(D5Rat45-D5Rat245)/Cfd WKY.WKHA-(D5Rat45-D5Rat245)/Cfd This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA congenic Unknown 5 159265355 159265706 1 - by flanking markers 5 162571275 162571427 1 - by flanking markers 5 158854038 158854190 1 - by flanking markers 5 152630083 152630236 1 - by flanking markers RRID:RGD_1579699
1579700 ACI.FHH-(D1Rat475-D1Rat90)(D3Rat84-D3Rat59)/Eur Double congenic strain from backcross of ACI.FHH-(D1Rat298-D1Rat90)/Eur and ACI.FHH-(D3Wox2-D3Rat59)/Eur. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1579700
1579701 BN-Nos1m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Nos1m1Mcwi 1578795 12 39812500 39869484 7 12 46049288 46209569 7 12 44214949 44405530 7 12 38615111 38795492 7 RRID:RGD_1579701
1579702 SS.SHR-(D9Wox16-D9Rat64)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 9 21667066 21667256 1 - by flanking markers 9 27914255 97338238 1 - by flanking markers 9 29075079 97647719 1 - by flanking markers 9 25268044 91090963 1 - by flanking markers RRID:RGD_1579702
1579703 SS.SHR-(D2Rat61-D2Mco18)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 2 79796833 227150249 1 - by flanking markers 2 88594475 100298539 1 - by flanking markers 2 68865414 80632096 1 - by flanking markers 18;2 79924734;78665619 79925127;78665763 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579703
1579704 FHH-Agtr1bm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b. PhysGen, Rat Resource & Research Center mutant Extinct (as of 2016-11-29) Agtr1bm1Mcwi 1578784 2 105503269 105602591 7 2 124879262 124954378 7 2 105149020 105224335 7 2 102844969 102920232 7 RRID:RGD_1579704
1579705 FHH-Nr0b2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nr0b2m1Mcwi 1578798 5 151524685 151528000 7 5 155465275 155468590 7 5 151776004 151779319 7 5 145779294 145782609 7 RRID:RRRC_00403
1579706 FHH-Nr4a1m1Mcwi Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. PhysGen mutant Cryopreserved Sperm (as of 2017-01-26) Nr4a1m1Mcwi 1578791 7 140012807 140020590 7 7 140700242 140721073 7 7 142899358 142920216 7 7 132368399 132389300 7 RRID:RGD_1579706
1579707 FHH-Adipoqm2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm2Mcwi 1578797 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00407
1579708 FHH-Desm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Desm1Mcwi 1578801 9 74637783 74645499 7 9 82325835 82333549 7 9 82556574 82564288 7 9 76850979 76858695 7 RRID:RGD_1579708
1579709 Wild/Mcwi Wild These rats were caught wild in Milwaukee, used for experiments and then sacrificed. Caught in Milwaukee wild Unknown RRID:RGD_1579709
1579710 GK/Far Goto-Kakizaki Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. James A. Haley Veterans Hospital, Tampa Florida inbred Unknown RRID:RGD_1579710
1579711 FHH-Adipoqm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm1Mcwi 1578787 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00406
1579712 FHH-Klf6m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Klf6m1Mcwi 1578789 17 75578498 75585072 7 17 69616967 69674031 7 17 67887939 67945052 7 17 64539456 64548451 7 RRID:RGD_1579712
1579894 SS.LEW-(D10Rat204-D10Rat9)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 94837236 99588446 1 - by flanking markers 10 93421499 93421719 1 - by flanking markers 10 93662786 93663006 1 - by flanking markers 10 90404397 90404618 1 - by flanking markers RRID:RGD_1579894
1579895 FHH-Bdkrb2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated. PhysGen mutant Extinct (as of 2016-10-24) Bdkrb2m1Mcwi 1579889 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1579895
1579896 SS.LEW-(D2Rat18-D2Chm277)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 40912197 56722286 1 - by flanking markers 2 60126669 76472773 1 - by flanking markers 2 41063439 56736627 1 - by flanking markers 2 41125789 56532139 1 - by flanking markers RRID:RGD_1579896
1579897 SS.SR-(D9Rat69-D9Mco14)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9 66679876 74437140 1 - by flanking markers 9 74640722 82125547 1 - by flanking markers 9 74858383 82356286 1 - by flanking markers 9 69371595 76650886 1 - by flanking markers RRID:RGD_1579897
1579898 SS.LEW-(D10Chm128-D10Chm121)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 71365656 1 - by flanking markers 10 69272915 71014829 1 - by flanking markers 10 69638898 70499629 1 - by flanking markers 10 67232398 68082614 1 - by flanking markers RRID:RGD_1579898
1579899 SS.LEW-(D5Rat130-D5Rat31)/JrMcwi SS.LEW-(D5Rat130-D5Rat31)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 139996194 1 - by flanking markers 5 36590997 142265366 1 - by flanking markers 5 31926122 138454239 1 - by flanking markers 5 31663789 133011550 1 - by flanking markers RRID:RGD_1579899
1579900 SS.SR-(D9Rat89-Resp18)/Mco Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 72257996 74558151 1 - by flanking markers 9 80172493 82246695 1 - by flanking markers 9 80400409 82477136 1 - by flanking markers 9 74701668 76771824 1 - by flanking markers RRID:RGD_1579900
1579901 SS.LEW-(D10Chm224-D10Chm6)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76000447 1 - by flanking markers 10 75100237 76438561 1 - by flanking markers 10 75001953 76556637 1 - by flanking markers 10 72508825 72509024 1 - by flanking markers RRID:RGD_1579901
1579902 SS.LEW-(D5Rat130-D5Rat108)/JrMcwi SS.LEW-(D5Rat130-D5Rat108)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_1579902
1579903 SS.LEW-(D10Chm10-D10Rat11)/Ayd A congenic substrain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 97152234 100633982 1 - by flanking markers 10 95701164 99184250 1 - by flanking markers 10 95967019 99492409 1 - by flanking markers 10 92698959 96121100 1 - by flanking markers RRID:RGD_1579903
1579904 SS.SR-(D9Mgh11-D9Mco33)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 10 86983905 86984155 1 - by flanking markers 10 85965754 85966003 1 - by flanking markers 10 86168841 86169090 1 - by flanking markers 10 83212828 83213078 1 - by flanking markers RRID:RGD_1579904
1579905 SS.SR-(D9Rat89-D9Mco27)/Mco Congenic strain derived from parental strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9;10 72257996;76477677 72258219;76477875 1 - by flanking markers;1 - by flanking markers 9;10 80172493;74600366 80172715;74600564 1 - by flanking markers;1 - by flanking markers 9;10 80400409;75505821 80400631;75506019 1 - by flanking markers;1 - by flanking markers 9;10 74701668;72976092 74701891;72976291 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579905
1579906 FHH-Adipoqm3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm3Mcwi 1579887 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00414
1579907 SS.LEW-(D10Chm128-D10Chm169)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 70654393 1 - by flanking markers 10 69272915 69442411 1 - by flanking markers 10 69638898 69809020 1 - by flanking markers 10 67232398 67400546 1 - by flanking markers RRID:RGD_1579907
1579908 SS.SR-(D9Mco95-Resp18)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80867159 82246695 1 - by flanking markers 9 81100315 82477136 1 - by flanking markers 9 75403227 76771824 1 - by flanking markers RRID:RGD_1579908
1579909 FHH-Fgl2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. PhysGen mutant Extinct (as of 2017-01-26) Fgl2m1Mcwi 1579885 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1579909
1579910 FHH-Ccr2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccr2m1Mcwi 1579888 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RRRC_00399
1579911 SS.LEW-(D5Rat130-D5Rat72)/Mcwi SS.LEW-(D5Rat130-D5Rat72)/Mcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 120983466 1 - by flanking markers 5 36590997 123028200 1 - by flanking markers 5 31926122 119125145 1 - by flanking markers 5 31663789 114973531 1 - by flanking markers RRID:RGD_1579911
1579912 FHH-F10m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m2Mcwi 1579886 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00412
1579913 SS.LEW-(D10Chm224-D10Chm222)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76477875 1 - by flanking markers 10 74600366 76309841 1 - by flanking markers 10 75505821 75506019 1 - by flanking markers 10 72976092 72976291 1 - by flanking markers RRID:RGD_1579913
1579914 SS.LEW-(D10Mco30-D10Got92)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 77956387 1 - by flanking markers 10 73693979 76919627 1 - by flanking markers 10 76420583 77055888 1 - by flanking markers 10 73887148 74372232 1 - by flanking markers RRID:RGD_1579914
1580542 PCK-Pkhd1pck/CrljCrl This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). Charles River Laboratories coisogenic Unknown Pkhd1pck 11535943 RRID:RGD_1580542
1581616 DA.ACI-(D15Rat23-D15Rat71)/Kini DA.ACI-(D15Rat23-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 83040937 85456512 1 - by flanking markers 15 87155990 89768452 1 - by flanking markers 15 83647062 86002030 1 - by flanking markers 15 76003569 78330139 1 - by flanking markers RRID:RGD_1581616
1581617 SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas Texas transgenic Unknown RRID:RGD_1581617
1581618 SHRSP/Bbb This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581618
1581619 BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_1581619
1581620 SS.SR-(D9Mco61-D9Mco27)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_1581620
1581621 DA.ACI-(D15Rat6-D15Rat48)/Kini DA.ACI-(D15Rat6-D15Rat48)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 61161186 1 - by flanking markers 15 37103190 65959514 1 - by flanking markers 15 33219101 62301382 1 - by flanking markers 15 28030665 55302115 1 - by flanking markers RRID:RGD_1581621
1581622 SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas, Texas; Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-17) RRID:RRRC_00318
1581623 LA/Humd low autotomy Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581623
1581624 FHH-Lipem1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA. PhysGen mutant Extinct (as of 2017-01-26) Lipem1Mcwi 1581495 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1581624
1581625 BN-Hand1m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC. PGA mutant Unknown Hand1m1Mcwi 1581493 10 43423366 43425933 7 10 43050068 43052635 7 10 43250729 43253296 7 10 42006646 42009213 7 RRID:RGD_1581625
1581626 FHL/EurMcwi Fawn Hooded Low blood pressure The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage. PGA inbred Unknown RRID:RGD_1581626
1581627 WF.WKY-(D5Uwm66-D5Uwm67)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 73080117 79919776 1 - by flanking markers 5 76105513 82897734 1 - by flanking markers 5 71940894 78777811 1 - by flanking markers 5 69927283 76370048 1 - by flanking markers RRID:RGD_1581627
1581628 DA.ACI-(D15Rat6-D15Rat13)/Kini DA.ACI-(D15Rat 6-D15Rat13)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 43772355 1 - by flanking markers 15 37103190 51565184 1 - by flanking markers 15 33219101 47814460 1 - by flanking markers 15 28030665 38692741 1 - by flanking markers RRID:RGD_1581628
1581629 WF.WKY-(D5Wox8-D5Uwm62)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 4291144 61238981 1 - by flanking markers 5 4498411 64739489 1 - by flanking markers 5 4525738 60225339 1 - by flanking markers 5 5112159 58973694 1 - by flanking markers RRID:RGD_1581629
1581630 WF.WKY-(D5Uwm63-D5Uwm64)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 62299211 1 - by flanking markers 5 61271852 65886550 1 - by flanking markers 5 56733010 61370302 1 - by flanking markers 5 55564549 60051321 1 - by flanking markers RRID:RGD_1581630
1581631 WF.WKY-(D5Uwm61-D5Uwm37)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 130527490 1 - by flanking markers 5 87362775 132652105 1 - by flanking markers 5 83268986 128812854 1 - by flanking markers 5 80813116 123935338 1 - by flanking markers RRID:RGD_1581631
1581632 WF.WKY-(D5Uwm65-D5Uwm60)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 65553185 76159022 1 - by flanking markers 5 72838045 79426001 1 - by flanking markers 5 68395096 75274687 1 - by flanking markers 5 63190890 72943679 1 - by flanking markers RRID:RGD_1581632
1581633 DA.ACI-(D15Rat6-D15Rat71)/Kini DA.ACI-(D15Rat6-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 85456512 1 - by flanking markers 15 37103190 89768452 1 - by flanking markers 15 33219101 86002030 1 - by flanking markers 15 28030665 78330139 1 - by flanking markers RRID:RGD_1581633
1581634 BN-Adora2am1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2am1Mcwi 1581476 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1581634
1581635 WKY/Bbb This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581635
1581636 BN-Cebpem1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG. PGA mutant Unknown Cebpem1Mcwi 1581494 15 32787946 32789344 7 15 37241081 37242479 7 15 33356119 33357517 7 15 28169711 28171471 7 RRID:RGD_1581636
1581637 FHH-Has1m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG. PhysGen mutant Extinct (as of 2017-01-26) Has1m1Mcwi 1581477 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1581637
1581638 DA.ACI-(D15Rat126-D15Rat71)/Kini DA.ACI-(D15Rat126-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 85456315 85456512 1 - by flanking markers 15 86610850 89768452 1 - by flanking markers 15 83094829 86002030 1 - by flanking markers 15 75448637 78330139 1 - by flanking markers RRID:RGD_1581638
1581639 HAn/Humd high autotomy new Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581639
1581640 HA/Humd high autotomy High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581640
1581641 WF.WKY-(D5Uwm68-D5Mit4)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 77277626 94516069 1 - by flanking markers 5 80544432 97315322 1 - by flanking markers 5 76401130 93273395 1 - by flanking markers 5 74047272 90450412 1 - by flanking markers RRID:RGD_1581641
1581642 FHH-Ccr4m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA. PhysGen mutant Extinct (as of 2017-01-26) Ccr4m1Mcwi 1581492 8 118883148 118884230 7 8 121843005 121848545 7 8 122530152 122535959 7 8 114176291 114182033 7 RRID:RGD_1581642
1581643 LAn/Humd low autotomy new Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581643
1581644 FHH-Htr1am1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Htr1am1Mcwi 1581496 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RRRC_00413
1581645 LL/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_1581645
1582184 SR/JrHsd Dahl Salt-Resistant Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Envigo inbred Unknown RRID:RGD_1582184
1582185 SS.SR-(D3Mco36-D3Got166)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 166484910 171009778 1 - by flanking markers 3 178896560 181074971 1 - by flanking markers 3 172850273 177366660 1 - by flanking markers 3 163556062 168974694 1 - by flanking markers RRID:RGD_1582185
1582186 FHH.FHH.1BN-(D1Rat183-D1Rat76)/Mcwi FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 131123181 230411453 1 - by flanking markers 1 138077032 252243871 1 - by flanking markers 1 137083889 244992610 1 - by flanking markers 1 129384185 224569684 1 - by flanking markers RRID:RGD_1582186
1582187 SS.SR-(D3Mco24-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 166525892 1 - by flanking markers 3 160026579 178936339 1 - by flanking markers 3 155586270 172890235 1 - by flanking markers 3 147739514 163596045 1 - by flanking markers RRID:RGD_1582187
1582188 SS.SR-(D3Mco36-D3Mco46)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA, Rat Resource and Research Center, congenic Cryopreserved Sperm (as of 2019-02-18) 3 168983202 171009778 1 - by flanking markers 3 181074759 181830490 1 - by flanking markers 3 175283587 177366660 1 - by flanking markers 3 167003822 168974694 1 - by flanking markers RRID:RRRC_00660
1582189 SS.SR-(D3Mco39-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 149823173 1 - by flanking markers 3 160026579 180014700 1 - by flanking markers 3 155586270 176305870 1 - by flanking markers 3 147739514 167914627 1 - by flanking markers RRID:RGD_1582189
1582190 SS/JrHsd Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Envigo inbred Unknown RRID:RGD_1582190
1582191 FHH.FHH.1BN-(D1Rat287-D1Rat84)/Mcwi FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 190114247 259322833 1 - by flanking markers 1 208389496 281400240 1 - by flanking markers 1 201358068 273987019 1 - by flanking markers 1 185356336 252280168 1 - by flanking markers RRID:RGD_1582191
1582192 SS.SR-(D3Mco36-D3Got159)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 162807724 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_1582192
1582193 FHH.FHH.1BN-(D1Mgh13-D1Rat89)/Mcwi FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 252340389 265343617 1 - by flanking markers 1 274224224 287349830 1 - by flanking markers 1 266793821 279986079 1 - by flanking markers 1 245907761 257976495 1 - by flanking markers RRID:RGD_1582193
1582194 SS.SR-(D3Mco78-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 164079729 1 - by flanking markers 3 160026579 177341735 1 - by flanking markers 3 155586270 171277347 1 - by flanking markers 3 147739514 161994638 1 - by flanking markers RRID:RGD_1582194
1582195 FHH.FHH.1BN-(D1Rat173F6B-D1Rat84)/Mcwi FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 259322503 259322833 1 - by flanking markers 1 281400069 281400240 1 - by flanking markers 1 273986848 273987019 1 - by flanking markers 1 252279996 252280168 1 - by flanking markers RRID:RGD_1582195
1582196 FHH.FHH.1BN-(D1Rat234-D1Rat265)/Mcwi FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 41225047 90449243 1 - by flanking markers 1 95453405 95453561 1 - by flanking markers 1 94364073 94364229 1 - by flanking markers 1 90664883 90665040 1 - by flanking markers RRID:RGD_1582196
1598797 WF.WKY-(D10Got124-D10Rat187)/Uwm WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL. Department of Oncology, University of Wisconsin, Madison Wisconsin congenic Unknown 10 89575059 110385665 1 - by flanking markers 10 88338460 109941891 1 - by flanking markers 10 88544136 110355174 1 - by flanking markers 10 85565469 106428971 1 - by flanking markers RRID:RGD_1598797
1598798 BBDP/WorN Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00092
1598799 ACI.FHH-(D1Rat384-D1Rat452)(D17Rat61-D1Arb5)(D17Rat51)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598799
1598800 ACI.FHH-(D1Rat384-D1Rat156)/Eur Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229184432 253410500 1 - by flanking markers 1 250993318 279213254 1 - by flanking markers 1 243737319 243737466 1 - by flanking markers 1 223390805 223390953 1 - by flanking markers RRID:RGD_1598800
1598801 ACI.FHH-(D1Mit18-D1Mit8)(D14Mit11-D14Hmgc14b)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598801
1598802 BBDR/WorN Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00094
1598803 BBNB/WorN Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr, Rat Resource and Research Center inbred Unknown (as of 2020-02-24) RRID:RRRC_00093
1598804 WKY.GHS-(D1Rat32-D1Mit32) GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL Department of Medicine and Physiology, University of Rochester, Rochester New York congenic Unknown 1 112148733 250430505 1 - by flanking markers 1 202649657 272443364 1 - by flanking markers 1 195598053 265002735 1 - by flanking markers 1 244113147 244113296 1 - by flanking markers RRID:RGD_1598804
1599674 BBDP.WF-(D8Rat59-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 112242639 128970675 1 - by flanking markers 8 115112735 132425312 1 - by flanking markers 8 133272922 133273132 1 - by flanking markers 8 123815688 123815899 1 - by flanking markers RRID:RGD_1599674
1599675 BBDP.WF-(D13Rat124-D13Mgh5)/Sunn The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line. Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown Ptprc 3451 13 46721037 63301552 1 - by flanking markers 13 55662705 71178960 1 - by flanking markers 13 50609228 66204630 1 - by flanking markers 13 45228358 61058078 1 - by flanking markers RRID:RGD_1599675
1599755 F344.BN-(D16Mit5-D16Rat75) BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy congenic Unknown 16 24131965 24132402 1 - by flanking markers 16 24112631 24112769 1 - by flanking markers 16 24228228 24228366 1 - by flanking markers 16 22477482 22477621 1 - by flanking markers RRID:RGD_1599755
1599756 BN-Has2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. PGA mutant Unknown Has2m1Mcwi 1599566 7 93230135 93256139 7 7 97055458 97081461 7 7 96438046 96464049 7 7 88113326 88139337 7 RRID:RGD_1599756
1599757 BN-Adora2am2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2am2Mcwi 1599561 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1599757
1599758 SS-Sod3m1Mcwi Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2021-11-03) Sod3m1Mcwi 1599567 14 63381447 63387180 7 14 61071304 61083776 7 14 60958583 60971143 7 14 58610104 58615845 7 RRID:RRRC_00415
1599759 GRY/Idr groggy rat Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003. National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) Neurobiology Cacna1agry 12880382 19 25188170 25424495 7 19 36502533 36727039 7 19 25627751 25627751 8 19 23644553 23644553 8 RRID:RGD_1599759
1599760 SPRD.WKY-(D18Wox8-D18Rat44)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 18 19892650 86863412 1 - by flanking markers 18 20030289 86114102 1 - by flanking markers 18 20285758 87080053 1 - by flanking markers 18 19278901 83218561 1 - by flanking markers RRID:RGD_1599760
1599761 BN-Lcatm2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG. PGA mutant Unknown Lcatm2Mcwi 1599570 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1599761
1599762 SS-Bdkrb2m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA. PGA mutant Unknown Bdkrb2m2Mcwi 1599568 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1599762
1599763 SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 5 24978084 24978263 1 - by flanking markers 5 29109097 29109277 1 - by flanking markers RRID:RGD_1599763
1599764 COP.DA-(D16Rat12-D16Rat90)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 16 380245 80345693 1 - by flanking markers RRID:RGD_1599764
1599765 SS-Klf4m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC. PGA mutant Unknown Klf4m2Mcwi 1599559 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599765
1599766 SS-Hps6m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG. PGA mutant Unknown Hps6m1Mcwi 1599564 1 251226344 251228953 7 1 273191755 273194364 7 1 265761818 265764427 7 1 244853256 244855865 7 RRID:RGD_1599766
1599767 SS-Htr1am2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. PGA mutant Unknown Htr1am2Mcwi 1599562 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RGD_1599767
1599768 SS-Klf4m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC. PGA mutant Unknown Klf4m1Mcwi 1599569 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599768
1599769 COP.DA-(D3Rat233-D3Mgh14)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 3 118863100 118863223 1 - by flanking markers 3 130198712 130198834 1 - by flanking markers 3 123700322 123700444 1 - by flanking markers 3 118376416 118376539 1 - by flanking markers RRID:RGD_1599769
1600337 F344.GK-(D1Mgh14-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 263698966 267111153 1 - by flanking markers 1 285604773 289137268 1 - by flanking markers 1 278228767 281795785 1 - by flanking markers 1 256448513 259647894 1 - by flanking markers RRID:RGD_1600337
1600338 SHR.F344-(D12Mgh5-D12Mgh6)/Snk Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan congenic Unknown 12 29130180 42387195 1 - by flanking markers 12 33647399 33647522 1 - by flanking markers 12 31723565 31723688 1 - by flanking markers 12 28064433 28064557 1 - by flanking markers RRID:RGD_1600338
1600339 BN.GK-(D1Wox18-D1Got254)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 1 94626541 264367394 1 - by flanking markers 1 101198387 286341689 1 - by flanking markers 1 100133276 278978026 1 - by flanking markers 1 94644435 257091168 1 - by flanking markers RRID:RGD_1600339
1600340 DA/BklArbNsi Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI. Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00693
1600341 LEW-Tg(Ren2)27/Jmul This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats Wake Forest University School of Medicine, Winston-Salem, North Carolina transgenic Unknown RRID:RGD_1600341
1600342 F344.GK-(D1Got250-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 259168938 267111153 1 - by flanking markers 1 281200731 289137268 1 - by flanking markers 1 273787505 281795785 1 - by flanking markers 1 252080660 259647894 1 - by flanking markers RRID:RGD_1600342
1600343 SHRSP.WKY-(D1Wox29-D1Arb21)/Izm This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1600343
1600344 F344.GK-(D1Rat175-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 1 259647732 259647894 1 - by flanking markers RRID:RGD_1600344
1600345 F344.GK-(D1Rat83-D1Rat376)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 252133623 252133935 1 - by flanking markers 1 274017004 274017147 1 - by flanking markers 1 266587077 266587220 1 - by flanking markers 1 245700955 245701099 1 - by flanking markers RRID:RGD_1600345
1600346 F344.GK-(D1Swe4-D1Rat85)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 255386328 258599658 1 - by flanking markers 1 277075545 280845045 1 - by flanking markers 1 269633949 273433763 1 - by flanking markers 1 248746112 251790570 1 - by flanking markers RRID:RGD_1600346
1600490 SS-Chr 1BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1600490
1625284 Wild1/Hubr This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation Hubrecht Laboratory, Utrecht, The Netherlands wild Unknown RRID:RGD_1625284
1626207 BN-Adora2am3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2am3Mcwi 1642070 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1626207
1626210 BN-Lipem2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG. PGA mutant Unknown Lipem2Mcwi 1642169 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1626210
1626211 SS-Cpf2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant Unknown RRID:RGD_1626211
1626213 BN-Oxtrm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC. PGA mutant Unknown Oxtrm1Mcwi 1642173 4 148314089 148326797 7 4 207701360 207717840 7 4 144399326 144417598 7 4 145598549 145614674 7 RRID:RGD_1626213
1626214 BN-Slc27a5m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA. PGA mutant Unknown Slc27a5m2Mcwi 1642170 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1626214
1641831 MWF-Chr 6SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641831
1641849 SS.LEW-(D10Mit1-D10Mgh1)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 95368898 95369088 1 - by flanking markers 10 93929621 93929812 1 - by flanking markers RRID:RGD_1641849
1641850 SHR.WKY-(D1Got158-D1Got161)/Njs This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic Unknown Spon1 619918 1 169571535 169571693 1 - by flanking markers 1 183593063 183593220 1 - by flanking markers 1 176611942 176612099 1 - by flanking markers 1 165908744 165908902 1 - by flanking markers RRID:RGD_1641850
1641851 SHR.PD-(D8Rat42-D8Arb23)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 51376771 52822796 1 - by flanking markers 8 51046971 52459221 1 - by flanking markers 8 52446316 53840120 1 - by flanking markers 8 48432652 49868959 1 - by flanking markers RRID:RGD_1641851
1641852 WF.BBDR-(D4Got48-D4Got43)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65628995 68036772 1 - by flanking markers 4 65594194 133430955 1 - by flanking markers 4 65776688 68645203 1 - by flanking markers 4 66800270 69276226 1 - by flanking markers RRID:RGD_1641852
1641853 SS.LEW-(D10Mco38-D10Mgh1)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 65122086 1 - by flanking markers 10 65339106 66856515 1 - by flanking markers RRID:RGD_1641853
1641854 HAS.LAS-(D5Rat70-D5Rat37)/Rar HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic Unknown 5 36386126 148460381 1 - by flanking markers 5 40446731 151220567 1 - by flanking markers 5 35788756 147487820 1 - by flanking markers 5 35189153 141643988 1 - by flanking markers RRID:RGD_1641854
1641855 BBDP.WF-(D8Rat73-D8Rat20)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 94870319 1 - by flanking markers 8 94761016 96840283 1 - by flanking markers 8 95257972 97339444 1 - by flanking markers 8 88552647 90508589 1 - by flanking markers RRID:RGD_1641855
1641856 P.NP-(D4Rat119-D4Rat55)/Iusm iP and iNP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641856
1641857 BBDP.WF-(D8Rat16-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 98878516 128970675 1 - by flanking markers 8 100780886 132425312 1 - by flanking markers 8 101304999 133273132 1 - by flanking markers 8 94388671 123815899 1 - by flanking markers RRID:RGD_1641857
1641858 SHR.WKY-(D1Rat420-D1Rat278)/Njs This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UK congenic Unknown 1 167931247 168930831 1 - by flanking markers 1 181904343 182965674 1 - by flanking markers 1 174905726 175980872 1 - by flanking markers 1 164310419 165279420 1 - by flanking markers RRID:RGD_1641858
1641859 SS.MNS-(D10Bra1-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_1641859
1641860 SS.MNS-(D10Mco62-D10Mit1)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 95369088 1 - by flanking markers 10 70763267 93929812 1 - by flanking markers RRID:RGD_1641860
1641861 HAS.LAS-(D2Rat53-D2Rat138)/Rar HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 2 204077549 230157845 1 - by flanking markers 2 230770662 256283467 1 - by flanking markers 2 211301116 237742948 1 - by flanking markers 2 196146703 221167075 1 - by flanking markers RRID:RRRC_00729
1641862 F344-ApcPirc/Uwm Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam) University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Live Animals; Cryopreserved Sperm (as of 2018-07-16) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RRRC_00782
1641863 SHR.PD-(D8Mgh9-D8Rat149)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 58692901 58693265 1 - by flanking markers 8 58297648 58297798 1 - by flanking markers 8 59716199 59716349 1 - by flanking markers 8 55523877 55524028 1 - by flanking markers RRID:RGD_1641863
1641864 WF/CrCrli J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute. Charles River Laboratories Italy inbred Unknown RRID:RGD_1641864
1641865 SD-Brca2m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon). University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca2m1Uwm 728326 12 4282952 4323693 7 12 490733 535090 7 12 518257 518257 8 12 74070 74070 8 RRID:RRRC_00286
1641866 SS.LEW-(D10Mit10-D10Rat24)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 79229233 1 - by flanking markers 10 27082535 78195122 1 - by flanking markers 10 27237530 78343192 1 - by flanking markers 10 26521957 75632053 1 - by flanking markers RRID:RGD_1641866
1641867 Iusm:P alcohol-preferring These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop this preference line (P) and non-preference line (Iusm:NP, RGD:1641873). Indiana Alcohol Research Center at the Indiana University School of Medicine outbred Unknown Snca 3729 RRID:RGD_1641867
1641868 WF.BBDR-(D4Rat93-D4Rat228)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown Tcrb 3834 4 67390393 67390598 1 - by flanking markers 4 67470286 67470490 1 - by flanking markers 4 67663300 67663504 1 - by flanking markers 4 68653456 68653663 1 - by flanking markers RRID:RGD_1641868
1641869 SS.MNS-(D10Mco31-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 84284413 101848683 1 - by flanking markers 10 83219971 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641869
1641870 BBDP.WF-(D8Rat73-D8Rat121)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 118705380 1 - by flanking markers 8 94761016 121648073 1 - by flanking markers 8 95257972 95258175 1 - by flanking markers 8 88552647 88552853 1 - by flanking markers RRID:RGD_1641870
1641871 SS.MNS-(D10Mco62-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 84284667 1 - by flanking markers 10 70763267 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641871
1641872 SS.LEW-(D10Mco38-D10Mco41)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 85793448 1 - by flanking markers 10 65339106 84798381 1 - by flanking markers 10 85007626 85007896 1 - by flanking markers 10 82057244 82057515 1 - by flanking markers RRID:RGD_1641872
1641873 Iusm:NP alcohol-nonpreferring These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop a preference line (Iusm:P, RGD:1641867) and this non-preference line (Iusm:NP). Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown Snca 3729 RRID:RGD_1641873
1641874 BBDP.WF-(D8Rat73-D8Rat90)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 114974688 1 - by flanking markers 8 94761016 118204000 1 - by flanking markers 8 95257972 118862813 1 - by flanking markers 8 88552647 110572221 1 - by flanking markers RRID:RGD_1641874
1641875 SHR-Chr YBN/Cub BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations Czech Academy of Sciences, Prague, Czech Republic consomic Unknown RRID:RGD_1641875
1641876 BBDP.WF-(D8Rat73-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 128970675 1 - by flanking markers 8 94761016 132425312 1 - by flanking markers 8 95257972 133273132 1 - by flanking markers 8 88552647 123815899 1 - by flanking markers RRID:RGD_1641876
1641877 NP.P-(D4Rat119-D4Rat55)/Iusm Male iP and female iNP rats were crossed to get F1 animals which were further backcrossed to iNP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Akr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap1 2092|3197|3729|68368|735049|1307836|1308501|1310949|1311418 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641877
1641878 WF.BBDR-(Clcn1-D4Rat228)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown Clcn1 2360 4 70052319 70081449 1 - by flanking markers 4 136479719 136509472 1 - by flanking markers 4 71674218 71704318 1 - by flanking markers 4 71171949 71201483 1 - by flanking markers RRID:RGD_1641878
1641879 SS-Chr 19SHR/Rkb SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641879
1641880 SD-Brca1m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon. University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca1|Brca1m1Uwm 2218|728298 10 90513630 90572676 7 10 89192653 89252760 7 10 89394821 89455093 7 10 86417441 86477762 7 RRID:RRRC_00285
1642017 BBDR/WorBrm Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642017
1642018 BBDP/WorBrm This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642018
1642036 SHR/OlaIpcv-mtBN/Crl Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic Unknown RRID:RGD_1642036
1642269 SS-Birc3m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG. PhysGen mutant Extinct (as of 2017-01-26) Birc3m2Mcwi 1642178 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1642269
1642270 BN-Lcatm3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC. PGA, Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery Lcatm3Mcwi 1642175 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00397
1642271 SS-Klf4m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klf4m3Mcwi 1642179 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RRRC_00417
1642272 SS.LEW-(D10Mco84-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 72827158 1 - by flanking markers 10 69542746 71779712 1 - by flanking markers 10 69910832 71870652 1 - by flanking markers 10 67502108 69424978 1 - by flanking markers RRID:RGD_1642272
1642273 SS-Thbdm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA. PhysGen mutant Extinct (as of 2017-01-26) Thbdm1Mcwi 1642182 3 137158955 137162607 7 3 149159895 149163547 7 3 142748673 142752325 7 3 135863366 135867018 7 RRID:RGD_1642273
1642274 SS-Has1m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC. PhysGen mutant Extinct (as of 2017-01-26) Has1m2Mcwi 1642171 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642274
1642275 SS.LEW-(D10Rat29-D10Mco88)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 71513333 1 - by flanking markers 10 67642121 71109330 1 - by flanking markers 10 67988035 70647306 1 - by flanking markers 10 68230134 68230352 1 - by flanking markers RRID:RGD_1642275
1642276 SS-Kcna5m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcna5m1Mcwi 1642177 4 162896283 162898091 7 4 226075051 226076859 7 4 159077195 159079003 7 4 159354689 159358173 7 RRID:RRRC_00418
1642277 SS-Cpt2m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cpt2m1Mcwi 1642174 5 129007685 129025501 7 5 131353542 131370821 7 5 127505646 127523016 7 5 122664677 122682126 7 RRID:RRRC_00416
1642278 SS-Ghsrm2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC. PhysGen mutant Extinct (as of 2017-01-26) Ghsrm2Mcwi 1642180 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RGD_1642278
1642279 SS.LEW-(D10Arb9-D10Rat161)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 97589703 1 - by flanking markers 10 66048908 96133217 1 - by flanking markers 10 65590122 65590250 1 - by flanking markers 10 63221094 63221223 1 - by flanking markers RRID:RGD_1642279
1642281 SS-Podxlm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA. PhysGen mutant Extinct (as of 2017-01-26) Podxlm1Mcwi 1642176 4 58611904 58658598 7 4 58581513 58645671 7 4 58829049 58893353 7 4 60135124 60181829 7 RRID:RGD_1642281
1642282 SS-Cacna1gm1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT. PGA mutant Unknown Cacna1gm1Mcwi 1642168 10 83043636 83112886 7 10 81950594 82017885 7 10 82129071 82197828 7 10 79354998 79422960 7 RRID:RGD_1642282
1642283 SS.LEW-(D10Rat29-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 72827158 1 - by flanking markers 10 67642121 71779712 1 - by flanking markers 10 67988035 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642283
1642284 SS-Fgl2m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT. PGA mutant Unknown Fgl2m2Mcwi 1642181 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642284
1642285 SS.LEW-(D10Arb9-D10Rat57)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 74388696 1 - by flanking markers 10 66048908 73484175 1 - by flanking markers 10 65590122 73582866 1 - by flanking markers 10 63221094 70982751 1 - by flanking markers RRID:RGD_1642285
1642287 SS.LEW-(D10Arb9-D10Mco84)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 70757419 1 - by flanking markers 10 66048908 69542910 1 - by flanking markers 10 65590122 69910996 1 - by flanking markers 10 63221094 67502273 1 - by flanking markers RRID:RGD_1642287
1642288 SS.LEW-(D10Mco89-D10Got101)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72684998 78262332 1 - by flanking markers 10 71638135 77223025 1 - by flanking markers 10 71727774 77360263 1 - by flanking markers 10 69282350 74676620 1 - by flanking markers RRID:RGD_1642288
1642289 SS-Serpina5m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT. PGA mutant Unknown Serpina5m1Mcwi 1642167 6 128156901 128161334 7 6 136972583 136990812 7 6 127753152 127772403 7 6 123009224 123028412 7 RRID:RGD_1642289
1642362 SS-Has1m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC. PGA mutant Unknown Has1m3Mcwi 1642359 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642362
1642363 BN-Fgl2m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT. PGA mutant Unknown Fgl2m3Mcwi 1642355 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642363
1642364 SS-Ghsrm3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm3Mcwi 1642357 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00421
1642365 SS-Fgl2m4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fgl2m4Mcwi 1642354 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RRRC_00420
1642366 SS-Lcatm4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. PhysGen, Rat Resource & Research Center mutant Extinct (as of 2017-01-26) Lcatm4Mcwi 1642358 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1642366
1642367 BN-Ccr2m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC. PhysGen mutant Extinct (as of 2017-01-26) Ccr2m2Mcwi 1642356 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RGD_1642367
1642439 SS-Lcatm5Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm5Mcwi 1642438 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00419
1642689 BN.OLETF-(D1Rat169-D1Rat90)/Got OLETF/Got females were crossed with BN/Crlj to produce F1 which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped Otsuka Pharmacuetical Company, Tokushima, Japan congenic Unknown Prlhr 71037 1 229876870 267111153 1 - by flanking markers 1 251652807 289137268 1 - by flanking markers 1 244401175 281795785 1 - by flanking markers 1 224054293 259647894 1 - by flanking markers RRID:RGD_1642689
1642690 LA-cp/NJcr Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta. Department of Surgery, University of Alberta, Edmonton, Canada congenic Unknown RRID:RGD_1642690
1642968 SS.LEW-(D10Mco84-D10Rat58)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 71067824 1 - by flanking markers 10 69542746 70966782 1 - by flanking markers 10 69910832 70202084 1 - by flanking markers 10 67502108 67785171 1 - by flanking markers RRID:RGD_1642968
1642969 SS.LEW-(D10Mco84-D10Mco134)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642969
1642970 SS.LEW-(D10Mco113-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72827032 72827158 1 - by flanking markers 10 71779587 71779712 1 - by flanking markers 10 71870527 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642970
1642971 SS.LEW-(D10Mco84-D10Mco129)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642971
1642972 SS.LEW-(D10Mco84-D10Mco143)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642972
1642989 SS-Tg(CAG-EGFP)1Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Cryopreserved Sperm (as of 2019-04-04) RRID:RGD_1642989
1642990 SD-Tg(CAG-EGFP)63Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642990
1642991 SS-Tg(CAG-eGFP)18Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642991
1642992 SS-Tg(CAG-EGFP)28Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642992
1642993 SD-Tg(CAG-EGFP)97Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642993
1642994 SS-Tg(CAG-EGFP)43Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642994
1642995 SS-Tg(CAG-eGFP)10Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642995
1642996 SS-Tg(CAG-EGFP)2Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642996
1642997 SS-Tg(CAG-EGFP)23Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642997
1643001 FH/Unc Fawn-hooded A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina inbred Unknown RRID:RGD_1643001
1643002 SHR.WKY-(D1Rat420-D1Got161)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Spon1 619918 1 167931247 167931390 1 - by flanking markers 1 181904343 181904486 1 - by flanking markers 1 174905726 174905869 1 - by flanking markers 1 164310419 164310563 1 - by flanking markers RRID:RGD_1643002
1643007 DA.ACI-(D12Wox12-D12Rat53)/Arb ACI/SegHsd and DA/OlaHsd were crossed to get F2 animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 12 20932555 43863270 1 - by flanking markers 12 24663002 50380790 1 - by flanking markers 12 22650721 48598906 1 - by flanking markers 12 19610889 42828880 1 - by flanking markers RRID:RGD_1643007
1643010 F344.OLETF-(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj double congenic strain generated by intercrossing F344.OLETF-(D7Rat18-D7Mit2)/Tj and F344.OLETF-(D14Rat23-D14Rat12)/Tj and F2 rats screened for homozygosity University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan congenic Unknown RRID:RGD_1643010
2289819 SS.MNS-(D10Mco62-D10Got99)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 76465800 1 - by flanking markers 10 70763267 74612561 1 - by flanking markers 10 75493824 75493944 1 - by flanking markers 10 72964095 72964216 1 - by flanking markers RRID:RGD_2289819
2289820 SS.MNS-(D10Mco30-D10Got91)/1Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289820
2289821 SS.MNS-(D10Mco30-D10Got91)/3Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289821
2289822 SS.MNS-(D10Mco30-D10Got112)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 79857935 1 - by flanking markers 10 73693979 78816367 1 - by flanking markers 10 76420583 78970405 1 - by flanking markers 10 73887148 76246212 1 - by flanking markers RRID:RGD_2289822
2289823 SS.MNS-(D10Mco62-D10Mco30)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 77547622 1 - by flanking markers 10 70763267 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289823
2289824 SS.MNS-(D10Mco30-D10Got101)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78262332 1 - by flanking markers 10 73693979 77223025 1 - by flanking markers 10 76420583 77360263 1 - by flanking markers 10 73887148 74676620 1 - by flanking markers RRID:RGD_2289824
2289825 SS.MNS-(D10Rat24-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 79229067 84284667 1 - by flanking markers 10 78194957 83220224 1 - by flanking markers 10 78343027 83411656 1 - by flanking markers 10 75631887 80537228 1 - by flanking markers RRID:RGD_2289825
2289826 SS.MNS-(D10Mco30-D10Got91)/2Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289826
2289827 SS.MNS-(D10Mco30-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 84284667 1 - by flanking markers 10 73693979 83220224 1 - by flanking markers 10 76420583 83411656 1 - by flanking markers 10 73887148 80537228 1 - by flanking markers RRID:RGD_2289827
2289913 SS.MNS-(D10Rat13-D10Rat12)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 97152234 99198997 1 - by flanking markers 10 95701164 97759008 1 - by flanking markers 10 95967019 98044833 1 - by flanking markers 10 92698959 94725019 1 - by flanking markers RRID:RGD_2289913
2289916 SS.MNS-(D10Mco15-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 98392296 101848683 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_2289916
2289917 SS.MNS-(D10Mco70-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 101355656 101848683 1 - by flanking markers 10 99976910 99977168 1 - by flanking markers 10 100287441 100287699 1 - by flanking markers 10 96836006 96836268 1 - by flanking markers RRID:RGD_2289917
2290056 F344-Elmod3Tn(sb-T2/Bart3)2.42Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Elmod3Tn(sb-T2/Bart3)2.42Mcwi 2290055 4 105866419 106099850 7 4 165192607 165237016 7 4 100422256 100465152 7 4 104614665 104653122 7 RRID:RRRC_00423
2290057 F344-TgTn(T2/Bart3)1Ceb The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic Cryopreserved Sperm RRID:RGD_2290057
2290064 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Trpc4Tn(sb-T2/Bart3)2.192Mcwi 2290060 2 143350286 143485716 7 2 163115873 163282223 7 2 143433102 143605757 7 2 138307676 138476856 7 RRID:RRRC_00344
2290065 F344-CA338503Tn(sb-T2/Bart3)2.196Mcwi this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.196Mcwi 2290059 RRID:RGD_2290065
2290066 F344-Nell1Tn(sb-T2/Bart3)2.195Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1. PGA mutant Unknown Nell1Tn(sb-T2/Bart3)2.195Mcwi 2290061 1 99805922 100758002 7 1 106397933 107260905 7 1 105348577 106218970 7 1 99709305 100573872 7 RRID:RGD_2290066
2290067 F344-BI285226Tn(sb-T2/Bart3)2.193Mcwi this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.193Mcwi 2290062 RRID:RGD_2290067
2290078 F344-Myo9aTn(sb-T2/Bart3)2.186Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo9aTn(sb-T2/Bart3)2.186Mcwi 2290068 8 63578001 63783813 7 8 64335907 64534890 7 8 64573248 64777607 7 8 60149234 60352330 7 RRID:RRRC_00385
2290079 F344-BI285226Tn(sb-T2/Bart3)2.194Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.194Mcwi 2290069 RRID:RGD_2290079
2290080 F344-BI284938Tn(sb-T2/Bart3)2.187Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.187Mcwi 2290074 RRID:RGD_2290080
2290081 F344-BI284934Tn(sb-T2/Bart3)2.185Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA, Rat Resource & Research Center mutant Cryopreserved Sperm BI284934Tn(sb-T2/Bart3)2.185Mcwi 2290072 RRID:RRRC_00367
2290082 F344-Brinp3Tn(sb-T2/Bart3)2.189Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Brinp3Tn(sb-T2/Bart3)2.189Mcwi 2290071 13 60584348 61024196 7 13 68507826 68938032 7 13 63526486 63959390 7 13 58413883 58846828 7 RRID:RRRC_00425
2290083 F344-Slc24a3Tn(sb-T2/Bart3)2.188Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene. PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.188Mcwi 2290073 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290083
2290100 F344-Entpd6Tn(sb-T2/Bart3)2.174Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene. PGA mutant Unknown Entpd6Tn(sb-T2/Bart3)2.174Mcwi 2290086 3 141385480 141407860 7 3 152905464 152927857 7 3 146546424 146568828 7 3 139575659 139598163 7 RRID:RGD_2290100
2290101 F344-CB706876Tn(sb-T2/Bart3)2.181Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CB706876Tn(sb-T2/Bart3)2.181Mcwi 2290092 RRID:RGD_2290101
2290102 F344-Klhl13Tn(sb-T2/Bart3)2.176Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene. PGA mutant Unknown Klhl13Tn(sb-T2/Bart3)2.176Mcwi 2290085 X 10344050 10424665 7 X 121716856 121876640 7 X 121578965 121735014 7 X 113942309 114107299 7 RRID:RGD_2290102
2290103 F344-Nrg1Tn(sb-T2/Bart3)2.183Mcwi this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrg1Tn(sb-T2/Bart3)2.183Mcwi 2290090 16 63937796 64126183 7 16 62632432 63718738 7 16 62969573 64065063 7 16 59250658 60304519 7 RRID:RRRC_00343
2290104 F344-Cadm2Tn(sb-T2/Bart3)2.180Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. PGA mutant Unknown Cadm2Tn(sb-T2/Bart3)2.180Mcwi 2290088 11 4273771 5330393 7 11 7871257 8090100 7 11 4175078 4397335 7 11 4548367 5525420 7 RRID:RGD_2290104
2290105 F344-Sptbn4Tn(sb-T2/Bart3)2.179Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. PGA mutant Unknown Sptbn4Tn(sb-T2/Bart3)2.179Mcwi 2290097 1 82436626 82523827 7 1 85379609 85467354 7 1 84168494 84254679 7 1 82650750 82738345 7 RRID:RGD_2290105
2290106 F344-BQ195794Tn(sb-T2/Bart3)2.182Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BQ195794Tn(sb-T2/Bart3)2.182Mcwi 2290070 RRID:RGD_2290106
2290107 F344-CyssTn(sb-T2/Bart3)2.173Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene. PGA mutant Unknown CyssTn(sb-T2/Bart3)2.173Mcwi 2290095 3 138826625 138830963 7 3 150801395 150805733 7 3 144427430 144431768 7 3 137432049 137436654 7 RRID:RGD_2290107
2290108 F344-LOC290071Tn(sb-T2/Bart3)2.170Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LOC290071Tn(sb-T2/Bart3)2.170Mcwi 2290089 15 30634899 32273880 7 RRID:RRRC_00338
2290109 F344-CA338503Tn(sb-T2/Bart3)2.168Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.168Mcwi 2290087 RRID:RGD_2290109
2290110 F344-Lims1Tn(sb-T2/Bart3)2.169Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lims1Tn(sb-T2/Bart3)2.169Mcwi 2290096 20 37349188 37397427 7 20 29715580 29824252 7 20 27895981 28004767 7 20 26309833 26418511 7 RRID:RRRC_00362
2290111 F344-Cst3Tn(sb-T2/Bart3)2.172Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. PGA mutant Unknown Cst3Tn(sb-T2/Bart3)2.172Mcwi 2290093 3 137650903 137654776 7 3 149628692 149632565 7 3 143219671 143223544 7 3 136336923 136340796 7 RRID:RGD_2290111
2290112 F344-CA338503Tn(sb-T2/Bart3)2.175Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.175Mcwi 2290094 RRID:RGD_2290112
2290113 F344-Fam19a2Tn(sb-T2/Bart3)2.184Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam19a2Tn(sb-T2/Bart3)2.184Mcwi 2290098 7 63388665 63566226 7 7 66221368 66695803 7 7 66017066 66496690 7 7 58942598 59418640 7 RRID:RRRC_00387
2290114 F344-Slc24a3Tn(sb-T2/Bart3)2.178Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene. PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.178Mcwi 2290091 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290114
2290135 F344-Chsy1Tn(sb-T2/Bart3)2.165Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Chsy1Tn(sb-T2/Bart3)2.165Mcwi 2290123 1 120539002 120600102 7 1 128095353 128156041 7 1 127010587 127071570 7 1 119689626 119750711 7 RRID:RRRC_00337
2290136 F344-Slc24a4Tn(sb-T2/Bart3)2.145Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. PGA mutant Unknown Slc24a4Tn(sb-T2/Bart3)2.145Mcwi 2290127 6 126403837 126538501 7 6 135226112 135364945 7 6 126015799 126158727 7 6 121279590 121419811 7 RRID:RGD_2290136
2290137 F344-BF522453Tn(sb-T2/Bart3)2.166Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA, Rat Resource & Research Center mutant Cryopreserved Sperm BF522453Tn(sb-T2/Bart3)2.166Mcwi 2290126 RRID:RRRC_00361
2290138 F344-Glis1Tn(sb-T2/Bart3)2.149Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. PGA mutant Extinct (as of 2016-12-12) Glis1Tn(sb-T2/Bart3)2.149Mcwi 2290128 5 128736183 128739369 7 5 130891667 131081696 7 5 127043344 127233395 7 5 122222155 122412141 7 RRID:RRRC_00332
2290139 F344-AW527406Tn(sb-T2/Bart3)2.156Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown AW527406Tn(sb-T2/Bart3)2.156Mcwi 2290122 RRID:RGD_2290139
2290140 F344-BI285110Tn(sb-T2/Bart3)2.167Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI285110Tn(sb-T2/Bart3)2.167Mcwi 2290115 RRID:RGD_2290140
2290141 F344-AbatTn(sb-T2/Bart3)2.163Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene. PGA, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2016-11-11) AbatTn(sb-T2/Bart3)2.163Mcwi 2290121 10 7040725 7137154 7 10 5894187 6002068 7 10 7093406 7200439 7 10 6996688 7092835 7 RRID:RRRC_00381
2290142 F344-LOC681893Tn(sb-T2/Bart3)2.161Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.161Mcwi 2290118 RRID:RGD_2290142
2290143 F344-NapbTn(sb-T2/Bart3)2.162Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) NapbTn(sb-T2/Bart3)2.162Mcwi 2290116 3 137447072 137490500 7 3 149431212 149473190 7 3 143017571 143063904 7 3 136132248 136179280 7 RRID:RRRC_00335
2290144 F344-Adgrl3Tn(sb-T2/Bart3)2.151Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adgrl3Tn(sb-T2/Bart3)2.151Mcwi 2290129 14 28385112 28854677 7 14 28183727 29040121 7 14 28362176 29226085 7 14 26336320 27104060 7 RRID:RRRC_00334
2290145 F344-BI284938Tn(sb-T2/Bart3)2.155Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.155Mcwi 2290120 RRID:RGD_2290145
2290146 F344-Plce1Tn(sb-T2/Bart3)2.146Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plce1Tn(sb-T2/Bart3)2.146Mcwi 2290125 1 242794858 243103437 7 1 264652842 264956664 7 1 257156023 257465440 7 1 236243445 236552571 7 RRID:RRRC_00380
2290147 F344-Sptlc3Tn(sb-T2/Bart3)2.147Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sptlc3Tn(sb-T2/Bart3)2.147Mcwi 2290124 3 127691668 127825206 7 3 139023075 139151792 7 3 132560437 132689313 7 3 126847878 126978010 7 RRID:RRRC_00331
2290148 F344-Map2k5Tn(sb-T2/Bart3)2.150Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. PGA mutant Extinct (as of 2016-12-21) Map2k5Tn(sb-T2/Bart3)2.150Mcwi 2290117 8 67313472 67542723 7 8 67784868 68010809 7 8 68055976 68282656 7 8 63625220 63852090 7 RRID:RRRC_00333
2290159 F344-Spetex-2HTn(sb-T2/Bart3)2.136Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene. PGA mutant Unknown Spetex-2HTn(sb-T2/Bart3)2.136Mcwi 2290150 15 5180002 5186910 7 RRID:RGD_2290159
2290160 F344-Rph3aTn(sb-T2/Bart3)2.104Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rph3aTn(sb-T2/Bart3)2.104Mcwi 2290154 12 36678613 36753316 7 12 42938832 43014142 7 12 41073296 41149799 7 12 35542389 35618901 7 RRID:RRRC_00326
2290161 F344-Tmco1Tn(sb-T2/Bart3)2.135Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene. PGA mutant Extinct (as of 2017-01-30) Tmco1Tn(sb-T2/Bart3)2.135Mcwi 2290156 13 82971926 82995262 7 13 90108152 90202246 7 13 85465015 85559113 7 13 79460229 79483557 7 RRID:RRRC_00328
2290162 F344-Inpp4bTn(sb-T2/Bart3)2.143Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.143Mcwi 2290149 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RRRC_00379
2290163 F344-TgTn(T2/Bart3)2Ceb transposon sleeping beauty The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290163
2290164 F344-Syne1Tn(sb-T2/Bart3)2.68Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Syne1Tn(sb-T2/Bart3)2.68Mcwi 2290153 1 35803552 36269628 7 1 42947742 43158478 7 1 41608287 42086662 7 1 41512146 41983382 7 RRID:RRRC_00325
2290165 F344-NtmTn(sb-T2/Bart3)2.130Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene. PGA mutant Extinct (as of 2017-01-24) NtmTn(sb-T2/Bart3)2.130Mcwi 2290157 8 28587019 29019888 7 8 30073163 31070882 7 8 30039332 31041755 7 8 27376582 28366604 7 RRID:RRRC_00327
2290166 F344-Plcb3Tn(sb-T2/Bart3)2.69Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plcb3Tn(sb-T2/Bart3)2.69Mcwi 2290155 1 209628425 209643694 7 1 229198739 229215831 7 1 222207887 222224993 7 1 204143257 204160384 7 RRID:RRRC_00424
2290167 F344-Dlg1Tn(sb-T2/Bart3)2.133Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. PGA mutant Unknown Dlg1Tn(sb-T2/Bart3)2.133Mcwi 2290152 11 70735283 70930374 7 11 75239783 75454358 7 11 72164566 72378895 7 11 68911883 69103230 7 RRID:RGD_2290167
2290168 F344-Pde5aTn(sb-T2/Bart3)2.144Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene. PGA mutant Extinct (as of 2017-01-24) Pde5aTn(sb-T2/Bart3)2.144Mcwi 2290151 2 219410394 219550910 7 2 246260843 246406296 7 2 226899604 227044916 7 2 210858515 211003480 7 RRID:RRRC_00330
2290169 F344-Tg(PGK2-sb11)Ceb Sleeping beauty transposase transgenic sb11 cDNA linked to human PGK2 promoter was used. PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290169
2290170 F344-Cd226Tn(sb-T2/Bart3)2.141Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cd226Tn(sb-T2/Bart3)2.141Mcwi 2290158 18 86064574 86157909 7 18 85337942 85433295 7 18 86299392 86394772 7 18 82449924 82545107 7 RRID:RRRC_00329
2290171 F344-LOC681893Tn(sb-T2/Bart3)2.159Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.159Mcwi 2290119 RRID:RGD_2290171
2290186 SD-Tg(SOD1*G93A)39 SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290186
2290187 SD-Tg(SOD1*H46R)4 SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290187
2290272 SS/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290272
2290273 SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290273
2290274 SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 11832728 76115762 1 - by flanking markers 15 15643978 80627247 1 - by flanking markers 15 11605245 77072316 1 - by flanking markers 15 10355054 69625966 1 - by flanking markers RRID:RGD_2290274
2290275 SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo The desired fragment is transferred from WKY to SHRSP National Bio Resource Project Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 170016252 170016653 1 - by flanking markers 3 180127863 180128021 1 - by flanking markers 3 176417943 176418101 1 - by flanking markers 3 168026691 168026850 1 - by flanking markers RRID:RGD_2290275
2290276 SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 118757096 1 - by flanking markers 3 11361699 130099054 1 - by flanking markers 3 6000748 123599709 1 - by flanking markers 3 10778704 118275626 1 - by flanking markers RRID:RGD_2290276
2290277 SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 101359980 1 - by flanking markers 3 50522686 113470358 1 - by flanking markers 3 45406058 106900596 1 - by flanking markers 3 43827364 102200699 1 - by flanking markers RRID:RGD_2290277
2290278 SR/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290278
2290279 SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 106177917 1 - by flanking markers 15 67139660 109944957 1 - by flanking markers 15 63498932 106550657 1 - by flanking markers 15 56484420 98288169 1 - by flanking markers RRID:RGD_2290279
2290280 SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2290280
2290281 SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 170016653 1 - by flanking markers 3 50522686 180128021 1 - by flanking markers 3 45406058 176418101 1 - by flanking markers 3 43827364 168026850 1 - by flanking markers RRID:RGD_2290281
2290282 SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290282
2290298 SHR-Tg(Thy1-MAPT)318 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290298
2290299 SHR-Tg(Thy1-MAPT)72 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290299
2290311 SD-Tg(SOD1*G93A)26Dwc SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California transgenic Unknown SOD1 730855 RRID:RGD_2290311
2290386 SD-Tg(Wlds)23Cole SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290386
2290387 SD-Tg(UbC-APPswe)6590 SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation Karolinska Institutet, Stockholm, Sweden transgenic Unknown APP 736021 RRID:RGD_2290387
2290391 SD-Tg(Wlds)79Cole SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290391
2290429 SS-Tg(ApoC3-CETP)53Opaz SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00310
2291840 F344-Dzank1Tn(sb-T2/Bart3)2.164Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene. PGA mutant Extinct (as of 2016-10-17) Dzank1Tn(sb-T2/Bart3)2.164Mcwi 2291839 3 133021912 133073987 7 3 145054445 145114445 7 3 138624517 138684530 7 3 131855890 131908217 7 RRID:RGD_2291840
2292168 ISIAH Inherited stress-induced arterial hypertension Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_2292168
2292384 SS.LEW-(D10Chm167-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70589279 71366998 1 - by flanking markers 10 69375493 71016171 1 - by flanking markers 10 69742043 70500971 1 - by flanking markers 10 67335465 68083956 1 - by flanking markers RRID:RGD_2292384
2292385 SS.LEW-(D10Mco30-D10Got107)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 78712717 1 - by flanking markers 10 73693979 77664589 1 - by flanking markers 10 76420583 77803328 1 - by flanking markers 10 73887148 75121215 1 - by flanking markers RRID:RGD_2292385
2292386 SS.LEW-(D10Chm155-D10Rat127)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 87272312 100040883 1 - by flanking markers 10 86214887 98591695 1 - by flanking markers 10 86418952 98888676 1 - by flanking markers 10 83463114 95552352 1 - by flanking markers RRID:RGD_2292386
2292387 SS.LEW-(D10Chm224-D10Chm259)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 75291923 1 - by flanking markers 10 75776633 76309841 1 - by flanking markers 10 74325927 74326153 1 - by flanking markers 10 71831756 71831983 1 - by flanking markers RRID:RGD_2292387
2292388 SS.LEW-(D10Chm246-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 71262405 71366998 1 - by flanking markers 10 70027256 71016171 1 - by flanking markers 10 70396378 70500971 1 - by flanking markers 10 67979320 68083956 1 - by flanking markers RRID:RGD_2292388
2292389 SS.LEW-(D10Chm10-D10Chm14)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat13-D10Rat11)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 96778676 99233951 1 - by flanking markers 10 95351725 97793613 1 - by flanking markers 10 95617075 98079438 1 - by flanking markers 10 92348201 94759977 1 - by flanking markers RRID:RGD_2292389
2292390 SS.LEW-(D10Rat194-D10Chm243)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 75706467 76081753 1 - by flanking markers 10 75018615 75388855 1 - by flanking markers 10 74712046 75083773 1 - by flanking markers 10 72219294 72590339 1 - by flanking markers RRID:RGD_2292390
2292451 F344-Stxbp5lTn(sb-T2/Bart3)2.202Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Stxbp5lTn(sb-T2/Bart3)2.202Mcwi 2292450 11 65129572 65455115 7 11 69337663 69661463 7 11 66246624 66566331 7 11 63334667 63654270 7 RRID:RRRC_00386
2292452 F344-Syndig1Tn(sb-T2/Bart3)2.171Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Syndig1Tn(sb-T2/Bart3)2.171Mcwi 2292449 3 139434170 139834916 7 3 151405855 151571801 7 3 145031427 145199273 7 3 138030995 138234646 7 RRID:RRRC_00342
2292453 F344-BE329202Tn(sb-T2/Bart3)2.198Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm BE329202Tn(sb-T2/Bart3)2.198Mcwi 2292448 RRID:RRRC_00345
2292454 F344-RGD1564304Tn(sb-T2/Bart3)2.201Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene. PhysGen mutant Extinct (as of 2017-01-26) RGD1564304Tn(sb-T2/Bart3)2.201Mcwi 2292447 RRID:RGD_2292454
2292459 WF.LEW-RVFV This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15) RRID:RRRC_00208
2292526 SS-Tg(Atp1a1)48Opaz SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) RRID:RRRC_00281
2292527 SS-Tg(RA1V9)64Opaz Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00308
2292528 F344-Tg(APPswe)Opaz F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00283
2292529 LEW-Tg((ROSA)26Sor-luc)11Jmsk LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site Rat Resource and Research Center, National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-08) Development RRID:RRRC_00299
2292530 SD-Tg(Pou5f1-Dsred) This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00320
2292531 SD-Tg(Pou5f1-EGFP) This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23) RRID:RRRC_00319
2292532 F344-Tg(betaCTF-l45F) F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00277
2292564 ACI.COP-(D6Rat80-D6Rat146)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 6 16302145 16302283 1 - by flanking markers 6 26052697 26052834 1 - by flanking markers 6 16100120 16100257 1 - by flanking markers 6 2299357 2299495 1 - by flanking markers RRID:RGD_2292564
2292565 ACI.COP-(D3Mgh16-D3Rat119)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 6373335 52643538 1 - by flanking markers 3 11361699 63334520 1 - by flanking markers 3 6000748 56715367 1 - by flanking markers 3 10778704 55223816 1 - by flanking markers RRID:RGD_2292565
2292566 ACI.COP-(D3Rat130-D3Rat114)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 44551252 149496698 1 - by flanking markers 3 55227530 160347840 1 - by flanking markers 3 48561928 155263151 1 - by flanking markers 3 47233211 147415807 1 - by flanking markers RRID:RGD_2292566
2292567 ACI.COP-(D10Mgh20-D10Rat4)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 10 53781126 107033716 1 - by flanking markers 10 53376677 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2292567
2292647 SS.LEW-(D1Mco36-D1Rat106)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 139471673 1 - by flanking markers 1 130267716 146282094 1 - by flanking markers 1 129208943 145354344 1 - by flanking markers 1 121833674 137184926 1 - by flanking markers RRID:RGD_2292647
2292648 SS.LEW-(D1Mco36-D1Mco77)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 122992360 1 - by flanking markers 1 130267716 130268180 1 - by flanking markers 1 129208943 129209407 1 - by flanking markers 1 121833674 121834139 1 - by flanking markers RRID:RGD_2292648
2292649 SS.LEW-(D1Mco36-D1Rat131)/1Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292649
2292650 SS.LEW-(D1Mco36-D1Rat131)/2Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292650
2292651 SS.LEW-(D1Mco99-D1Rat49)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292651
2292652 SS.LEW-(D1Mco85-D1Rat49)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292652
2292653 SS.LEW-(D1Mco36-D1Mco101)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 97174943 122992360 1 - by flanking markers 1 103735751 130268180 1 - by flanking markers 1 102658741 129209407 1 - by flanking markers 1 97146283 121834139 1 - by flanking markers RRID:RGD_2292653
2293012 ACI.BBDP-(RT1u)(Gimap5)/Sunn 2 BBDP regions [Iddm1(RT1u) and Iddm2(Gimap5)] were introgressed into the ACI/SegHsd background Sunnybrook Research Institute, Toronto, Ontario, Canada, Rat Resource and Research Center congenic Unknown RRID:RRRC_00788
2293120 LOU.BN-(D10Mgh1-D10Mgh14)/Ins segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU Cardiovascular Physiopathology, INSERM, Montpellier, France congenic Unknown Ace 2493 10 65379850 65379965 1 - by flanking markers 10 65109232 65109346 1 - by flanking markers 10 66539729 66539843 1 - by flanking markers 10 64155469 64155584 1 - by flanking markers RRID:RGD_2293120
2293143 SS.BN-(D13Rat20-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13 38329089 55373537 1 - by flanking markers 13 23200281 47267192 1 - by flanking markers 13 17996178 42155682 1 - by flanking markers 13 37262092 53383120 1 - by flanking markers RRID:RGD_2293143
2293144 SS.BN-(D13Rat91-D13Rat179)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46911975 60669696 1 - by flanking markers 13 55853015 68592209 1 - by flanking markers 13 50799478 63611529 1 - by flanking markers 13 45417753 58498119 1 - by flanking markers RRID:RGD_2293144
2293145 SS.BN-(D13Hmgc64-RN34_13048990782)/Mcwi SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13;13;13 49428397;48990782;45215472 49428577;48990782;45215667 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13 58314588;54170894 58314767;54171089 1 - by flanking markers;1 - by flanking markers 13;13 49102205;53264698 49102400;53264877 1 - by flanking markers;1 - by flanking markers 13;13 43763752;47841075 43763948;47841255 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293145
2293146 SS.BN-(D13Rat20-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 38329089;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 47267053;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 42155543;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 37262092;93541170 37262232;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293146
2293354 LEW.WKY-(D16Rat88-D16Rat40)/Tja segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd Imperial College, London, UK. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00708
2293355 WKY.LEW-(D16Rat88-D16Rat40)/Tja 22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00706
2293729 SHR-Gja8m1-/-Cub This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH2-terminal cytosolic domain of Cx50, L7Q Department of Biology, Charles University in Prague, Prague, Czech Republic mutant Unknown Gja8m1Cub 12791992 2 218536831 218538447 7 2 199052374 199052374 8 2 184492360 184492360 8 RRID:RGD_2293729
2293761 LH-Chr 17BN/Mav Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2293761
2293770 SHHF/Bbb Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2293770
2293832 LOU.BN-(D6Rat128-D6Rat115)/Ins segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross INSERM, Paris, France congenic Unknown 6 76613351 116550459 1 - by flanking markers 6 86645162 125802733 1 - by flanking markers 6 77111071 116576287 1 - by flanking markers 6 73691999 111838254 1 - by flanking markers RRID:RGD_2293832
2298494 Kini:DA,PVG-G10 Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG.1AV1 females founders generated F2. F3 generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2298494
2298498 W/Gaox Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China inbred Unknown RRID:RGD_2298498
2298772 WFfzHsd Fuzzy rat Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987) Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00340
2299122 F344-Tasp1Tn(sb-T2/Bart3)2.219Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene. PhysGen mutant Extinct (as of 2017-01-26) Tasp1Tn(sb-T2/Bart3)2.219Mcwi 2299101 3 128002479 128228127 7 3 139347611 139588372 7 3 132888785 133131213 7 3 127176416 127408039 7 RRID:RGD_2299122
2299123 F344-AW921689Tn(sb-T2/Bart3)2.209Mcwi this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant Unknown AW921689Tn(sb-T2/Bart3)2.209Mcwi 2299108 RRID:RGD_2299123
2299124 F344-Ubqln4Tn(sb-T2/Bart3)2.230Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ubqln4Tn(sb-T2/Bart3)2.230Mcwi 2299109 2 180669525 180684724 7 2 207318101 207333435 7 2 187915701 187931035 7 2 174012726 174028062 7 RRID:RRRC_00350
2299125 F344-Ccdc85aTn(sb-T2/Bart3)2.248Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccdc85aTn(sb-T2/Bart3)2.248Mcwi 2299113 14 109197317 109434306 7 14 112609601 112636341 7 14 112719482 112900724 7 14 102126574 102359207 7 RRID:RRRC_00356
2299126 F344-Kcnip4Tn(sb-T2/Bart3)2.225Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnip4Tn(sb-T2/Bart3)2.225Mcwi 2299100 14 66284290 67452628 7 14 65635533 66780362 7 14 65549362 66749181 7 14 61380699 62531399 7 RRID:RRRC_00348
2299127 F344-Eva1aTn(sb-T2/Bart3)2.233Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. PhysGen mutant Extinct (as of 2017-01-26) Eva1aTn(sb-T2/Bart3)2.233Mcwi 2299094 4 116280880 116330122 7 4 177461600 177511382 7 4 112714023 112823659 7 4 114593773 114643011 7 RRID:RGD_2299127
2299128 F344-Lama2Tn(sb-T2/Bart3)2.2013Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lama2Tn(sb-T2/Bart3)2.2013Mcwi 2299103 1 18203466 18885462 7 1 20002787 20647256 7 1 18491264 19143486 7 1 17672675 18320641 7 RRID:RRRC_00432
2299129 F344-Lrrc4cTn(sb-T2/Bart3)2.224Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.224Mcwi 2299107 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RGD_2299129
2299130 F344-AdaTn(sb-T2/Bart3)2.237Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-13) AdaTn(sb-T2/Bart3)2.237Mcwi 2299093 3 154636530 154660637 7 3 166306001 166330108 7 3 160115840 160139947 7 3 152398745 152422854 7 RRID:RRRC_00426
2299131 F344-Grk1Tn(sb-T2/Bart3)2.234Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Grk1Tn(sb-T2/Bart3)2.234Mcwi 2299115 16 80979323 80991796 7 16 80641991 80657693 7 16 81153489 81165442 7 16 76122501 76135792 7 RRID:RRRC_00388
2299132 F344-Cadm1Tn(sb-T2/Bart3)2.229Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. PhysGen mutant Extinct (as of 2017-01-26) Cadm1Tn(sb-T2/Bart3)2.229Mcwi 2299116 8 50765645 51108962 7 8 50460752 50796128 7 8 51858906 52200591 7 8 47847836 48178703 7 RRID:RGD_2299132
2299133 F344-Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi 2299098 2 236522381 236638692 7 2 262787595 262899803 7 2 244258550 244370983 7 2 227500366 227645213 7 RRID:RRRC_00357
2299134 F344-Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi 2299105 1 188518590 188643804 7 1 209449940 209577459 7 1 202432366 202560628 7 1 183829794 183959319 7 RRID:RRRC_00347
2299135 F344-Mgat4cTn(sb-T2/Bart3)2.244Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mgat4cTn(sb-T2/Bart3)2.244Mcwi 2299106 7 40171454 40383441 7 7 43829446 44052611 7 7 43249369 44024278 7 7 36709564 37485810 7 RRID:RRRC_00354
2299136 F344-SnphTn(sb-T2/Bart3)2.214Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene. PhysGen mutant Extinct (as of 2017-01-26) SnphTn(sb-T2/Bart3)2.214Mcwi 2299117 3 141921547 141961697 7 3 153455882 153496985 7 3 147102394 147143576 7 3 140098540 140139342 7 RRID:RGD_2299136
2299137 F344-Erbb4Tn(sb-T2/Bart3)2.208Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Erbb4Tn(sb-T2/Bart3)2.208Mcwi 2299110 9 66843898 67967970 7 9 74804287 75310350 7 9 75021790 76178936 7 9 69523733 70596743 7 RRID:RRRC_00383
2299138 F344-Nrxn2Tn(sb-T2/Bart3)2.250Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrxn2Tn(sb-T2/Bart3)2.250Mcwi 2299118 1 209211740 209318064 7 1 228789462 228899340 7 1 221792191 221908047 7 1 203726420 203842301 7 RRID:RRRC_00449
2299139 F344-Dnhd1Tn(sb-T2/Bart3)2.243Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. PhysGen mutant Extinct (as of 2017-01-26) Dnhd1Tn(sb-T2/Bart3)2.243Mcwi 2299114 1 163380065 163467261 7 1 177487073 177576072 7 1 170473792 170570220 7 1 159990785 160077990 7 RRID:RGD_2299139
2299140 F344-DccTn(sb-T2/Bart3)2.205Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) DccTn(sb-T2/Bart3)2.205Mcwi 2298938 18 68026795 69140741 7 18 65688901 66793126 7 18 66518213 67629801 7 18 64868987 65972783 7 RRID:RRRC_00384
2299141 F344-Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene. PhysGen mutant Extinct (as of 2017-01-26) Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi 2299104 18 35865837 36318308 7 18 36647298 37076455 7 18 36985709 37421383 7 18 34653716 35080889 7 RRID:RGD_2299141
2299142 F344-Inpp4bTn(sb-T2/Bart3)2.232Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.232Mcwi 2299095 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RGD_2299142
2299143 F344-Kif16bTn(sb-T2/Bart3)2.200Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kif16bTn(sb-T2/Bart3)2.200Mcwi 2299111 3 130967515 131250402 7 3 143103727 143381598 7 3 136596621 136936809 7 3 129974692 130254194 7 RRID:RRRC_00346
2299144 F344-TrdnTn(sb-T2/Bart3)2.238Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) TrdnTn(sb-T2/Bart3)2.238Mcwi 2299099 1 24514752 24925948 7 1 26865461 27248423 7 1 25403390 25787664 7 1 23955651 24410494 7 RRID:RRRC_00368
2299145 F344-Rprd1aTn(sb-T2/Bart3)2.247Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. PhysGen mutant Extinct (as of 2017-01-26) Rprd1aTn(sb-T2/Bart3)2.247Mcwi 2299096 18 16283291 16328357 7 18 16209135 16256883 7 18 16450160 16497913 7 18 15791418 15839338 7 RRID:RGD_2299145
2299146 F344-PtpreTn(sb-T2/Bart3)236Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene. PhysGen mutant Extinct (as of 2017-01-26) PtpreTn(sb-T2/Bart3)236Mcwi 2299097 1 195263489 195303249 7 1 214818446 214920034 7 1 207820719 207987123 7 1 190344331 190494815 7 RRID:RGD_2299146
2299147 F344-Prr5lTn(sb-T2/Bart3)2.228Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Prr5lTn(sb-T2/Bart3)2.228Mcwi 2299112 3 86868129 86948468 7 3 97950297 98119477 7 3 91290207 91461208 7 3 88001951 88173532 7 RRID:RRRC_00349
2299148 F344-Immp1lTn(sb-T2/Bart3)2.246Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Immp1lTn(sb-T2/Bart3)2.246Mcwi 2299102 3 91408864 91436603 7 3 102575250 102646194 7 3 95955126 96024316 7 3 92385329 92449559 7 RRID:RRRC_00355
2300018 SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm Mukogawa Women's University, Nishinomiya, Hyogo Japan, National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension RRID:RGD_2300018
2300195 EHC.BN-(D14Rat43-D14Rat132)/Kyu EHC/Seac and BN/Seac were crossed to get F1 progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics Kyushu University, Fukuoka, Japan congenic Unknown 14 79256324 107101727 1 - by flanking markers 14 78419915 110102984 1 - by flanking markers 14 78446303 110402569 1 - by flanking markers 14 100147356 100147478 1 - by flanking markers RRID:RGD_2300195
2300215 SHR.BN-(D10Mgh3-D10Rat85)/Ipcv Congenic substrain derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 10 48994688 100090454 1 - by flanking markers 10 49018990 98640289 1 - by flanking markers 10 49239646 98939361 1 - by flanking markers 10 47494000 95600487 1 - by flanking markers RRID:RGD_2300215
2300216 SHR-Tg(PEPCK-SREBF1)1Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2300216
2300217 SHR.BN-(D10Mgh3-Srebf1)/Ipcv 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Srebf1 69423 10 46461684 100090454 1 - by flanking markers 10 46326015 98640289 1 - by flanking markers 10 46570996 98939361 1 - by flanking markers 10 45007637 95600487 1 - by flanking markers RRID:RGD_2300217
2301079 F344-Lrrc7Tn(sb-T2/Bart3)2.253Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc7Tn(sb-T2/Bart3)2.253Mcwi 2301078 2 256228792 256644029 7 2 283549882 283934360 7 2 264910594 265300860 7 2 247146616 247634945 7 RRID:RRRC_00360
2301080 F344-Lrrc4cTn(sb-T2/Bart3)2.254Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.254Mcwi 2301076 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RRRC_00359
2301081 F344-Mmel1Tn(sb-T2/Bart3)2.255Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mmel1Tn(sb-T2/Bart3)2.255Mcwi 2301077 5 171675007 171703353 7 5 175729143 175759868 7 5 172273450 172303905 7 5 165431278 165461716 7 RRID:RRRC_00358
2301246 SS.LEW-(D3Rat61-D3Wox1)/Ayd A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 147852788 168149595 1 - by flanking markers 3 158115782 182470017 1 - by flanking markers 3 153381237 174632112 1 - by flanking markers 3 145925360 166177555 1 - by flanking markers RRID:RGD_2301246
2301247 SS.LEW-(D16Got3-D16Rat112)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Mit2-D16Chm23)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 64718 3531727 1 - by flanking markers 16 773329 4149422 1 - by flanking markers 16 778415 4203372 1 - by flanking markers 16 110590 3447332 1 - by flanking markers RRID:RGD_2301247
2301248 SS.LEW-(D3Got33-D3Chm68)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 45100293 60708929 1 - by flanking markers 3 55769295 71451283 1 - by flanking markers 3 49115270 64892832 1 - by flanking markers 3 47769862 62962984 1 - by flanking markers RRID:RGD_2301248
2301249 SS.LEW-(D18Rat30-D18Chm29)/Ayd A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 5682011 12249935 1 - by flanking markers 18 5795276 15461904 1 - by flanking markers 18 5825946 15691464 1 - by flanking markers 18 5584537 11796356 1 - by flanking markers RRID:RGD_2301249
2301315 LE/Orl Long-Evans/Cryptorchid Obtained from Centre Nationale de la Researche Scientifique, Orleans, France Centre Nationale de la Researche Scientifique, Orleans, France inbred Unknown RRID:RGD_2301315
2301330 KH Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma inbred Unknown RRID:RGD_2301330
2301367 SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 66680022 170817807 1 - by flanking markers 2 86560119 197513270 1 - by flanking markers 2 66828049 178177553 1 - by flanking markers 2 66118275 164552628 1 - by flanking markers RRID:RGD_2301367
2301368 SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 170817613 170817807 1 - by flanking markers 2 197513076 197513270 1 - by flanking markers 2 178177359 178177553 1 - by flanking markers 2 164552433 164552628 1 - by flanking markers RRID:RGD_2301368
2301369 SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 196277776 204077687 1 - by flanking markers 2 223058573 230770799 1 - by flanking markers 2 203613889 211301253 1 - by flanking markers 2 188657176 196146841 1 - by flanking markers RRID:RGD_2301369
2301370 SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 141259937 190384899 1 - by flanking markers 2 161271919 216143762 1 - by flanking markers 2 141583337 196645063 1 - by flanking markers 2 136445150 183048631 1 - by flanking markers RRID:RGD_2301370
2301371 SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Gstm1|Vcam1|S1pr1 2755|3952|61958 2 182724363 216711836 1 - by flanking markers 2 209270725 241761983 1 - by flanking markers RRID:RGD_2301371
2301381 SS.LEW-(D18Chm41-D18Rat92)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 53898282 1 - by flanking markers 18 30797572 52299753 1 - by flanking markers 18 31109532 53083766 1 - by flanking markers 18 29804982 51515008 1 - by flanking markers RRID:RGD_2301381
2301382 SS.LEW-(D18Chm91-D18Rat67)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12677191 23780206 1 - by flanking markers 18 15053338 23867696 1 - by flanking markers 18 15274408 24147513 1 - by flanking markers 18 12205066 23012468 1 - by flanking markers RRID:RGD_2301382
2301383 SS.LEW-(D18Chm31-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 54856651 1 - by flanking markers 18 2761846 53346447 1 - by flanking markers 18 2745212 54108474 1 - by flanking markers 18 52539763 52539863 1 - by flanking markers RRID:RGD_2301383
2301384 SS.LEW-(D18Chm41-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 77511190 1 - by flanking markers 18 30797572 76318715 1 - by flanking markers 18 31109532 77212332 1 - by flanking markers 18 29804982 74055742 1 - by flanking markers RRID:RGD_2301384
2301385 SS.LEW-(D18Rat29-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13904295 54856651 1 - by flanking markers 18 13042236 53346447 1 - by flanking markers 18 13257458 54108474 1 - by flanking markers 18 13529795 52539863 1 - by flanking markers RRID:RGD_2301385
2301386 SS.LEW-(D18Rat61-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 61571526 77511190 1 - by flanking markers 18 60167906 76318715 1 - by flanking markers 18 60971508 77212332 1 - by flanking markers 18 58805687 74055742 1 - by flanking markers RRID:RGD_2301386
2301387 SS.LEW-(D18Rat67-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 23779885 54856651 1 - by flanking markers 18 23867550 53346447 1 - by flanking markers 18 24147367 54108474 1 - by flanking markers 18 23012321 52539863 1 - by flanking markers RRID:RGD_2301387
2301388 SS.LEW-(D18Chm56-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 49014933 54856651 1 - by flanking markers 18 47711090 53346447 1 - by flanking markers 18 48499359 54108474 1 - by flanking markers 18 46969392 52539863 1 - by flanking markers RRID:RGD_2301388
2301700 F344-Spata13Tn(sb-T2/Bart3)2.267Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spata13Tn(sb-T2/Bart3)2.267Mcwi 2301697 15 39722469 39849214 7 15 44749770 44878760 7 15 40937652 41066645 7 15 34778479 34907645 7 RRID:RRRC_00373
2301701 F344-PtpraTn(sb-T2/Bart3)2.261Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PtpraTn(sb-T2/Bart3)2.261Mcwi 2301698 3 118061713 118171300 7 3 129475237 129582992 7 3 122976066 123084585 7 3 117650146 117759744 7 RRID:RRRC_00370
2301702 F344-Sf4Tn(sb-T2/Bart3)2.264Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sf4Tn(sb-T2/Bart3)2.264Mcwi 2301696 16 19835921 19866795 7 16 20950430 21047301 7 16 21100923 21131795 7 16 19352659 19383533 7 RRID:RRRC_00371
2301937 BN.GH-(D18Rat41-D18Mgh4)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 18 59279066 79585133 1 - by flanking markers 18 57699045 79012652 1 - by flanking markers 18 58476128 79948741 1 - by flanking markers 18;6 56594589;118921813 76477940;118921891 1 - by flanking markers;1 - by flanking markers RRID:RGD_2301937
2301938 BN.GH-(D6Mit12-D6Rat15)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 3158401 105011726 1 - by flanking markers 6 2916444 113050815 1 - by flanking markers 6 104890044 104890216 1 - by flanking markers 6 100873387 100873560 1 - by flanking markers RRID:RGD_2301938
2301939 BN.GH-(D2Rat22-D2Mgh11)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2 69302718 69303085 1 - by flanking markers 2 88968735 223460027 1 - by flanking markers 2 69243686 204022555 1 - by flanking markers 2 68462860 189039377 1 - by flanking markers RRID:RGD_2301939
2301986 BN.GH-(D2Rat22-D2Mgh11)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301986
2301987 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)/Mcwi desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301987
2301988 BN.GH-(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301988
2301989 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301989
2302067 F344/DuCrlSwe Substrain of Fischer rats maintained at Malmo, Sweden Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_2302067
2302080 Rhd:F344,GK-G21 GK/Swe and F344/Swe were bred to create F1 generation, couples of F1 with GK/Swe and F344/Swe females founders generated F2. F3 generation originated from breeding random couples which were intercrossed to get further generations Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden advanced_intercross_line Unknown RRID:RGD_2302080
2302081 DA.E3-(D11Got79-D11Wox5)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.' Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 11 82238710 85432136 1 - by flanking markers 11 86800287 90495881 1 - by flanking markers 11 83727048 87444587 1 - by flanking markers 11 80039141 83440803 1 - by flanking markers RRID:RGD_2302081
2302106 SHRSP.WKY-(D1Rat44-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2302106
2302108 SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 124614852 1 - by flanking markers 1 80946174 131822376 1 - by flanking markers 1 79689548 130779320 1 - by flanking markers 1 78430536 123350581 1 - by flanking markers RRID:RGD_2302108
2302109 SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 153754250 1 - by flanking markers 1 80946174 167707569 1 - by flanking markers 1 79689548 161493868 1 - by flanking markers 1 78430536 150872737 1 - by flanking markers RRID:RGD_2302109
2302110 SHRSP.WKY-(Apbb1-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension Apbb1 2122 1 163282918 187092492 1 - by flanking markers 1 177393531 206277202 1 - by flanking markers 1 170387625 199254774 1 - by flanking markers 1 159896889 182418476 1 - by flanking markers RRID:RGD_2302110
2302132 SHRSP-Tg(Tagln-ACE2)6918Bdr Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany transgenic Unknown Tagln|ACE2 3723|1347174 RRID:RGD_2302132
2302141 F344-Tg(Cyp1a1-Ren2)10Jmul Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis. University of Edinburgh Medical School, Edinburgh, UK transgenic Unknown Cyp1a1|Ren2 2458|1622375 RRID:RGD_2302141
2302148 SHR-Tg(EEF1A1-Cd36)10Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302148
2302149 SHR-Tg(EEF1A1-Cd36)19Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302149
2302150 SHR-Tg(EEF1A1-Cd36)93Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter). Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302150
2302151 SHR-Tg(EEF1A1-Cd36)106Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302151
2302279 F344.SDT-(D3Wox9-D3Arb20)/Kbe Female F344/NSlc were crossed with male SDT/CrljJcl, then female F1 were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers Kobe University School of Medicine, Chuo-ku, Kobe, Japan congenic Unknown 3 47722501 47722628 1 - by flanking markers 3 58456360 58456486 1 - by flanking markers 3 51821710 51821836 1 - by flanking markers 3 50436913 50437042 1 - by flanking markers RRID:RGD_2302279
2302387 DA.ACI-(D2Mit12-D2Mgh29)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 227310008 1 - by flanking markers 2 74640967 201405160 1 - by flanking markers 2 181990297 235290110 1 - by flanking markers 2 168358098 218414891 1 - by flanking markers RRID:RRRC_00667
2302649 F344-Nsun4Tn(sb-T2/Bart3)2.286Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nsun4Tn(sb-T2/Bart3)2.286Mcwi 2302645 5 136277224 136297339 7 5 138152068 138689234 7 5 134885377 134905492 7 5 129511224 129532498 7 RRID:RRRC_00435
2302650 F344-Enox1Tn(sb-T2/Bart3)2.282Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Enox1Tn(sb-T2/Bart3)2.282Mcwi 2302641 15 58555747 58762870 7 15 63013519 63564418 7 15 59331134 59884512 7 15 52517833 53079752 7 RRID:RRRC_00470
2302651 F344-Klra1Tn(sb-T2/Bart3)2.279Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klra1Tn(sb-T2/Bart3)2.279Mcwi 2302638 4 168892865 168928286 7 4 227986994 228022556 7 4 165426365 165460140 7 4 164873735 164985429 7 RRID:RRRC_00431
2302652 F344-Pde4dTn(sb-T2/Bart3)2.285Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pde4dTn(sb-T2/Bart3)2.285Mcwi 2302644 2 40196097 41311012 7 2 59292847 60521358 7 2 40219999 41468551 7 2 40014933 41529190 7 RRID:RRRC_00436
2302653 F344-Mov10Tn(sb-T2/Bart3)2.281Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mov10Tn(sb-T2/Bart3)2.281Mcwi 2302647 2 200053185 200075536 7 2 226696252 226717551 7 2 207277088 207301245 7 2 192292041 192315142 7 RRID:RRRC_00377
2302654 F344-Csmd3Tn(sb-T2/Bart3)2.288Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Csmd3Tn(sb-T2/Bart3)2.288Mcwi 2302637 7 83586771 84932392 7 7 86689912 87802035 7 7 86695703 88072106 7 7 78747322 80066466 7 RRID:RRRC_00390
2302655 F344-Tmtc2Tn(sb-T2/Bart3)2.276Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tmtc2Tn(sb-T2/Bart3)2.276Mcwi 2302646 7 43667983 44133854 7 7 47197110 47603261 7 7 47179596 47586777 7 7 40392377 40806685 7 RRID:RRRC_00376
2302656 F344-Casp7Tn(sb-T2/Bart3)2.280Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. PhysGen mutant Extinct (as of 2017-01-26) Casp7Tn(sb-T2/Bart3)2.280Mcwi 2302642 1 262689300 262721591 7 1 284572208 284623736 7 1 277190557 277242779 7 1 255437438 255476737 7 RRID:RGD_2302656
2302657 F344-Orc3Tn(sb-T2/Bart3)2.275Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Orc3Tn(sb-T2/Bart3)2.275Mcwi 2302648 5 51172243 51226644 7 5 54588113 54644440 7 5 50019159 50075533 7 5 49123758 49181552 7 RRID:RRRC_00375
2302658 F344-BbxTn(sb-T2/Bart3)2.291Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) BbxTn(sb-T2/Bart3)2.291Mcwi 2302640 11 51655446 51799132 7 11 56153038 56397255 7 11 52983286 53228557 7 11 50381249 50628934 7 RRID:RRRC_00428
2302659 F344-Snx25Tn(sb-T2/Bart3)2.270Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Snx25Tn(sb-T2/Bart3)2.270Mcwi 2302636 16 49415658 49518663 7 16 49051539 49159381 7 16 49328958 49432415 7 16 46134552 46238471 7 RRID:RRRC_00374
2302660 F344-Nectin1Tn(sb-T2/Bart3)2.284Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nectin1Tn(sb-T2/Bart3)2.284Mcwi 2302639 8 46739657 46799051 7 8 46714981 46777484 7 8 48094233 48198499 7 8 44101776 44164863 7 RRID:RRRC_00378
2302661 F344-Gramd1bTn(sb-T2/Bart3)2.287Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gramd1bTn(sb-T2/Bart3)2.287Mcwi 2302635 8 43260379 43429258 7 8 61200537 61378124 7 8 44160634 44399110 7 8 40654492 40893869 7 RRID:RRRC_00389
2302662 F344-Slc7a11Tn(sb-T2/Bart3)2.266Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a11Tn(sb-T2/Bart3)2.266Mcwi 2302643 2 139241142 139317101 7 2 158930294 159004937 7 2 139453774 139528479 7 2 134382002 134517622 7 RRID:RRRC_00372
2302666 Scr:sP Sardinian alcohol-preferring rats sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding. The Scripps Research Institute, LaJolla, California outbred Unknown RRID:RGD_2302666
2302984 SS.BN-(D13Rat151-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 64083138 80109632 1 - by flanking markers 13 71941043 87516988 1 - by flanking markers 13 66971778 66971975 1 - by flanking markers 13 61825626 61825824 1 - by flanking markers RRID:RGD_2302984
2302985 SS.BN-(D13Rat111-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;13;13;5 32030139;42627610;45828608;97701780 32030259;42627837;45828716;97703112 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;13;5 54791498;40421740;51509286;100631702 54791605;40421859;51509512;100633034 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;13;13;13 96601805;49720575;46444570;35301263 96603137;49720682;46444796;35301382 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;5 41184022;30395351;93541170 41184251;30395471;93542503 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_2302985
2302986 SS.BN-(D13Rat88-D13Rat91)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 46912163 1 - by flanking markers 13 51509286 55853202 1 - by flanking markers 13 46444570 50799665 1 - by flanking markers 13 41184022 45417941 1 - by flanking markers RRID:RGD_2302986
2302987 SS.BN-(D13Rat7-D13Rat60)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 13053933 1 - by flanking markers 13 19518130 32069874 1 - by flanking markers 13 14279081 26919398 1 - by flanking markers 13 11766535 23001904 1 - by flanking markers RRID:RGD_2302987
2302989 SS.BN-(D13Rat57-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 80109432 100133413 1 - by flanking markers 13 87516787 109040616 1 - by flanking markers 13 104392076 104392271 1 - by flanking markers 13 95722244 95722440 1 - by flanking markers RRID:RGD_2302989
2302994 SS.BN-(D13Rat127-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 63301678 1 - by flanking markers 13 23200281 71179041 1 - by flanking markers 13 17996178 66204711 1 - by flanking markers 13 53382878 61058159 1 - by flanking markers RRID:RGD_2302994
2302995 SS.BN-(D13Rat115-D13Rat101)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 35719010 49428577 1 - by flanking markers 13 44763184 58314767 1 - by flanking markers 13 39639775 53264877 1 - by flanking markers 13 34778619 47841255 1 - by flanking markers RRID:RGD_2302995
2302996 SS.BN-(D13Rat7-D13Rat88)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 38329229 1 - by flanking markers 13 19518130 47267192 1 - by flanking markers 13 14279081 42155682 1 - by flanking markers 13 11766535 37262232 1 - by flanking markers RRID:RGD_2302996
2302997 SS.BN-(D13Rat91-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 63301678 1 - by flanking markers 13 53846466 71179041 1 - by flanking markers 13 48776655 66204711 1 - by flanking markers 13 43437904 61058159 1 - by flanking markers RRID:RGD_2302997
2302999 SS.BN-(D13Rat178-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 57566232 64083335 1 - by flanking markers 13 65516837 71941240 1 - by flanking markers 13 60528276 66971975 1 - by flanking markers 13 55481090 61825824 1 - by flanking markers RRID:RGD_2302999
2303000 SS.BN-(D13Rat123-D13Rat150)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 57566359 1 - by flanking markers 13 53846466 65516963 1 - by flanking markers 13 48776655 60528402 1 - by flanking markers 13 43437904 55481217 1 - by flanking markers RRID:RGD_2303000
2303001 SS.BN-(D13Rat111-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 49428577 1 - by flanking markers 13 40421740 58314767 1 - by flanking markers 13 35301263 53264877 1 - by flanking markers 13 30395351 47841255 1 - by flanking markers RRID:RGD_2303001
2303002 SS.BN-(D13Rat123-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 76779489 1 - by flanking markers 13 51509286 83929327 1 - by flanking markers 13 46444570 79034003 1 - by flanking markers 13 41184022 73485113 1 - by flanking markers RRID:RGD_2303002
2303003 SS.BN-(D13Rat7-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 49428577 1 - by flanking markers 13 19518130 58314767 1 - by flanking markers 13 14279081 53264877 1 - by flanking markers 13 11766535 47841255 1 - by flanking markers RRID:RGD_2303003
2303004 SS.BN-(D13Rat115-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 67752598 1 - by flanking markers 13 71178814 75143303 1 - by flanking markers 13 66204484 70172216 1 - by flanking markers 13 61057931 64901750 1 - by flanking markers RRID:RGD_2303004
2303005 SS.BN-(D13Rat127-D13Rat77)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 57922038 1 - by flanking markers 13 23200281 65861506 1 - by flanking markers 13 17996178 60876578 1 - by flanking markers 13 53382878 55829942 1 - by flanking markers RRID:RGD_2303005
2303006 SS.BN-(D13Rat101-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46269934 72638941 1 - by flanking markers 13 55560677 79943775 1 - by flanking markers 13 75026588 75026713 1 - by flanking markers 13 69535761 69535887 1 - by flanking markers RRID:RGD_2303006
2303007 SS.BN-(D13Rat127-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 72638941 1 - by flanking markers 13 23200281 79943775 1 - by flanking markers 13 17996178 75026713 1 - by flanking markers 13 53382878 69535887 1 - by flanking markers RRID:RGD_2303007
2303008 SS.BN-(D13Rat61-D13GRat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 76779489 1 - by flanking markers 13 71178814 83929327 1 - by flanking markers 13 66204484 79034003 1 - by flanking markers 13 61057931 73485113 1 - by flanking markers RRID:RGD_2303008
2303009 SS.BN-(D13Rat183-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77336098 100133413 1 - by flanking markers 13 84460970 109040616 1 - by flanking markers 13 79567081 104392271 1 - by flanking markers 13 74023918 95722440 1 - by flanking markers RRID:RGD_2303009
2303010 SS.BN-(D13Got51-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 100133413 1 - by flanking markers 13 76974692 109040616 1 - by flanking markers 13 72031440 104392271 1 - by flanking markers 13 66706825 95722440 1 - by flanking markers RRID:RGD_2303010
2303011 SS.BN-(D13Got51-D13Rat57)/Mcwi SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 80109632 1 - by flanking markers 13 76974692 87516988 1 - by flanking markers 13 72031440 72031708 1 - by flanking markers 13 66706825 66707096 1 - by flanking markers RRID:RGD_2303011
2303099 F344-Kcnh7Tn(sb-T2/Bart3)2.295Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnh7Tn(sb-T2/Bart3)2.295Mcwi 2303095 3 44657361 45153509 7 3 55325680 55822973 7 3 48662450 49168716 7 3 47329338 47822122 7 RRID:RRRC_00430
2303100 F344-Slc16a12Tn(sb-T2/Bart3)2.298Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc16a12Tn(sb-T2/Bart3)2.298Mcwi 2303097 1 238643040 238665699 7 1 260197556 260275962 7 1 252976071 253054500 7 1 232184004 232262170 7 RRID:RRRC_00438
2303101 F344-Kcnab1Tn(sb-T2/Bart3)2.300Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnab1Tn(sb-T2/Bart3)2.300Mcwi 2303094 2 154837841 155145882 7 2 174966379 175400010 7 2 155555798 156011438 7 2 149137025 149603540 7 RRID:RRRC_00471
2303102 F344-Dnah11Tn(sb-T2/Bart3)2.293Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Dnah11Tn(sb-T2/Bart3)2.293Mcwi 2303098 6 145190931 145516859 7 6 154698519 155011384 7 6 145784893 146099212 7 6 138839175 139155554 7 RRID:RRRC_00429
2303103 F344-Pebp4Tn(sb-T2/Bart3)2.299Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pebp4Tn(sb-T2/Bart3)2.299Mcwi 2303096 15 50225405 50460627 7 15 55252902 55466149 7 15 51528587 51740626 7 15 44920946 45134188 7 RRID:RRRC_00455
2303116 SPRD.WKY-(D10Rat91-D10Rat135)/Ibmm SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 10 9762188 108776963 1 - by flanking markers 10 8619955 108145987 1 - by flanking markers 10 9841807 108540162 1 - by flanking markers 10 9658275 104670812 1 - by flanking markers RRID:RGD_2303116
2303117 SPRD.WKY-(D5Rat190-D5Rat114)(D18Rat102-D18Rat44)/Ibmm Double congenic strain generated by intercrossing SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm and SPRD.WKY-(D18Rat102-D18Rat44)/Ibmm; F1 animals were intercrossed and F2 screened for heterozygousity by markers Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown RRID:RGD_2303117
2303148 SS.SHR-(D9Wox16-D9Rat76)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 33497026 1 - by flanking markers 9 24681016 40929956 1 - by flanking markers 9 25819185 41261265 1 - by flanking markers 9 22198773 36962591 1 - by flanking markers RRID:RGD_2303148
2303149 SS.SHR-(D9Wox16-D9Mco73)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 47764357 1 - by flanking markers 9 24681016 55323208 1 - by flanking markers 9 25819185 55627498 1 - by flanking markers 9 22198773 50687400 1 - by flanking markers RRID:RGD_2303149
2303150 SS.SHR-(D9Mco74-D9Rat64)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 25174989 91131755 1 - by flanking markers 9 31484855 98715585 1 - by flanking markers 9 32677807 99041268 1 - by flanking markers 9 28806563 92491790 1 - by flanking markers RRID:RGD_2303150
2303151 SS.SHR-(D9Wox16-D9Mco77)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 54083264 1 - by flanking markers 9 24681016 64294638 1 - by flanking markers 9 25819185 64491201 1 - by flanking markers 9 22198773 56777289 1 - by flanking markers RRID:RGD_2303151
2303152 SS.SHR-(D9Mco72-D9Mco93)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 90249887 1 - by flanking markers 9 52352690 97845437 1 - by flanking markers 9 52686874 98164303 1 - by flanking markers 9 47902208 91616855 1 - by flanking markers RRID:RGD_2303152
2303153 SS.SHR-(D9Rat7-D9Mco93)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77170797 90249887 1 - by flanking markers 9 83451810 97845437 1 - by flanking markers 9 83686153 98164303 1 - by flanking markers 9 79271511 91616855 1 - by flanking markers RRID:RGD_2303153
2303154 SS.SHR-(D9Wox16-D9Mco85)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 76456066 1 - by flanking markers 9 24681016 82659881 1 - by flanking markers 9 25819185 82890620 1 - by flanking markers 9 22198773 78595166 1 - by flanking markers RRID:RGD_2303154
2303504 LEW/JmsNgs congenital hydrocephalus rat Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry RRID:RGD_2303759
2303761 SD-Tg(CAG-EGFP)4Osb Green rat This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc. National BioResource Project for the Rat in Japan transgenic Live Animals RRID:RGD_2303761
2303779 OLETF-Chr 14F344/Tj Chromosome 14 from F344 is introgressed in OLETF background National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303779
2303784 SHR-Chr 4WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303784
2303785 SHRSP-Chr 3WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303785
2303792 WTC.ZI-Atrnzi/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrnzi 40902832 RRID:RGD_2303792
2303793 WTC.DMY-dmy/Kyo Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2303793
2303971 OLETF.F344-(D7Mgh16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 96492203 1 - by flanking markers 7 100584458 100584693 1 - by flanking markers 7 100004559 100004794 1 - by flanking markers 7 91256311 91256547 1 - by flanking markers RRID:RGD_2303971
2303972 BN-Chr 13SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed PhysGen consomic Unknown RRID:RGD_2303972
2303973 OLETF.F344-(D10Wox7-D10Wox6)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_2303973
2303976 F344-Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi 2303974 2 103102679 103271273 7 2 122442002 122610354 7 2 102701903 102871257 7 2 100502791 100669713 7 RRID:RRRC_00472
2303977 F344-Ano3Tn(sb-T2/Bart3)2.307Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ano3Tn(sb-T2/Bart3)2.307Mcwi 2303975 3 96123925 96237157 7 3 108441370 108751911 7 3 101843516 102203368 7 3 97235671 97550090 7 RRID:RRRC_00477
2303978 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303978
2303979 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303979
2303986 WKAH.LEC-Atp7bhts/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11) Cancer Atp7bhts 11532742 16 74607988 74680080 7 16 74495179 74575822 7 16 74865516 74944935 7 16 69952286 70024404 7 RRID:RGD_2303986
2303987 F344.OLETF-(D17Mgh4-Edn1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Edn1 2532 17 28303886 28309775 1 - by flanking markers 17 24117499 24124188 1 - by flanking markers 17 22136814 22143745 1 - by flanking markers 17 22454924 22460812 1 - by flanking markers RRID:RGD_2303987
2303988 F344.OLETF-(D14Rat23-D14Rat12)(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303988
2303989 F344.OLETF-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303989
2303990 F344.OLETF-(D1Mit20-D1Mgh26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2303990
2303991 F344.OLETF-(D7Rat31-D7Rat35)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 20307479 28488710 1 - by flanking markers 7 24326613 32338830 1 - by flanking markers 7 24175337 32258115 1 - by flanking markers 7 18169505 26029351 1 - by flanking markers RRID:RGD_2303991
2303992 F344.OLETF-(D5Mgh29-D5Mgh22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 157584332 157584492 1 - by flanking markers 5 160953624 160953783 1 - by flanking markers 5 157212263 157212422 1 - by flanking markers 5 151005994 151006154 1 - by flanking markers RRID:RGD_2303992
2303993 OLETF.F344-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303993
2303994 F344.OLETF-(D5Mgh4-D5Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 99344678 99344842 1 - by flanking markers 5 102264251 102264414 1 - by flanking markers 5 98224053 98224216 1 - by flanking markers 5 95112065 95112231 1 - by flanking markers RRID:RGD_2303994
2303995 F344.OLETF-(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2303995
2303996 F344.Cg-Foxn1rnu/Kyo This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 10 63251400 63273710 1 - by flanking markers RRID:RGD_2303996
2303997 F344.OLETF-(D7Mgh8-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303997
2303998 WKAH.LEC-Ptprkthid/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Ptprk 619706 1 17328563 17752200 1 - by flanking markers 1 18602550 19574958 1 - by flanking markers 1 17445052 18058266 1 - by flanking markers 1 16738896 17236687 1 - by flanking markers RRID:RGD_2303998
2303999 F344.OLETF-(D14Rat8-D14Rat26)(D14Rat18-D14Rat22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303999
2304000 F344.OLETF-(D12Wox5-D12Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2304000
2304001 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304001
2304002 F344.OLETF-(D11Mgh4-D11Mgh1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2304002
2304003 F344.OLETF-(D16Rat19-D16Rat13)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 35339929 77968799 1 - by flanking markers 16 35126908 77759249 1 - by flanking markers 16 35307110 78172206 1 - by flanking markers 16 31951520 73187298 1 - by flanking markers RRID:RGD_2304003
2304004 F344.OLETF-(D7Mit2-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304004
2304016 BUF.ACI-(D4Rat192-D4Rat66)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 161023350 161023765 1 - by flanking markers 4 224435359 224435481 1 - by flanking markers 4 157417581 157417703 1 - by flanking markers 4 157704599 157704722 1 - by flanking markers RRID:RGD_2304016
2304017 F344.CVD-Unc5ccvd/Kyo CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05) Neurobiology Unc5c|Unc5ccvd 735109|12802355 2 239365109 239721231 7 2 265573406 265926229 7 2 247352390 247352390 8 2 230489880 230489880 8 RRID:RGD_2304017
2304018 BUF.ACI-(D4Rat226-D4Rat109)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 61542056 117094107 1 - by flanking markers 4 61331785 178404466 1 - by flanking markers 4 61612433 113728420 1 - by flanking markers 4 62837725 115401611 1 - by flanking markers RRID:RGD_2304018
2304019 BUF.ACI-(D15Rat68-D15Rat29)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 62521452 108387411 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2304019
2304020 ACI.BUF-(D15Rat97-D15Rat29)/Ncc This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 78048029 108387411 1 - by flanking markers 15 82573157 82573380 1 - by flanking markers 15 79033484 79033707 1 - by flanking markers 15 71477067 71477291 1 - by flanking markers RRID:RGD_2304020
2304037 DDI/Ddia dokkyo diabetes insipidus rat Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Urology RRID:RGD_2304037
2304038 OP/Jtt Opacitas Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Ophthalmology RRID:RGD_2304038
2304039 WIC-Tgrdw/Kts Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism Tgrdw 12879860 7 104035776 104220754 7 7 107399165 107602400 7 7 107567063 107567063 8 7 98517376 98517376 8 RRID:RGD_2304039
2304040 F344.OP-Op/Jtt Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology RRID:RGD_2304040
2304041 SD-Tg(CAG-Rgn)Slc Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene National BioResource Project for the Rat in Japan transgenic Live Animals Osteosis Rgn 3560 RRID:RGD_2304041
2304045 F344.ZUC-Leprfa(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_2304045
2304046 F344.ZUC-(Leprfa)(D7Rat16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 108647236 108647376 1 - by flanking markers 7 112143411 112143550 1 - by flanking markers 7 112204378 112204517 1 - by flanking markers 7 102920123 102920263 1 - by flanking markers RRID:RGD_2304046
2304047 F344.ZUC-Leprfa/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity Lepr|Leprfa 3001|13432153 RRID:RGD_2304047
2304050 F344.OLETF-(D14Rat23-D14Rat55)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 27571792 1 - by flanking markers 14 2222207 27510976 1 - by flanking markers 14 2227825 27686562 1 - by flanking markers 14 1217606 25656577 1 - by flanking markers RRID:RGD_2304050
2304051 F344.OLETF-(D14Rat8-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 41707592 1 - by flanking markers 14 32389647 61886417 1 - by flanking markers 14 32593926 61783215 1 - by flanking markers 14 30320092 39153750 1 - by flanking markers RRID:RGD_2304051
2304052 F344.OLETF-(D14Rat55-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 27571487 41707592 1 - by flanking markers 14 27510756 61886417 1 - by flanking markers 14 27686342 61783215 1 - by flanking markers 14 25656356 39153750 1 - by flanking markers RRID:RGD_2304052
2304053 F344.OLETF-(D14Rat23-D14Rat5)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 11589751 1 - by flanking markers 14 2222207 11868597 1 - by flanking markers 14 2227825 11926177 1 - by flanking markers 14 1217606 10277166 1 - by flanking markers RRID:RGD_2304053
2304054 F344.OLETF-(D14Rat23-D14Rat10)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 33157602 1 - by flanking markers 14 2222207 32957654 1 - by flanking markers 14 2227825 33163485 1 - by flanking markers 14 1217606 30883947 1 - by flanking markers RRID:RGD_2304054
2304055 F344.OLETF-(D14Wox1-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 41707423 41707592 1 - by flanking markers 14 61886249 61886417 1 - by flanking markers 14 61783047 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304055
2304056 F344.OLETF-(D14Rat23-D14Wox14)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 21885861 1 - by flanking markers 14 2222207 21925011 1 - by flanking markers 14 2227825 22009966 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304056
2304057 F344.OLETF-(D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in JapanD14Rat143-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 19738306 41707592 1 - by flanking markers 14 19754557 61886417 1 - by flanking markers 14 19847829 61783215 1 - by flanking markers 14 18212584 39153750 1 - by flanking markers RRID:RGD_2304058
2304059 F344.OLETF-(D14Rat5-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 11589293 41707592 1 - by flanking markers 14 11868448 61886417 1 - by flanking markers 14 11926028 61783215 1 - by flanking markers 14 10277016 39153750 1 - by flanking markers RRID:RGD_2304059
2304060 F344.OLETF-(D14Wox14-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 21885743 41707592 1 - by flanking markers 14 21924894 61886417 1 - by flanking markers 14 22009849 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304060
2304061 F344.OLETF-(D14Rat23)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 1764554 1 - by flanking markers 14 2222207 2222374 1 - by flanking markers 14 2227825 2227992 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304061
2304063 KDP-Tg(H2Kd-Cblb)2Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304063
2304064 KDP-Tg(H2Kd-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304064
2304065 KDP-Tg(INS-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304065
2304066 KDP-Tg(CAG-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Unknown Cblb 620535 RRID:RGD_2304066
2304074 WKY.BUF-Tsr1d/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304074
2304075 ACI.BUF-Pur1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304075
2304076 WKY.BUF-Thym1, Thym2/Mna This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-03-14) Cancer RRID:RGD_2304076
2304077 WKY.BUF-Pur1s/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304077
2304078 ACI.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304078
2304079 WKY.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304079
2304080 ACI.BUF-Aftm1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2304080
2304081 WKY.BUF-Pur1w/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304081
2304082 WKY.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304082
2304083 ACI.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304083
2304093 SHRSP.WKY-(D1Rat106-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 139471535 187092492 1 - by flanking markers 1 146068162 206277202 1 - by flanking markers 1 145140412 199254774 1 - by flanking markers 1 137184788 182418476 1 - by flanking markers RRID:RGD_2304093
2304094 SHRSP.WKY-(D1Smu12-D1Rat44)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Unknown Cardio Hypertension 1 153754139 153754250 1 - by flanking markers 1 167707459 167707569 1 - by flanking markers 1 161493758 161493868 1 - by flanking markers 1 150872626 150872737 1 - by flanking markers RRID:RGD_2304094
2304095 W-Tg(Plcb2-WGA-EGFP)F1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304095
2304096 SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304096
2304097 SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304097
2304098 SHRSP.WKY-(D1Smu13-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304098
2304099 SHRSP.WKY-(D1Smu12-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304099
2304100 SHRSP.WKY-(D1Rat39-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 125983422 187092492 1 - by flanking markers 1 133172202 206277202 1 - by flanking markers 1 132134307 199254774 1 - by flanking markers 1 124668437 182418476 1 - by flanking markers RRID:RGD_2304100
2304101 SHRSP.WKY-(D1Rat43-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 144634295 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304101
2304102 SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304102
2304104 W-Tg(Plcb2-WGA-EGFP)M1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304104
2304120 SHRSP/2Ta Kyo > Ta (1972) National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304120
2304121 DA.WF-(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 1 146971846 146971983 1 - by flanking markers 1 162692213 162692800 1 - by flanking markers 1 156446196 156446783 1 - by flanking markers 1 144267353 144267916 1 - by flanking markers RRID:RGD_2304121
2304122 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304122
2304123 DA.WF-(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nos3 3186 4 6158847 91330856 1 - by flanking markers 4 7333272 157291359 1 - by flanking markers 4 7321908 92484312 1 - by flanking markers 4 10793834 91360801 1 - by flanking markers RRID:RGD_2304123
2304124 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304124
2304125 DRH.F344-(D1Mgh8-D1Mgh12)/Shigm desired fragment from F344 was introgressed into DRH background National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1 156124624 247322277 1 - by flanking markers 1 169999389 270717037 1 - by flanking markers 1 163796316 163796432 1 - by flanking markers 1 153136852 153136969 1 - by flanking markers RRID:RGD_2304125
2304200 W-Tg(CAG-ABO*A)32Jmsk This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304200
2304201 F344-Galntl6Tn(sb-T2/Bart3)2.311McwiRrrc These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Galntl6Tn(sb-T2/Bart3)2.311Mcwi 2304194 16 34557663 35853849 7 16 34380195 35619972 7 16 34551052 35803840 7 16 31192880 32443979 7 RRID:RRRC_00450
2304202 F344-RGD1565323Tn(sb-T2/Bart3)2.312Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1565323Tn(sb-T2/Bart3)2.312Mcwi 2304193 17 38022396 38039975 7 17 34865901 34882646 7 17 32973695 32990440 7 17 31661713 31678816 7 RRID:RRRC_00437
2304203 W-Tg(CAG-DsRed2/GFP)1Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304203
2304204 W-Tg(CAG-ABO*B)13Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304204
2304205 W-Tg(Alb-DsRed2)34Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304205
2304206 W-Tg(CAG-DsRed2/GFP)15Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00300
2304207 F344-LzicTn(sb-T2/Bart3)2.309Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LzicTn(sb-T2/Bart3)2.309Mcwi 2304196 5 166567412 166579423 7 5 170076617 170089776 7 5 166430305 166443485 7 5 159928260 159941512 7 RRID:RRRC_00434
2304208 F344-Rapgef4Tn(sb-T2/Bart3)2.314Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rapgef4Tn(sb-T2/Bart3)2.314Mcwi 2304197 3 54396312 54717148 7 3 65122705 65409814 7 3 58632338 58925127 7 3 56809388 57101332 7 RRID:RRRC_00479
2304209 F344-RorbTn(sb-T2/Bart3)2.304Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene. PhysGen mutant Extinct (as of 2017-01-26) RorbTn(sb-T2/Bart3)2.304Mcwi 2304199 1 222545682 222726307 7 1 241354340 241541103 7 1 234252757 234442597 7 1 216363629 216544390 7 RRID:RGD_2304209
2304210 W-Tg(Alb-DsRed2)42Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00260
2304211 W-Tg(CAG-cre)81Jmsk This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo (as of 2018-07-16) Development RRID:RRRC_00301
2304212 F344-RGD1563503Tn(sb-T2/Bart3)2.313Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1563503Tn(sb-T2/Bart3)2.313Mcwi 2304198 17 21066144 21067040 7 17 17584757 17585688 7 17 15526295 15527253 7 RRID:RRRC_00453
2304213 F344-P3h3Tn(sb-T2/Bart3)2.310Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) P3h3Tn(sb-T2/Bart3)2.310Mcwi 2304195 4 160964297 160978321 7 4 224377005 224392881 7 4 157359331 157375186 7 4 157646242 157662035 7 RRID:RRRC_00433
2304214 W-Tg(CAG-ABO*B)2Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304214
2304215 F344-Tg(XPO1)1Hik F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer; Infectious RRID:RGD_2304215
2304221 WTC-swh/Kyo The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-Atrnzi colony at the National Cancer Center Research Institute in 1998. After elimination of zi allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11) Dermatology EdaraddswhKyo 14398765 17 67056373 67143933 7 17 92462305 92503399 7 17 90802280 90843476 7 17 85866629 85910612 7 RRID:RGD_2304221
2304222 WIAR/Iar Inbred Wistar-Imamichi Strain developed by the depositor. This strain was established by inbreeding of Wistar-Imamichi rats by sib-mating. Strain characteristic is same as that of Wistar-Imamichi. (Nov 6, 2009) National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism; Development RRID:RGD_2304222
2304241 F344-Tg(CXCR4)1Hik Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious CXCR4 732176 RRID:RGD_2304241
2304242 WTC-Kcnq1dfkKyo Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrnzi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1dfk/Kyo rat is a mutant for circling behavior. although the Atrnzi allele of WTC.ZI-Atrnzi congenic rats was eliminated, the circling behavior remained. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-04-05) Otorhinology; Internal Organ Kcnq1|Kcnq1dfk 621503|12802344 1 203383401 203803687 7 1 223154713 223490458 7 1 216377021 216379067 8 1 198374486 198376539 8 RRID:RGD_2304242
2304277 SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 128874534 139471673 1 - by flanking markers 1 136045631 146282094 1 - by flanking markers 1 135022396 145354344 1 - by flanking markers 1 127453884 137184926 1 - by flanking markers RRID:RGD_2304277
2304278 DA-Tg(Alb-HSVtk)5Jmsk This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304278
2304279 W-Tg(MT2A-Myc)1Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304279
2304280 SHR/Shi Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304280
2304281 SERC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology RRID:RGD_2304281
2304282 IEW/Ihr mutant of Ihara epileptic rat. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Neurobiology; Ophthalmology RRID:RGD_2304282
2304283 SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2304283
2304284 SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 218467340 1 - by flanking markers 1 80946174 239429964 1 - by flanking markers 1 79689548 232297227 1 - by flanking markers 1 78430536 212458660 1 - by flanking markers RRID:RGD_2304284
2304285 BDIX/NemOda This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992. National BioResource Project for the Rat in Japan inbred Unknown Cancer RRID:RGD_2304285
2304286 DMYC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan coisogenic Cryopreserved Sperm RRID:RGD_2304286
2304287 ACI.F344-(D16Rat17-D16Rat15)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304287
2304288 ACI.BUF-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304288
2304289 SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 130788777 1 - by flanking markers 1 80946174 137735636 1 - by flanking markers 1 79689548 136742994 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304289
2304290 BUF.ACI-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304290
2304291 LEW-Tg(CAG-EGFP)1Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304291
2304292 LEW-Tg((ROSA)26Sor-luc)21Jmsk This strain expresses luciferase ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2304292
2304293 F344.LEC-xhs1/1Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304293
2304294 MPOD/Kyo Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cancer; Immunology RRID:RGD_2304294
2304295 SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Igf1r 2869 1 122704976 128874670 1 - by flanking markers 1 129985761 136045766 1 - by flanking markers 1 128924921 135022531 1 - by flanking markers 1 121549831 127454022 1 - by flanking markers RRID:RGD_2304295
2304296 KB/Oda Maintained by crossing heterozygotes of the albino locus (segregating inbred strain). National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo RRID:RGD_2304296
2304297 TM.KDP-Cblb/Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 11 49690402 49856762 1 - by flanking markers 11 54218260 54383403 1 - by flanking markers 11 51037383 51202761 1 - by flanking markers 11 48589878 48756940 1 - by flanking markers RRID:RGD_2304297
2304298 SD-Tg(Tuba1a-EYFP)Okn This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter. National BioResource Project for the Rat in Japan transgenic Unknown RRID:RGD_2304298
2304299 LEW-Tg(Alb-GFP)6Jmsk This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304299
2304300 W-Tg(S100b-EGFP)Scell Developed by microinjecting the transgene into Wistar rats National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Metabolism RRID:RGD_2304300
2304301 SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Slco3a1 620227 1 129580126 139471673 1 - by flanking markers 1 136793300 146282094 1 - by flanking markers 1 135790854 145354344 1 - by flanking markers 1 128106232 137184926 1 - by flanking markers RRID:RGD_2304301
2304302 SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2304302
2304303 W-Tg(MT2A-Myc)2Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304303
2304304 SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 142486986 199254774 1 - by flanking markers 1 134641522 182418476 1 - by flanking markers RRID:RGD_2304304
2304305 DOB/Oda This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_2304305
2304306 BUF.ACI-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304306
2304307 ACI.BUF-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304307
2304308 ICR/Ihr A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract. National BioResource Project for the Rat in Japan inbred Live Animals (as of 2019-08-05) Neurobiology; Ophthalmology RRID:RGD_2304308
2304309 SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304309
2304310 SD-Tg(Nes/Hspa1b-EGFP)Okn This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2304310
2304311 LEW-Tg((ROSA)26Sor-lacZ)44JmskRrrc This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RRRC_00298
2304312 SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2304312
2304313 SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304313
2304314 BDIX.Cg-Tal/NemOda Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Osteosis RRID:RGD_2304314
2304315 SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Calca 2254 1 172686168 187092492 1 - by flanking markers 1 191158061 206277202 1 - by flanking markers 1 184184018 199254774 1 - by flanking markers 1 168878212 182418476 1 - by flanking markers RRID:RGD_2304315
2304316 F344.LEC-xhs1/2Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304316
2304329 WKY/Ezo Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_2304329
2304330 SD-Tg(HRAS)128Ncc This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30) Cancer RRID:RGD_2304330
2304331 F344-Tg(CCR5)1Hik Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious RRID:RGD_2304331
2304332 HER/Wkmt Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology RRID:RGD_2304332
2305934 F344-Spta1Tn(sb-T2/Bart3)2.315Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spta1Tn(sb-T2/Bart3)2.315Mcwi 2305932 13 89951924 90028592 7 13 96782387 96860327 7 13 92264231 92340091 7 13 86203504 86279371 7 RRID:RRRC_00439
2305935 F344-Rtn4Tn(sb-T2/Bart3)2.316Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rtn4Tn(sb-T2/Bart3)2.316Mcwi 2305933 14 110725089 110772578 7 14 113792257 113839936 7 14 114126931 114174459 7 14 103450074 103497687 7 RRID:RRRC_00476
2305939 SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305939
2305940 SHRSP-Chr 7WKY/Tkyo Chromosome 7 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305940
2305941 SHR-Chr 15WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305941
2305942 SHR-Chr 3WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305942
2305943 SHRSP-Chr 15WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305943
2305944 SHRSP-Chr 4WKY/Tkyo Chromosome 4 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305944
2305945 SHRSP-Chr 13WKY/Tkyo Chromosome 13 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305945
2305946 SHR-Chr 1WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305946
2305947 SHR-Chr 19WKY/Tkyo Chromosome 19 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305947
2305948 SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305948
2305949 SHRSP-Chr 1WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305949
2305966 SHR.SHRSP-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305966
2305967 SHR.SHRSP-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305967
2305968 SHRSP.WKY-(D1Wox18-D1Rat39)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 125983558 1 - by flanking markers 1 101198387 133172336 1 - by flanking markers 1 100133276 132134441 1 - by flanking markers 1 94644435 124668572 1 - by flanking markers RRID:RGD_2305968
2305969 SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2305969
2305970 DA-Tg(Alb-TTR*V30M)7Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2305970
2305971 SHRSP.SHR-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305971
2305972 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305972
2305973 SHRSP.SHR-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305973
2305974 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305974
2305975 SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2305975
2305976 DA-Tg(Alb-TTR*V30M)9Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource & Research Center transgenic Cryopreserved Embryo Development RRID:RRRC_00339
2305977 ACI.F344-(D16Rat12-D16Mco2)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 350121 67547357 1 - by flanking markers 16 1084304 67099528 1 - by flanking markers 16 1090054 1090164 1 - by flanking markers 16 380245 380356 1 - by flanking markers RRID:RGD_2305977
2305978 LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2305978
2305979 WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305979
2305987 F344.OLETF-(D7Mgh16-D7Wox46)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 113050225 1 - by flanking markers 7 100584458 116158165 1 - by flanking markers 7 100004559 116255796 1 - by flanking markers 7 91256311 106845450 1 - by flanking markers RRID:RGD_2305987
2305988 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305988
2305989 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Z-Leprfa/Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305989
2305990 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305990
2305991 (F344.OLETF-(D7Mgh16-D7Mgh20)/Tj X F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305991
2305992 F344.OLETF-(D7Mit16-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7 113886156 113886318 1 - by flanking markers RRID:RGD_2305992
2305993 F344.OLETF-(D14Rat23)(D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305993
2305994 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity RRID:RGD_2305994
2305995 F344.OLETF-(D7Got130-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305995
2305996 F344.Cg-Leprfa(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305996
2305997 (F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/2Tj x F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305997
2305998 F344.Cg-Leprfa(D8Rat54-D8Mgh17)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2305998
2305999 F344.OLETF-(D7Mgh16-D7Rat70)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 117397170 1 - by flanking markers 7 100584458 120641361 1 - by flanking markers 7 100004559 120648531 1 - by flanking markers 7 91256311 110979877 1 - by flanking markers RRID:RGD_2305999
2306000 F344.OLETF-(D7Rat70-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 117396947 117397170 1 - by flanking markers 7 120641139 120641361 1 - by flanking markers 7 120648309 120648531 1 - by flanking markers 7 110979654 110979877 1 - by flanking markers RRID:RGD_2306000
2306001 F344.OLETF-(D7Rat176-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 111200727 111200952 1 - by flanking markers 7 114641525 114641749 1 - by flanking markers 7 114708083 114708307 1 - by flanking markers 7 105399233 105399458 1 - by flanking markers RRID:RGD_2306001
2306002 F344.OLETF-(D14Rat23)(D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306002
2306003 F344.OLETF-(D7Wox46-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 113050053 113050225 1 - by flanking markers 7 116157993 116158165 1 - by flanking markers 7 116255624 116255796 1 - by flanking markers 7 106845277 106845450 1 - by flanking markers RRID:RGD_2306003
2306004 F344.OLETF-(D7Mgh16-D7Mit16)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 120746007 1 - by flanking markers 7 100584458 123587717 1 - by flanking markers 7 100004559 123602998 1 - by flanking markers 7 91256311 113886318 1 - by flanking markers RRID:RGD_2306004
2306013 F344.OLETF-(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_2306013
2306014 F344.OLETF-(D8Rat54-D8Mgh17)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2306014
2306015 F344.OLETF-(D12Wox5-D12Rat21)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2306015
2306016 F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2306016
2306017 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306017
2306018 F344.OLETF-(D9Mgh8-D9Mit2)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2306018
2306019 F344.OLETF-(D1Mit20-D1Mgh26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2306019
2306020 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306020
2306021 SHR-Chr 2WKY/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2306021
2306022 KCI/Kyo Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Pcdh15 1590969 20 14507804 15240479 7 20 17138580 19021206 7 20 14952213 15334745 7 20 13997094 15496446 7 RRID:RGD_2306022
2306023 F344-Tg(CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious CCNT1 1322457 RRID:RGD_2306023
2306024 FOK/Ncu Furuyama rat These are resistant to hot environment. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2306024
2306025 WMN/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306025
2306026 F344.OLETF-(D16Wox4-D16Rat13)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_2306026
2306027 WM/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306027
2306028 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306028
2306029 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306029
2306030 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306030
2306033 SHR.Cg-Leprcp/NDmcr Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension Leprcp 11570565 RRID:RGD_2306033
2306034 NER.F344-(D1Mgh6-D1Rat132)(D5Rat100-D5Rat234)/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology RRID:RGD_2306034
2306035 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)/Kyo This double congenic strain was established by crossing F344.NER-(D1Mgh6-D1Rat73)/Kyo and F344.NER-(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan congenic Live Animals Neurobiology RRID:RGD_2306035
2306036 F344-Apcm1Kyo F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-03-14) Cancer Apc|Apcm1Kyo 2123|12792252 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RGD_2306036
2306037 F344-Tg(CD4)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306037
2306041 F344-Scn1am2Kyo Established by ENU mutagenesis. A point mutation in Scn1a gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Scn1am2Kyo 12792284 3 48238528 48364143 7 3 59016641 59135580 7 3 52437310 52437310 8 3 50998498 50998498 8 RRID:RGD_2306041
2306042 F344-Scn1am1Kyo Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Neurobiology Scn1am1Kyo 12792283 3 48238528 48364143 7 3 59016641 59135580 7 3 52408707 52408707 8 3 50969024 50969024 8 RRID:RGD_2306042
2306043 SHR/4Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306043
2306044 SHRSP/3Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306044
2306045 SHR/2Dmcr Developed by the DEPOSITOR, one of the SHR substrains from B2 line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306045
2306046 W-Tg(CAG-EGFP)3Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo RRID:RGD_2306046
2306047 W-Tg(Gnrh1-EGFP)Nphy This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Gnrh1 2720 RRID:RGD_2306047
2306048 SHR/3Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306048
2306049 SHRSP/4Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306049
2306050 SHRSP/5Dmcr Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306050
2306051 SHRSP/2Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306051
2306058 LEC.W-Tg(CAG-Zfml)30Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306058
2306059 DA.Cg-Foxn1rnu Lystbg/Slc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Immunology; Hematology Foxn1|Lyst 3970|621837 RRID:RGD_2306059
2306060 LEC.W-Tg(CAG-Zfml)26Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306060
2306061 ACI.BUF-Pur1, Thym2/Mna The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002. National BioResource Project for the Rat in Japan congenic Unknown Metabolism RRID:RGD_2306061
2306062 W-Tg(Per1-luc)1Oa Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00273
2306063 LEC.W-Tg(CAG-Zfml)21Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306063
2306064 MPR/Iar Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Osteosis Arsb|ArsbMPR 2158|12792967 2 24067560 24223821 7 2 42559079 42717753 7 2 23385154 23543028 7 2 25002210 25162675 7 RRID:RGD_2306064
2306070 WIC-Tg(Wap-GH1)1Mni Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306070
2306071 F344-Tg(CAG-EGFP)Ncco Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer; Metabolism RRID:RGD_2306071
2306072 ACI.F344-(D16Nkg74)/Nkg A sub congenic strain of ACI/N.F344-(D16Rat12-D16Mco2)/Nkg National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306072
2306073 WIC-Tg(Wap-GH1)2Mni Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306073
2306076 ACI.F344-(D16Nkg9-D16Nkg38)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306076
2306077 ACI.F344-(D16Rat64-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 59398206 59398647 1 - by flanking markers 16 58966446 58966664 1 - by flanking markers 16 59285775 59285993 1 - by flanking markers 16 55711087 55711306 1 - by flanking markers RRID:RGD_2306077
2306078 KFRS4A/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior RRID:RGD_2306078
2306079 ACI.F344-(D16Nkg87-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat64-D16Nkg105)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306079
2306085 TCR/Ibu Toyoda Circling Rat A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior RRID:RGD_2306085
2306089 ACI.BUF-(D7Wox16-D7Rat69)/Mna The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 7 64611964 113044228 1 - by flanking markers 7 67991394 116151991 1 - by flanking markers 7 67801457 67801690 1 - by flanking markers 7 60460452 60460686 1 - by flanking markers RRID:RGD_2306089
2306090 ExHC/Ta Exogenously hypercholesterolemic rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism RRID:RGD_2306090
2306098 ACI.F344-(D16Nkg30-D16Mgh6)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 16 49150370 49150515 1 - by flanking markers 16 48766016 48766115 1 - by flanking markers 16 49051407 49051506 1 - by flanking markers 16 45868397 45868497 1 - by flanking markers RRID:RGD_2306098
2306099 SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 62521592 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2306099
2306100 SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 99858951 170016653 1 - by flanking markers 3 112038782 180128021 1 - by flanking markers 3 105465332 176418101 1 - by flanking markers 3 100769917 168026850 1 - by flanking markers RRID:RGD_2306100
2306101 LEC.BN-(D4Mgh16-D4Rat233)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 61646674 108329449 1 - by flanking markers 4 61427427 170105737 1 - by flanking markers 4 61708103 105384025 1 - by flanking markers 4 62933269 107032773 1 - by flanking markers RRID:RGD_2306101
2306102 BN.LEC-(D4Rat128-D4Rat106)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 117887968 1 - by flanking markers 4 145335315 179959894 1 - by flanking markers 4 80666353 115372927 1 - by flanking markers 4 79986873 116179656 1 - by flanking markers RRID:RGD_2306102
2306103 SHRSP/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_2306103
2306104 BN.LEC-(D4Rat184-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 120665583 142160377 1 - by flanking markers 4 182854846 203361566 1 - by flanking markers 4 118283596 138891201 1 - by flanking markers 4 118928273 139725596 1 - by flanking markers RRID:RGD_2306104
2306105 BN.LEC-(D4Rat128-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 142160377 1 - by flanking markers 4 145335315 203361566 1 - by flanking markers 4 80666353 138891201 1 - by flanking markers 4 79986873 139725596 1 - by flanking markers RRID:RGD_2306105
2306106 CLX/Ta Circling behavior linked to the X-chromosome (CLX) Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Behavior RRID:RGD_2306106
2306107 SD-Tg(Sp6)58Tj The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-22) Dentistry; Development Sp6 1306768 RRID:RGD_2306107
2306108 SHR.WKY-(D3Mit9-D3Wox16)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 26674018 89245110 1 - by flanking markers 3 39535971 100667805 1 - by flanking markers 3 34394121 94028641 1 - by flanking markers 3 30356773 90477342 1 - by flanking markers RRID:RGD_2306108
2306109 SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 50522618 170016653 1 - by flanking markers 3 61249840 180128021 1 - by flanking markers 3 54630948 176418101 1 - by flanking markers 3 53184593 168026850 1 - by flanking markers RRID:RGD_2306109
2306110 IER/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Neurobiology RRID:RGD_2306110
2306111 LEC.BN-(D4Mgh16-D4Rat233)(D4Rat271-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306111
2306112 ZDF-LeprfaCrlCrlj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo Diabetes Obesity Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_2306112
2306113 SD-Tg(Sp6)6Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306113
2306114 SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2306114
2306115 SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 101359980 1 - by flanking markers 3 11361699 113470358 1 - by flanking markers 3 6000748 106900596 1 - by flanking markers 3 10778704 102200699 1 - by flanking markers RRID:RGD_2306115
2306116 SD-Tg(Sp6)5Tj The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306116
2306117 ACI.F344-(D16Nkg9-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306117
2306118 SHR.WKY-(D15Rat95-D15Rat106)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 69469532 106177917 1 - by flanking markers 15 74166614 109944957 1 - by flanking markers 15 70559420 106550657 1 - by flanking markers 15 63180675 98288169 1 - by flanking markers RRID:RGD_2306118
2306119 F344-Tg(CD4,CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306119
2306120 SHR.WKY-(D4Wox27-D4Rat15)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 4 460493 47890193 1 - by flanking markers 4 3096322 48448808 1 - by flanking markers 4 3044017 48656399 1 - by flanking markers 4 5218294 50119996 1 - by flanking markers RRID:RGD_2306120
2306276 F344-Exoc4Tn(sb-T2/Bart3)2.317Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Exoc4Tn(sb-T2/Bart3)2.317Mcwi 2306273 4 60406942 61284294 7 4 60287465 61081401 7 4 60549128 61358305 7 4 61807706 62584316 7 RRID:RRRC_00456
2306277 F344-Gng12Tn(sb-T2/Bart3)2.320Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gng12Tn(sb-T2/Bart3)2.320Mcwi 2306274 4 96622363 96624479 7 4 162420268 162549350 7 4 97634925 97763478 7 4 96011118 96134767 7 RRID:RRRC_00454
2306278 F344-AW915325Tn(sb-T2/Bart3)2.319Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-31) AW915325Tn(sb-T2/Bart3)2.319Mcwi 2306272 RRID:RRRC_00448
2306279 F344-Diaph3Tn(sb-T2/Bart3)2.318Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Diaph3Tn(sb-T2/Bart3)2.318Mcwi 2306275 15 68905784 69267707 7 15 73538942 74007617 7 15 69928507 70400077 7 15 62543375 63013060 7 RRID:RRRC_00446
2306529 BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Parental strain BBDR.BBDP-(D4Rhw17-ss99306861)(D4Rhw11-D4Rhw10)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75808584 77809321 1 - by flanking markers 4 142052025 144005977 1 - by flanking markers 4 77380565 79326833 1 - by flanking markers 4 76721312 78654798 1 - by flanking markers RRID:RGD_2306529
2306532 BBDR.F344-(D4Rat27-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306532
2306533 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/2Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RRRC_00469
2306534 BBDR.F344-(D4Rat102-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306534
2306535 BBDR.F344-(D4Rat253-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306535
2306536 BBDR.F344-(D4Arb11-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains generated by intercrossing male BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw and female BBDR/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306536
2306537 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/1Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306537
2306538 BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306538
2306539 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/3Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306539
2306540 BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306540
2306541 BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington, Rat Resource and Research Center congenic Unknown RRID:RRRC_00457
2306542 BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306542
2306543 BBDR.F344-(D4Got59-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306543
2306544 BBDR.F344-(D4Rat26-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306544
2306709 BBDR.BBDP-(D4Mit6-D4Mit7)/3Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306709
2306710 F344-LmlnTn(sb-T2/Bart3)2.322Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LmlnTn(sb-T2/Bart3)2.322Mcwi 2306701 11 69481117 69547133 7 11 73980288 74048100 7 11 70895141 70963121 7 11 67656241 67725889 7 RRID:RRRC_00447
2306711 F344-FM117003Tn(sb-T2/Bart3)2.321McwiRrrc this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm FM117003Tn(sb-T2/Bart3)2.321Mcwi 2306703 RRID:RRRC_00475
2306712 BBDR.BBDP-(D4Mit6-D4Mit7)/2Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306712
2306717 BBDP/WorSunn These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada. Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada, Rat Resource and Research Center inbred Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) RRID:RRRC_00787
2306784 Kini:DA,PVG-G12 Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1a MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG/OlaHsd females founders generated F2. F3 generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2306784
2306815 SS.SR-(D7Rat67-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111506104 113014423 1 - by flanking markers 7 114961803 116100169 1 - by flanking markers 7 115041287 115041463 1 - by flanking markers 7 105699315 105699492 1 - by flanking markers RRID:RGD_2306815
2306816 SS.SR-(D7Mco19-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112800232 113014423 1 - by flanking markers 7 115828017 116100169 1 - by flanking markers 7 115922628 115922885 1 - by flanking markers 7 106571501 106571759 1 - by flanking markers RRID:RGD_2306816
2306817 SS.SR-(D7Uia1-D7Mco19)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 112800489 1 - by flanking markers 7 112367543 115828274 1 - by flanking markers 7 112429186 115922885 1 - by flanking markers 7 103146217 106571759 1 - by flanking markers RRID:RGD_2306817
2306818 SS.SR-(D7Rat131-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111882387 113014423 1 - by flanking markers 7 115334997 116100169 1 - by flanking markers 7 115421039 115421228 1 - by flanking markers 7 106074002 106074194 1 - by flanking markers RRID:RGD_2306818
2306819 SS.SR-(D7Uia1-D7Rat131)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 111882577 1 - by flanking markers 7 112367543 115335186 1 - by flanking markers 7 112429186 115421228 1 - by flanking markers 7 103146217 106074194 1 - by flanking markers RRID:RGD_2306819
2306820 SS.SR-(D3Arb14-D3Mco36)/Mco SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 171009566 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_2306820
2306823 SS.SR-(D3Arb14-D3Mco36)(D7Mco19-D7Mco7)/Mco SS.SR-(D3Arb14-D3Mco36)/Mco were crossed with SS.SR-(D7Mco19-D7Mco7)/Jr and then F1 rats were backcrossed with SS.SR-(D3Arb14-D3Mco36)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2306823
2306840 E3.DA-(D4Wox22-D4Got132)(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown RRID:RGD_2306840
2306841 E3.DA-(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23845554 23845733 1 - by flanking markers 12 17721341 27718984 1 - by flanking markers 12 15714609 25711626 1 - by flanking markers 12 13635523 22692658 1 - by flanking markers RRID:RGD_2306841
2306842 E3.DA-(D20Rat45-D20Rat47)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6;20 133455626;1616332 133455718;5447494 1 - by flanking markers;1 - by flanking markers 20 4059279 8810333 1 - by flanking markers 20 2018654 6567533 1 - by flanking markers 20 1527842 5304690 1 - by flanking markers RRID:RGD_2306842
2306874 F344-IntuTn(sb-T2/Bart3)2.324Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) IntuTn(sb-T2/Bart3)2.324Mcwi 2306873 2 127564813 127639564 7 2 147063971 147216092 7 2 127459089 127521327 7 2 123600972 123685331 7 RRID:RRRC_00441
2306875 F344-FaslgTn(sb-T2/Bart3)2.325Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. PhysGen mutant Extinct (as of 2017-01-26) FaslgTn(sb-T2/Bart3)2.325Mcwi 2306872 13 77472950 77480210 7 13 84590119 84605900 7 13 79696811 79717581 7 13 74151519 74172760 7 RRID:RGD_2306875
2306892 SHR.BN-(D2Rat114-D2Rat123)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 36432989 112326568 1 - by flanking markers 2 55361257 131889716 1 - by flanking markers 2 36245223 112175725 1 - by flanking markers 2 109366814 109366971 1 - by flanking markers RRID:RGD_2306892
2306893 SHR.BN-(D16Rat87-D16Mgh1)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 16 3464719 46137590 1 - by flanking markers 16 4082652 45651269 1 - by flanking markers 16 4136355 45905331 1 - by flanking markers 16 3380150 43025077 1 - by flanking markers RRID:RGD_2306893
2306894 SHR.BN-(D4Rat33-D4Rat54)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 4 80205349 121829076 1 - by flanking markers 4 146540904 184799673 1 - by flanking markers 4 81874073 119546974 1 - by flanking markers 4 81006124 120102625 1 - by flanking markers RRID:RGD_2306894
2306895 SHR.BN-(D2Rat226-D2Rat294)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 170338294 236153712 1 - by flanking markers 2 197020226 262435073 1 - by flanking markers 2 177680772 243901375 1 - by flanking markers 2 164073756 227146641 1 - by flanking markers RRID:RGD_2306895
2306961 RLA/Verh Roman low avoidance Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306961
2306962 RHA/Verh Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306962
2307077 HXB4/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307077
2307078 HXB27/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307078
2307079 HXB3/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307079
2307080 HXB20/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307080
2307081 HXB31/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307081
2307082 HXB18/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307082
2307083 HXB10/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307083
2307084 HXB24/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307084
2307085 HXB17/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307085
2307086 HXB7/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307086
2307087 SHR.BN-(D18Rat32-D18Rat12)/Ipcv A segment of chr 18 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307087
2307088 HXB22/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307088
2307089 HXB29/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307089
2307090 SHR.BN10/Ipcv A segment of chr 10 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307090
2307091 HXB13/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307091
2307092 HXB14/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307092
2307093 HXB23/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307093
2307094 HXB1/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307094
2307095 HXB15/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307095
2307096 HXB2/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307096
2307097 HXB21/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307097
2307098 HXB25/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307098
2307099 HXB5/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307099
2307115 BXH5/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307115
2307116 PXO3-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307116
2307117 PXO5-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307117
2307118 PXO9/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307118
2307119 PXO7-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307119
2307120 PXO7-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307120
2307121 BXH2/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307121
2307122 PXO8-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307122
2307123 BXH13/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307123
2307124 BXH10/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307124
2307125 PXO6-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307125
2307126 BXH8/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307126
2307127 BXH11/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307127
2307128 PXO5-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307128
2307129 BXH9/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307129
2307130 PXO6-3/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307130
2307131 PXO8-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307131
2307132 PXO10/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307132
2307134 BXH3/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307134
2307135 PXO4/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307135
2307136 BXH6/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307136
2307137 PXO6-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307137
2307138 PXO1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307138
2307139 BXH12/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307139
2307155 SHR/1NCrl To Charles River from NIH in 1973 at F32. MRC Clinical Sciences Centre, College School of Medicine, London, UK inbred Unknown RRID:RGD_2307155
2307156 DA/ZtmKini Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307156
2307157 PVG.1AV1/Kini Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307157
2307159 SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307159
2307160 SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307160
2307161 SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307161
2307166 SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307166
2307167 SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307167
2307168 SHRSR/Bbb Spontaneously Hypertensive Rat, Stroke Resistant This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2307168
2307169 SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307169
2307298 BN/HanKini Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307298
2307299 ACI/ZtmKini substrain of ACI derived from ACI/Ztm Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307299
2307300 LEW.1AV1/Kini Substrain of LEW.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307300
2307301 DA.LEW.RT1f-(D20Wox15-D20Wox13)/Rhd RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden congenic Unknown 20 2790524 6695696 1 - by flanking markers 20 5249993 10234922 1 - by flanking markers 20 3151827 8034632 1 - by flanking markers 20 2646407 6515143 1 - by flanking markers RRID:RGD_2307301
2307317 MHS Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy outbred Unknown RRID:RGD_2307317
2307318 BDIX/Ifz derived from Berlin-Druckrey strain BDIX Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_2307318
2307319 MNS/N Milan normotensive strain Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00171
2307355 PXO3-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307355
2307356 PXO2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307356
2307357 BDV/Ztm Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_2307357
2307358 LUDW/OlaHsd Ludwig Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979. Envigo inbred Cryorecovery RRID:RGD_2307358
2307359 BUF/SimRijHsd Developed by Heston in 1946 from a Buffalo Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_2307359
2307360 DA.BI.RT1i-(D20Rat42-D20Rat31)/Rhd RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 10410227 1 - by flanking markers 20 6265460 12972703 1 - by flanking markers 20 4186104 10800530 1 - by flanking markers 20 4459698 10078919 1 - by flanking markers RRID:RGD_2307360
2307441 F344-Cyyr1Tn(sb-T2/Bart3)2.328Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyyr1Tn(sb-T2/Bart3)2.328Mcwi 2307440 11 25036792 25157304 7 11 28591553 28702298 7 11 24967936 25078740 7 11 24557620 24664007 7 RRID:RRRC_00452
2307442 F344-Robo1Tn(sb-T2/Bart3)2.327Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Robo1Tn(sb-T2/Bart3)2.327Mcwi 2307439 11 10784947 11720646 7 11 13314508 13808775 7 11 9079291 10146302 7 11 10580863 11621675 7 RRID:RRRC_00451
2308816 Crl:WI(Han) Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system. Charles River Laboratories outbred Unknown RRID:RGD_2308816
2308851 Crl:OP(CD) Obese Prone Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD). Charles River Laboratories outbred Unknown RRID:RGD_2308851
2308852 Crl:LE Long-Evans Rats Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978. Charles River Laboratories outbred Unknown RRID:RGD_2308852
2308853 Crl:OR(CD) Obese Resistant Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets. Charles River Laboratories outbred Unknown RRID:RGD_2308853
2308885 GK/CskCrljCrl The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006. Charles River Laboratories inbred Unknown RRID:RGD_2308885
2308886 SS/HsdMcwiCrl Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001. Charles River Laboratories inbred Unknown RRID:RGD_2308886
2311049 SHROB/KolGmiCrl-Leprcp/Crl This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. Charles River Laboratories coisogenic Unknown Leprcp 11570565 RRID:RGD_2311049
2311051 SHRSP/A3NCrl Stroke Prone Rats The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. Charles River Laboratories inbred Unknown RRID:RGD_2311051
2311070 BUF/CrCrl Buffalo Rat Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown RRID:RGD_2311070
2311071 ZDF-Leprfa/Crl A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. Charles River Laboratories coisogenic Unknown Lepr 3001 RRID:RGD_2311071
2311072 FHH/EurMcwiCrl An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001. Charles River Laboratories inbred Unknown RRID:RGD_2311072
2311073 NBL/CrCrl Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998. Charles River Laboratories inbred Unknown RRID:RGD_2311073
2311074 BDIX/CrCrl Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown RRID:RGD_2311074
2311078 Crl:CD-Hrhr CD hairless rats This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic. Charles River Laboratories outbred Unknown RRID:RGD_2311078
2311079 WF/CrCrl J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown RRID:RGD_2311079
2311082 SS-Chr 13BN/McwiCrl Developed at the Medical College of Wisconsin. To Charles River in 2003. Charles River Laboratories consomic Unknown RRID:RGD_2311082
2311692 F344-Myo1dTn(sb-T2/Bart3)2.334Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo1dTn(sb-T2/Bart3)2.334Mcwi 2311691 10 68720729 68997721 7 10 67520649 67811744 7 10 67866939 68142864 7 10 65489153 65765812 7 RRID:RRRC_00478
2311693 F344-Tmem22Tn(sb-T2/Bart3)2.332Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Tmem22Tn(sb-T2/Bart3)2.332Mcwi 2311689 8 105416072 105443969 7 8 108269643 108297339 7 8 108854134 108881519 7 8 101085579 101113339 7 RRID:RGD_2311693
2311694 F344-Fam227aTn(sb-T2/Bart3)2.333Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam227aTn(sb-T2/Bart3)2.333Mcwi 2311687 7 117441099 117469873 7 7 120839737 120881869 7 7 120846166 120891738 7 7 111174362 111216513 7 RRID:RRRC_00484
2312352 LEW.1N These congenic rats carry the RTln haplotype on the LEW strain genetic background. Zentralinstitut fur Versuchstierzucht, Hannover, Germany congenic Unknown RRID:RGD_2312352
2312447 SD-Tg(Pmp22)Kan This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library Max Planck Institute for Experimental Medicine, Gottingen, Germany transgenic Unknown Pmp22 11125 RRID:RGD_2312447
2312466 Crl:LIS Lister Hooded Rat These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance. Charles River Laboratories outbred Unknown RRID:RGD_2312466
2312471 Crl:ZUC(Orl)-Leprfa The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991. Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312471
2312472 Crl:WI(WU) Wistar Wu Rat Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987. Charles River Laboratories outbred Unknown RRID:RGD_2312472
2312473 BDIX/OrlCrl BDIX Rats Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991. Charles River Laboratories inbred Unknown RRID:RGD_2312473
2312474 Crl:OFA(SD) The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968. Charles River Laboratories outbred Unknown RRID:RGD_2312474
2312498 WAG/RijCrl WAG Rats A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993. Charles River Laboratories inbred Unknown RRID:RGD_2312498
2312499 Crl:NIH-Foxn1rnu Nude Rats The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs. Charles River Laboratories outbred Unknown RRID:RGD_2312499
2312504 Crlj:WI Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981) Charles River Laboratories outbred Unknown RRID:RGD_2312504
2312511 WF/IcoCrl Wistar Rats Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970. Charles River Laboratories inbred Unknown RRID:RGD_2312511
2312512 ZSF1-Leprfa, Leprcp/Crl This hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. Charles River Laboratories hybrid Unknown RRID:RGD_2312512
2312513 Crlj:DON Dr. Sato(1952) to Nippon Rat to CRLJ(1990) Charles River Laboratories outbred Unknown RRID:RGD_2312513
2312514 Crlj:LEC Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991). Charles River Laboratories outbred Unknown RRID:RGD_2312514
2312518 Crlj:ZUC-Leprfa Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000) Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312518
2312577 SHR.BN-(D18Rat99-D18Rat82)/Ipcv F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 31654683 73666623 1 - by flanking markers 18 32165265 72695235 1 - by flanking markers 18 32487692 73016546 1 - by flanking markers 18 30558524 70263868 1 - by flanking markers RRID:RGD_2312577
2312578 SHR.BN-(D18Rat82)/Ipcv F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 73016379 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312578
2312579 SHR.BN-(D18Rat40-D18Rat82)/Ipcv F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 62106066 73666623 1 - by flanking markers 18 60695794 72695235 1 - by flanking markers 18 61499531 73016546 1 - by flanking markers 18 59330409 70263868 1 - by flanking markers RRID:RGD_2312579
2312580 SHR.BN-(D18Rat113-D18Rat82)/Ipcv SHR/OlaIpcv were crossed with BN/Crl, F1 animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 3719547 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312580
2312609 MWF-Chr 8SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2312609
2312644 DA.WOKW-(D3Mit10-D3Rat189)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 35797577 35797756 1 - by flanking markers 3 44863125 44863303 1 - by flanking markers 3 39773247 39773425 1 - by flanking markers 3 38710365 38710544 1 - by flanking markers RRID:RGD_2312644
2312645 DA.WOKW-(D16Rat88-D16Wox7)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 16 819225 63306215 1 - by flanking markers 16 1534408 62873174 1 - by flanking markers 16 1550187 63210301 1 - by flanking markers 16 832236 59492508 1 - by flanking markers RRID:RGD_2312645
2312646 DA.WOKW-(D5Mgh6-D5Mit5)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 5 71814715 109163425 1 - by flanking markers 5 75334610 112058005 1 - by flanking markers 5 71154828 108092802 1 - by flanking markers 5 68984307 104251008 1 - by flanking markers RRID:RGD_2312646
2312647 DA.WOKW-(D3Mgh5-D3Rat1)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 97523869 170016653 1 - by flanking markers 3 109733850 180128021 1 - by flanking markers 3 103141814 176418101 1 - by flanking markers 3 98535255 168026850 1 - by flanking markers RRID:RGD_2312647
2312648 DA.WOKW-(D10Mgh2-D10Rat4)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 10 106422174 107033716 1 - by flanking markers 10 105533457 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2312648
2312733 BN-Chr 13SS Chr 18SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed PhysGen consomic Cryopreserved Sperm RRID:RGD_2312733
2313181 LEW.1WR1/WorBrm Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc. Biomedical Research Models, Inc. congenic Unknown RRID:RGD_2313181
2313209 WF.ART2/Wor developed at the Universtiy of Massachusetts, Medical School Universtiy of Massachusetts, Worcester, MA congenic Unknown RRID:RGD_2313209
2313221 SHHF-Leprcp/Crl Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. Charles River Laboratories congenic Unknown Leprcp 11570565 RRID:RGD_2313221
2313222 BN/HsdMcwiCrl BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River Charles River Laboratories inbred Unknown RRID:RGD_2313222
2313231 LEWBNF1/Crl This hybrid rat is a cross between a LEW female and a BN male rat. Charles River Laboratories hybrid Unknown RRID:RGD_2313231
2313232 WFF344F1/Crl This hybrid rat is a cross between a WF female and a F344 male rat. Charles River Laboratories hybrid Unknown RRID:RGD_2313232
2313342 BN-Chr 17LH/Mav Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313342
2313343 LH-Chr 13BN/Mav Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313343
2313384 Wild/Nov These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia wild Unknown RRID:RGD_2313384
2313463 F344-Ppfia2Tn(sb-T2/Bart3)2.339Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppfia2Tn(sb-T2/Bart3)2.339Mcwi 2313459 7 45140154 45616620 7 7 48563521 49058116 7 7 48548932 49045852 7 7 41765716 42240104 7 RRID:RRRC_00474
2313464 F344-LargeTn(sb-T2/Bart3)2.336Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) LargeTn(sb-T2/Bart3)2.336Mcwi 2313460 19 12043818 12497663 7 19 23595328 24054765 7 19 12481563 12945320 7 19 11603129 12048930 7 RRID:RGD_2313464
2313465 F344-Pld5Tn(sb-T2/Bart3)2.340Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pld5Tn(sb-T2/Bart3)2.340Mcwi 2313462 13 91715000 92058036 7 13 98486317 98812030 7 13 94025696 94355219 7 13 87895694 88232868 7 RRID:RRRC_00483
2313466 F344-Agbl4Tn(sb-T2/Bart3)2.337Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Agbl4Tn(sb-T2/Bart3)2.337Mcwi 2313461 5 134582789 135484937 7 5 130742297 131656581 7 5 125254963 126534367 7 RRID:RRRC_00473
2313588 SD-Tg(Ins2-IAPP)Soel Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter Pfizer, Inc, Groton, Connecticut transgenic Unknown RRID:RGD_2313588
2313693 SHR-Tg(PEPCK-SREBF1)2Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2313693
2313734 SD-Tg(H1/tetO-RNAi:Insr)29Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313734
2313735 SD-Tg(H1/tetO-RNAi:Insr)14Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313735
2313922 F344-Tg(Cyp1a1-Ren2)10.LEW-(D10Rat142-D10Rat15)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome. Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 92448353 96667338 1 - by flanking markers 10 91113514 95243104 1 - by flanking markers 10 91345679 95508221 1 - by flanking markers 10 88207600 92238497 1 - by flanking markers RRID:RGD_2313922
2313923 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(D10Rat99-D10Rat11)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome. Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 89278229 100633982 1 - by flanking markers 10 88043769 99184250 1 - by flanking markers 10 88250522 99492409 1 - by flanking markers 10 85269536 96121100 1 - by flanking markers RRID:RGD_2313923
2313924 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK consomic Unknown RRID:RGD_2313924
2314001 N:HS Heterogeneous stock Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown RRID:RGD_2314001
2314009 NMcwi:HS Heterogeneous stock 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc. Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin outbred Unknown RRID:RGD_2314009
2314027 SDT.Cg-Leprfa/Jtt SDT fatty Leprfa allele from ZDF was introgressed into SDT rats using the speed congenic method Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan congenic Unknown RRID:RGD_2314027
2314161 F344-Kuru1/Kyo Kuru1 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314161
2314162 F344-Oune/Kyo Oune A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Tbx6 1307716 RRID:RGD_2314162
2314163 F344-Kcna1Adms/Kyo ADMS (autosomal dominant myokymia and seizures) rat This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Kcna1Adms 12880383 4 163011777 163013522 7 4 226188851 226190596 7 4 159190781 159192526 7 4 159464223 159472905 7 RRID:RGD_2314163
2314164 F344-Kuru2/Kyo Kuru2 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314164
2314165 ACI-Chib/Kyo Chibi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology RRID:RGD_2314165
2314166 F344-Tbr2/Kyo Tsubura2 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314166
2314167 F344-Kmch/Kyo Komachi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm RRID:RGD_2314167
2314168 F344-Tbr1/Kyo Tsubura1 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314168
2314169 WTC.F344-Scn1am1Kyo/Kyo This congenic strain was established by backcrossing F344-Scn1am1Kyo onto WTC/Kyo. National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Sperm Scn1am1Kyo 12792283 RRID:RGD_2314169
2314170 F344-Egrm1Kyo EGR (Excessive Grooming Rat), Kaikai, Kyo1897 This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314170
2314224 F344.OLETF-(D1Rat166-D1Rat90)/2Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_2314224
2314225 F344-Chr 15OLETF/Tj Developed by the depositor National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2314225
2314226 WI-Tg(WSCD2)3Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314226
2314227 WI-Tg(WSCD2)4Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314227
2314228 WI-Tg(WSCD2)5Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314228
2314229 F344.OLETF-(D7Uwm22-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 123733466 123733601 1 - by flanking markers 7 126334525 126334660 1 - by flanking markers 7 126622888 126623023 1 - by flanking markers 7 116836447 116836583 1 - by flanking markers RRID:RGD_2314229
2314230 F344-Hrkrh/Kyo Hairless Kyoto, Hanako A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology; Urology RRID:RGD_2314230
2314231 F344.OLETF-(D5Mgh5-D5Mgh23)/2Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_2314231
2314232 WI-Tg(WSCD2)1Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314232
2314243 SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1 22842898 220639653 1 - by flanking markers 1 24875821 244066407 1 - by flanking markers 1 23406428 236763528 1 - by flanking markers 1 22340647 214537671 1 - by flanking markers RRID:RGD_2314243
2314244 BCR/Nn In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology RRID:RGD_2314244
2314245 WI-Tg(WSCD2)6Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314245
2314246 SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo Developed by the Depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 219629755 267111153 1 - by flanking markers 1 240604381 289137268 1 - by flanking markers 1 233490105 281795785 1 - by flanking markers 1 213533809 259647894 1 - by flanking markers RRID:RGD_2314246
2314247 WI-Tg(Prl-EGFP)Yamp A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Metabolism; Development RRID:RGD_2314247
2314313 NER.F344-(D5Rat100-D5Rat234)/Kyo The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 5 68843563 68843964 1 - by flanking markers 5 70180341 70180484 1 - by flanking markers 5 65696672 65696815 1 - by flanking markers 5 66174080 66174226 1 - by flanking markers RRID:RGD_2314313
2314314 NER.F344-(D1Mgh6-D1Rat132)/Kyo The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 1 87656636 165996388 1 - by flanking markers 1 92524380 179788206 1 - by flanking markers 1 91394009 172789257 1 - by flanking markers 1 87790149 162457491 1 - by flanking markers RRID:RGD_2314314
2314315 F344.NER-(D5Mgh4-D5Rat36)/Kyo The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 5 145186817 145187034 1 - by flanking markers 5 147610023 147610238 1 - by flanking markers 5 143846157 143846372 1 - by flanking markers 5 138113556 138113774 1 - by flanking markers RRID:RGD_2314315
2314316 F344.NER-(D1Mgh6-D1Rat73)/Kyo The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 87656636 224420760 1 - by flanking markers 1 92524380 246113473 1 - by flanking markers 1 91394009 238824901 1 - by flanking markers 1 87790149 218748178 1 - by flanking markers RRID:RGD_2314316
2314317 WTC.GRY-Cacna1agry/Kyo Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-04) Neurobiology Cacna1a|Cacna1agry 2244|12880382 RRID:RGD_2314317
2314339 F344-PatjTn(sb-T2/Bart3)2.343Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PatjTn(sb-T2/Bart3)2.343Mcwi 2314335 5 118806744 119131114 7 5 120981525 121281044 7 5 117038548 117340308 7 5 113061985 113364807 7 RRID:RRRC_00480
2314340 F344-AcoxlTn(sb-T2/Bart3)2.342Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene. PhysGen mutant Extinct (as of 2016-10-24) AcoxlTn(sb-T2/Bart3)2.342Mcwi 2314337 3 115365279 115687566 7 3 126606586 126919666 7 3 120414311 120724809 7 3 115061069 115367032 7 RRID:RGD_2314340
2314341 F344-Auts2Tn(sb-T2/Bart3)2.344Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. PhysGen mutant Extinct (as of 2016-10-24) Auts2Tn(sb-T2/Bart3)2.344Mcwi 2314338 12 25518248 25541023 7 12 24104187 25194123 7 RRID:RGD_2314341
2314342 F344-PalldTn(sb-T2/Bart3)2.341Mcwi These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene. PhysGen mutant Extinct (as of 2017-01-26) PalldTn(sb-T2/Bart3)2.341Mcwi 2314336 16 31144028 31144544 7 16 31198863 31240064 7 16 31349140 31390340 7 16 27981315 28143129 7 RRID:RGD_2314342
2314360 ACI.F344-(D16Mit5-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314360
2314361 W-Tg(Slc32a1-YFP*)1Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314361
2314362 F344-Hrdk/Kyo Hairless dominant Kyoto Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314362
2314363 W-Tg(Slc32a1-YFP*)2Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314363
2314364 ACI.F344-(D16Nkg112-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314364
2314365 KFRS2/Kyo A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology Tyr|TyrsiaKyo 1589755|13207345 1 143641257 143746315 7 1 157322968 157416594 7 1 151012598 151106802 7 1 141115036 141210207 7 RRID:RGD_2314365
2314368 F344-Trdk/Kyo Tremor dominant Kyoto Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2,. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-15) Neurobiology Kcnn2Trdk 149735330 18 39560962 39705037 7 18 38822146 38864110 7 18 39331894 39479574 7 18 37817966 38258347 7 RRID:RGD_2314368
2314375 LE.AR-Ednrbsl/Okkm AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-28) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314375
2314376 KFRS4/Kyo A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo (as of 2021-10-05) Ophthalmology; Dermatology RRID:RGD_2314376
2314377 KFRS3B/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314377
2314378 AR-Ednrbsl/Okkm Aganglionosis rat Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-31) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314378
2314379 KFRS6/Kyo A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant Live Animals Dermatology RRID:RGD_2314379
2314380 SD-Tg(CAG-lacZ)541Htsu Developed by the depositor National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_2314380
2314381 KFRS5A/Kyo A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology Krt71Rex 11570416 7 141143396 141166531 7 7 143345201 143371346 7 7 132873532 132898975 7 RRID:RGD_2314381
2314382 SD-Tg(CAG-HRAS*G12V)250Htsu This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Cancer HRAS 730881 RRID:RGD_2314382
2314383 KFRS3A/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314383
2314396 LCR/Mco Low-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314396
2314397 HCR/Mco High-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314397
2314414 LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314414
2314415 LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314415
2314477 LEW-RT1DA/Rrrc Sprague-Dawley RT1u haplotype backcrossed onto Lewis inbred strain. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00391
2314478 LEW-RT1.Bm1Trg/Rrrc RT1.B ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00392
2314492 SBN.SBH-(D1Rat148-D1Rat89)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 16325337 265343617 1 - by flanking markers 1 18951160 287349830 1 - by flanking markers 1 16470664 279986079 1 - by flanking markers 1 15760582 257976495 1 - by flanking markers RRID:RGD_2314492
2314493 SBH.SBN-(D1Mgh2-D1Rat74)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 227005733 1 - by flanking markers 1 24875821 248763894 1 - by flanking markers 1 23406428 241482368 1 - by flanking markers 1 22340647 221264292 1 - by flanking markers RRID:RGD_2314493
2314494 SBH.SBN-(D1Rat137-D1Rat123)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 223729371 1 - by flanking markers 1 95325941 245519018 1 - by flanking markers 1 94225372 238220385 1 - by flanking markers 1 90532338 218108781 1 - by flanking markers RRID:RGD_2314494
2314495 SBN.SBH-(D1Rat27-D1Mit7)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90282040 240980321 1 - by flanking markers 1 95301716 262617374 1 - by flanking markers 1 94201400 94201552 1 - by flanking markers 1 90508614 90508767 1 - by flanking markers RRID:RGD_2314495
2314496 SBH.SBN-(D1Mgh2-D1Mgh11)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 22843363 1 - by flanking markers 1 24875821 24875970 1 - by flanking markers 1 23406428 23406577 1 - by flanking markers 1 22340647 22340797 1 - by flanking markers RRID:RGD_2314496
2314497 SBN.SBH-(D1Rat101-D1Rat74)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 97174943 227005733 1 - by flanking markers 1 103735751 248763894 1 - by flanking markers 1 102658741 241482368 1 - by flanking markers 1 97146283 221264292 1 - by flanking markers RRID:RGD_2314497
2314498 SBH.SBN-(D1Rat137-D1Rat83)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 252133935 1 - by flanking markers 1 95325941 274017147 1 - by flanking markers 1 94225372 266587220 1 - by flanking markers 1 90532338 245701099 1 - by flanking markers RRID:RGD_2314498
2314499 SBN.SBH-(D1Mgh17-D1Mgh14)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 9082836 263699089 1 - by flanking markers 1 10007292 285604895 1 - by flanking markers 1 8387052 278228889 1 - by flanking markers 1 8606496 256448636 1 - by flanking markers RRID:RGD_2314499
2314500 SBH.SBN-(D1Mgh2-D1Rat101)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 97175101 1 - by flanking markers 1 24875821 103735908 1 - by flanking markers 1 23406428 102658898 1 - by flanking markers 1 22340647 97146439 1 - by flanking markers RRID:RGD_2314500
2314501 SBH.SBN-(D1Wox11-D1Rat137)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 64145811 90306478 1 - by flanking markers 1 63399232 95326185 1 - by flanking markers 1 64407177 94225616 1 - by flanking markers 1 65832929 90532583 1 - by flanking markers RRID:RGD_2314501
2314530 SS.SHR-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their female F1 were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314530
2314531 SHR.SS-(D13Rat1-D13Mgh6)/Mco SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 13 10555730 101704301 1 - by flanking markers 13 29679984 108279142 1 - by flanking markers 13 24501968 103613733 1 - by flanking markers 13 20605555 97213863 1 - by flanking markers RRID:RGD_2314531
2314532 SHR.SS-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314532
2314655 BRAT-Avpdi/BluHsd Brattleboro Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avpdi 13627261 3 118205007 118206985 7 3 129615610 129627147 7 3 123117482 123119460 7 3 117793447 117805091 7 RRID:RGD_2314655
2314861 WAG/RijYcb Substrain of WAG/Rij; from Netherlands to Yale University. Comparative Medicine, Yale University, Connecticut inbred Unknown RRID:RGD_2314861
2314904 WAG-F8m1Ycb This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. Comparative Medicine, Yale University, Connecticut mutant Unknown F8m1Ycb 2314903 18 121134 162008 7 18 413447 444491 7 18 394478 394478 8 18 145719 145719 8 RRID:RGD_2314904
2314928 Slc:W Slc: Wistar Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain. SLC, Japan outbred Unknown RRID:RGD_2314928
2314934 WST.F344-Ker/Kyo Wistar/ST-Boo This congenic strain was established by backcrossing F344-Ker/Kyo (NBRP No.0458) onto Slc:WST National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314934
2314935 WST.F344-Kmch/Kyo Wistar/ST-Komachi This congenic strain was established by backcrossing F344-Kmch/Kyo (NBRP No.0458) onto Slc:WST. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314935
2314936 WI-Tg(WSCD2)Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-24) RRID:RGD_2314936
2314937 F344.OLETF-(D5Mgh20-D5Mgh22)/Tj Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 140925168 157584492 1 - by flanking markers 5 143051962 160953783 1 - by flanking markers 5 139267814 157212422 1 - by flanking markers 5 133916727 151006154 1 - by flanking markers RRID:RGD_2314937
2316631 F344.GK-(D1Swe8-D1Gpam-1)/Swe This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown Adra2a|Pdcd4|Shoc2 2056|620816|1308146 1 259866528 259866737 1 - by flanking markers 1 281763458 281763667 1 - by flanking markers 1 274353782 274353991 1 - by flanking markers 1 252645447 252645657 1 - by flanking markers RRID:RGD_2316631
2316632 NEDH/KSim New England Deaconess Hospital Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman Simonsen Laboratories inbred Unknown RRID:RGD_2316632
2316633 F344.GK-(D1Got251-D1Gpam-1)/Swe This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 260641680 260641846 1 - by flanking markers 1 282550224 282550389 1 - by flanking markers 1 275138749 275138914 1 - by flanking markers 1 253439653 253439819 1 - by flanking markers RRID:RGD_2316633
2316653 SS.LEW-(D1Mco102-D1Got46)/Mco A sub-congenic strain derived from SS.LEW-(D1Uia8-D1Rat18)/Mco contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 38394289;2374083 38394434;2374266 1 - by flanking markers;1 - by flanking markers 1 36290530 45656739 1 - by flanking markers 1 34888392 44326906 1 - by flanking markers 1 32249735 44011366 1 - by flanking markers RRID:RGD_2316653
2316654 SS.LEW-(D1Mco102-D1Mco129)/1Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316654
2316655 SS.LEW-(D1Mco102-D1Mco129)/2Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316655
2316925 SHR.BN-(D3Rat159-D3Rat1)/Mco 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 119437175 170016653 1 - by flanking markers 3 130776038 180128021 1 - by flanking markers 3 124284647 176418101 1 - by flanking markers 3 118950053 168026850 1 - by flanking markers RRID:RGD_2316925
2316927 SHR.BN-(D6Rat40-D6Rat170)/Mco 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 6 1301952 46792623 1 - by flanking markers 6 1111498 56881356 1 - by flanking markers 6 1120393 48179481 1 - by flanking markers 6 16536243 45547114 1 - by flanking markers RRID:RGD_2316927
2316928 SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2316928
2317196 DA.PVG.1AV1-(D8Rat146-D8Got145) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 73105403 91329867 1 - by flanking markers 8 76885501 93261060 1 - by flanking markers 8 74920991 93746162 1 - by flanking markers 8 69352596 87043114 1 - by flanking markers RRID:RGD_2317196
2317197 DA.PVG.1AV1-(D8Rat41-D8Rat24) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 50354908 82247243 1 - by flanking markers 8 50240107 84140836 1 - by flanking markers 8 51633707 84569318 1 - by flanking markers 8 47627235 78138314 1 - by flanking markers RRID:RGD_2317197
2317201 DA.PVG.1AV1-(D8Rat24-D8Got145) DA.PVG.1AV1-(D8Rat146-D8Got145) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 82246890 91329867 1 - by flanking markers 8 84140683 93261060 1 - by flanking markers 8 84569165 93746162 1 - by flanking markers 8 78138158 87043114 1 - by flanking markers RRID:RGD_2317201
2317278 Taiep/Dun These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin mutant Unknown RRID:RGD_2317278
2317590 DA.PVG.1AV1-(D4Rat23-D4Rat108)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 82090355 1 - by flanking markers 4 58518376 148552304 1 - by flanking markers 4 83889402 83889539 1 - by flanking markers 4 82844048 82844186 1 - by flanking markers RRID:RGD_2317590
2317595 DA.PVG.1AV1-(D4Rat23-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 104416171 1 - by flanking markers 4 58518376 163844298 1 - by flanking markers 4 99066972 99067150 1 - by flanking markers 4 103194805 103194984 1 - by flanking markers RRID:RGD_2317595
2317596 DA.PVG.1AV1-(D4Rat103-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 82700691 104416171 1 - by flanking markers 4 149135946 163844298 1 - by flanking markers 4 84475257 99067150 1 - by flanking markers 4 83428419 103194984 1 - by flanking markers RRID:RGD_2317596
2317598 DA.PVG.1AV1-(D4Rat231-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 88462327 104416171 1 - by flanking markers 4 154593964 163844298 1 - by flanking markers 4 89777552 99067150 1 - by flanking markers 4 88656681 103194984 1 - by flanking markers RRID:RGD_2317598
2317599 DA.PVG.1AV1-(D4Got211-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 79604076 104416171 1 - by flanking markers 4 145804154 163844298 1 - by flanking markers 4 81136696 99067150 1 - by flanking markers 4 80445377 103194984 1 - by flanking markers RRID:RGD_2317599
2317791 DA.PVG.1AV1-(D4Got60-D4Kini1)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 80704779 81729771 1 - by flanking markers 4 147125280 148194009 1 - by flanking markers 4 83531021 83531176 1 - by flanking markers 4 82490359 82490515 1 - by flanking markers RRID:RGD_2317791
2317812 AT.ANT-(D1Uia12-D1Rat288)/Rar F2 males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested University of Colorado Denver, Colorado, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 1 134007903 192038535 1 - by flanking markers 1 140949643 211567839 1 - by flanking markers 1 139972085 139972231 1 - by flanking markers 1 132214399 132214546 1 - by flanking markers RRID:RRRC_00728
2317813 AT.ANT-(D1Rat234-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 158511230 1 - by flanking markers 1 172296302 172296459 1 - by flanking markers 1 166100317 166100474 1 - by flanking markers 1 155422851 155423009 1 - by flanking markers RRID:RGD_2317813
2317814 AT.ANT-(D1Rat273-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 140644473 153578547 1 - by flanking markers 1 147436666 167535765 1 - by flanking markers 1 146507930 161321256 1 - by flanking markers 1 138344856 150700247 1 - by flanking markers RRID:RGD_2317814
2317815 AT.ANT-(D1Rat35-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 158511230 1 - by flanking markers 1 131958920 172296459 1 - by flanking markers 1 130917121 166100474 1 - by flanking markers 1 123479780 155423009 1 - by flanking markers RRID:RGD_2317815
2317816 AT.ANT-(D1Rat234-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 153578547 1 - by flanking markers 1 167535661 167535765 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317816
2317817 AT.ANT-(D1Rat183-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 131123181 192038535 1 - by flanking markers 1 138077032 211567839 1 - by flanking markers 1 137083889 137084126 1 - by flanking markers 1 129384185 129384427 1 - by flanking markers RRID:RGD_2317817
2317818 AT.ANT-(D1Rat273-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 140644473 192038535 1 - by flanking markers 1 147436666 211567839 1 - by flanking markers 1 146507930 146508090 1 - by flanking markers 1 138344856 138345017 1 - by flanking markers RRID:RGD_2317818
2317819 AT.ANT-(D1Rat35-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 192038535 1 - by flanking markers 1 131958920 211567839 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317819
2317820 AT.ANT-(D1Rat158-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 153578442 192038535 1 - by flanking markers 1 167535661 211567839 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317820
2317822 AT.ANT-(D1Rat35-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 133567105 1 - by flanking markers 1 131958920 140507239 1 - by flanking markers 1 130917121 139524104 1 - by flanking markers 1 123479780 131763614 1 - by flanking markers RRID:RGD_2317822
2317825 AT.ANT-(D1Rat234-D1Rat35)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 124749065 1 - by flanking markers 1 131958920 131959064 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317825
2317827 AT.ANT-(D1Rat234-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 133567105 1 - by flanking markers 1 140507063 140507239 1 - by flanking markers 1 139523928 139524104 1 - by flanking markers 1 131763437 131763614 1 - by flanking markers RRID:RGD_2317827
2317891 SHR-Chr 6MWF/Rkb SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2317891
2324631 DA.E3-(D4Wox49-D4Got136)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden. congenic Unknown Clec4a3 1359528 4 159060677 160528447 1 - by flanking markers 4 222438489 223964695 1 - by flanking markers 4 155414290 156945571 1 - by flanking markers 4 155828194 157232313 1 - by flanking markers RRID:RGD_2324631
2325143 SHR/NHsdMco Spontaneously Hypertensive Rat SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325143
2325145 LEW/CrlMco Lewis These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325145
2325146 MNS/NMco Milan normotensive strain These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325146
2325202 SS/JrSeac Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension RRID:RGD_2325202
2325206 LEW/Seac Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan Seac Yoshitomi, LTD Japan inbred Unknown RRID:RGD_2325206
2325209 SHRSP/Hos Substrain of SHRSP purchased from Sankyo Lab Service, Japan. Sankyo Lab Service, Japan. inbred Unknown RRID:RGD_2325209
2325724 PVG.LEW-(D1Rat270-D1Rat68)/Kini 63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 130290073 193070197 1 - by flanking markers 1 136616460 212591221 1 - by flanking markers 1 135611773 205603226 1 - by flanking markers 1 128593600 188377506 1 - by flanking markers RRID:RGD_2325724
2325754 SD-Pax6Sey/Mce Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. Department of Ophthalmology, Okayama University Medical School, Okayama, Japan mutant Unknown Pax6|Pax6Sey 3258|737688 3 91127605 91149178 7 3 102320059 102348223 7 3 95724051 95724052 8 3 92152512 92152513 8 RRID:RGD_2325754
2325773 WKY.LEW-(D13Arb15-D13Rat58)/Tja Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 13 68269576 92436175 1 - by flanking markers RRID:RGD_2325773
2325774 WKY.LEW-(D13Arb10-D13Arb15)(D16Rat88-D16Rat40)/Tja WKY.LEW-(D13Arb10-D13Arb15) were crossed with WKY.LEW-(D16Rat88-D16Rat40), the F1 were backcrossed to WKY.LEW-(D13Arb10-D13Arb15) and then the offsprings were intercrossed Imperial College, London, UK, Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00707
2325796 SS.LEW-(D3Rat52-D3Chm57)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat130)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 24716931 1 - by flanking markers 3 19410399 34290625 1 - by flanking markers 3 14090411 29084626 1 - by flanking markers 3 18311454 28441896 1 - by flanking markers RRID:RGD_2325796
2325798 SS.LEW-(D10Got112-Igfbp4)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79857808 87834315 1 - by flanking markers 10 78816241 86759484 1 - by flanking markers 10 78970279 86962563 1 - by flanking markers 10 76246085 84007272 1 - by flanking markers RRID:RGD_2325798
2325801 SS.LEW-(D16Chm36-D16Mit2)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 890512 4304517 1 - by flanking markers 16 1604056 5038806 1 - by flanking markers 16 1619835 5098704 1 - by flanking markers 16 903314 4227730 1 - by flanking markers RRID:RGD_2325801
2325803 SS.LEW-(D16Rat112-D16Chm60)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 3165043 1 - by flanking markers 16 773329 3491557 1 - by flanking markers 16 778415 3525217 1 - by flanking markers 16 110590 3080679 1 - by flanking markers RRID:RGD_2325803
4107048 SS.SR-(D7Rat16-D7Rat189)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 120385575 1 - by flanking markers 7 112143411 123228091 1 - by flanking markers 7 112204378 123243402 1 - by flanking markers 7 102920123 113526566 1 - by flanking markers RRID:RGD_4107048
4107052 SS.SR-(D7Rat16-D7Mgh5)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 115820414 1 - by flanking markers 7 112143411 119125830 1 - by flanking markers 7 112204378 119131068 1 - by flanking markers 7 102920123 109483487 1 - by flanking markers RRID:RGD_4107052
4107055 SS.SR-(D7Rat16-D7Rat176)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 111200952 1 - by flanking markers 7 112143411 114641749 1 - by flanking markers 7 112204378 114708307 1 - by flanking markers 7 102920123 105399458 1 - by flanking markers RRID:RGD_4107055
4107057 SS.SR-(D7Mco7-D7Rat81)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112979256 129500555 1 - by flanking markers 7 116059683 131926277 1 - by flanking markers 7 132252091 132252361 1 - by flanking markers 7 122220558 122220831 1 - by flanking markers RRID:RGD_4107057
4107063 SS.LEW-(D1Uia8-D1Rat124)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_4107063
4107065 SS.LEW-(D1Uia8-D1Rat213)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 81548753 81548909 1 - by flanking markers 1 84537073 84537228 1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_4107065
4139872 SS-Nckap5em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em2Mcwi 4139862 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139872
4139873 SS-Rag1em2Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em2Mcwi 4139866 3 86780782 86791878 7 3 97866048 97877145 7 3 91212228 91212244 8 3 87922895 87922911 8 RRID:RGD_4139873
4139874 SS-Ets1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ets1em1Mcwi 4139856 8 32481694 32545237 7 8 33798598 33921593 7 8 33851478 33851485 8 8 31045909 31168010 7 RRID:RGD_4139874
4139875 FHH-Chr 1BN-Sorcs1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs1em1Mcwi 4139864 1 255767411 256279565 7 1 277404996 277912261 7 1 269965824 270473097 7 1 249207764 249207777 8 RRID:RGD_4139875
4139876 SS-Mmp2em1Mcwi This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mmp2em1Mcwi 4139860 19 15246036 15275061 7 19 26629728 26658966 7 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139876
4139877 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rab38em1Mcwi 4139867 1 144783919 144864573 7 1 158385888 158466621 7 1 152072716 152153449 7 1 142182566 142262923 7 RRID:RGD_4139877
4139878 SS-Mmp2em2Mcwi This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Mmp2em2Mcwi 4139869 19 15246036 15275061 7 19 26646695 26646702 8 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139878
4139879 SS-Nckap5em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Nckap5em1Mcwi 4139859 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139879
4139880 SS-Renem1Mcwi This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Renem1Mcwi 4139863 13 46262936 46275213 7 13 55555583 55566812 7 13 50502724 50513953 7 13 44803412 44803421 8 RRID:RGD_4139880
4139881 SS-Nckap5em3Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em3Mcwi 4139861 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139881
4139882 SS-Nppaem4Mcwi This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Nppaem4Mcwi 4139857 5 165074518 165075827 7 5 168466309 168467618 7 5 164808762 164808783 8 5 158429042 158430351 7 RRID:RGD_4139882
4139883 SS-Nox4em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nox4em2Mcwi 4139868 1 143415816 143603554 7 1 157106652 157285107 7 1 150861996 150862003 8 1 140900886 141078844 7 RRID:RGD_4139883
4139884 SS-Rag1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em1Mcwi 4139865 3 86780782 86791878 7 3 97866048 97877145 7 3 91212237 91212249 8 3 87922904 87922916 8 RRID:RGD_4139884
4139885 SS-Sh2b3em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_4139885
4139889 BHD/Dspe Birt-Hogg-Dube rat A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-06-06) Flcn 735088 RRID:RGD_4139889
4139890 TT/Sgn Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Fkbp6 1308926 12 22474002 22544784 7 12 26363264 26435311 7 12 24365941 24438088 7 12 21318251 21390350 7 RRID:RGD_4139890
4139891 F344-Chr 3SDT/Nyo This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background. National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_4139891
4139892 ALD/Hyo acid lipase deficiency rat In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism Lipam1Hyo 150519893 RRID:RGD_4139892
4140402 W-Tg(Gh1as)Nibs The construct which contains of rat growth hormone (Gh1) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat Gh1 cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_4140402
4140403 SD-Tg(Eno2-ATXN3*64Q)29Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140403
4140404 ODS-Gulood/od/ShiJcl Osteogenic disorder Shionagi rat Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) Gulood 126848761 RRID:RGD_4140404
4140405 LEXF6A/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140405
4140406 SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140406
4140407 SDT.BN-Gluco13/Nyo The Gluco13 (Gisdt1) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-Gluco14/Nyo (NBRP No. 0602). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140407
4140408 LEXF8C/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140408
4140409 COP-Chr 16DA/McoRrrc Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background University of Toledo College of Medicine, Toledo, Ohio consomic Unknown RRID:RGD_4140409
4140410 SD-Tg(Eno2-ATXN3*64Q)16Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140410
4140411 SDT.BN-Gluco14/Nyo The Gluco14 (Gisdt2) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN- Gluco13/Nyo (NBRP No. 0601). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140411
4140412 LEXF1D/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140412
4140413 LEXF1B/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140413
4140414 WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic Unknown 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140414
4140415 TRMRC/Kyo The coisogenic control strain for the TRMR strain (NBRP No.0016). National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Sperm RRID:RGD_4140415
4140416 SD-Tg(Eno2-Vcp)16Kakiz This transgenic strain was generated by microinjection into Slc:SD fertilized eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140416
4140469 F344-Kmch/NSlc Komachi from NBRP National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_4140469
4142540 SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 26280781 47890193 1 - by flanking markers 4 26659360 48448808 1 - by flanking markers 4 26753655 48656399 1 - by flanking markers 4 29593287 50119996 1 - by flanking markers RRID:RGD_4142540
4142541 W-Tg(Tek-GFP)1Soh This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_4142541
4142542 BN.SDT-Gluco14/Nyo The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142542
4142543 BN.SDT-Gluco13/Nyo The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142543
4142544 WKY/Kiha A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo RRID:RGD_4142544
4142545 SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 3 59676608 101359980 1 - by flanking markers 3 70419858 113470358 1 - by flanking markers 3 63849481 106900596 1 - by flanking markers 3 61934079 102200699 1 - by flanking markers RRID:RGD_4142545
4142546 AMI/Tj Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Dentistry RRID:RGD_4142546
4142547 SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 33407710 1 - by flanking markers 4 3096322 34240072 1 - by flanking markers 4 3044017 34379894 1 - by flanking markers 4 5218294 36405277 1 - by flanking markers RRID:RGD_4142547
4142548 SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 26280949 1 - by flanking markers 4 3096322 26659527 1 - by flanking markers 4 3044017 26753822 1 - by flanking markers 4 5218294 29593455 1 - by flanking markers RRID:RGD_4142548
4142549 SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 3237361 1 - by flanking markers 4 3096322 4400584 1 - by flanking markers 4 3044017 4364885 1 - by flanking markers 4 5218294 7935781 1 - by flanking markers RRID:RGD_4142549
4142550 SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 46605924 47890193 1 - by flanking markers 4 46704280 48448808 1 - by flanking markers 4 46898276 48656399 1 - by flanking markers 4 49131906 50119996 1 - by flanking markers RRID:RGD_4142550
4142799 LEW.SS-(D2Uia5-D2Rat143)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 2 13909383 106236206 1 - by flanking markers 2 13186164 125885146 1 - by flanking markers 2 13328947 106156987 1 - by flanking markers 2 15575840 103519040 1 - by flanking markers RRID:RGD_4142799
4142800 LEW.SS-(D18Chm31-D18Mit8)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_4142800
4143165 SD-Tg(Aqp5-GFP)ZboroRrrc Aqp5EGFP This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Aqp5 2144 RRID:RRRC_00427
4143456 BN.GK-(D2Wox30-D2Wox68)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown RRID:RGD_4143456
4143457 BN.GK-(D2Rat40-D2Wox35)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 163154358 1 - by flanking markers 2 189197858 189197988 1 - by flanking markers 2 169852670 244719662 1 - by flanking markers 2 157142078 157142209 1 - by flanking markers RRID:RGD_4143457
4143458 BN.GK-(D2Wox49-D2Rat70)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 191000085 254933362 1 - by flanking markers 2 217822782 281850471 1 - by flanking markers 2 198335799 263179188 1 - by flanking markers 2 183756199 245889826 1 - by flanking markers RRID:RGD_4143458
4143459 BN.GK-(D2Rat40-D2Got149)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 222343164 1 - by flanking markers 2 189197858 248391122 1 - by flanking markers 2 169852670 229036415 1 - by flanking markers 2 157142078 213653017 1 - by flanking markers RRID:RGD_4143459
4145088 SS.BN-(D6Rat119-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 111239053 138260635 1 - by flanking markers 6 120420333 147057860 1 - by flanking markers 6 111134524 138065254 1 - by flanking markers 6 106752656 132339866 1 - by flanking markers RRID:RGD_4145088
4145089 SS.BN-(D6Rat149-D6Rat18)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 93374504 1 - by flanking markers 6 6959479 103168177 1 - by flanking markers 6 7009971 93706327 1 - by flanking markers 6 10894415 89763029 1 - by flanking markers RRID:RGD_4145089
4145090 SS.BN-(D6Rat149-D6Got171)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 123782965 1 - by flanking markers 6 6959479 132827005 1 - by flanking markers 6 7009971 123598338 1 - by flanking markers 6 10894415 118863044 1 - by flanking markers RRID:RGD_4145090
4145091 SS.BN-(D6Rat149-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 138260635 1 - by flanking markers 6 6959479 147057860 1 - by flanking markers 6 7009971 138065254 1 - by flanking markers 6 10894415 132339866 1 - by flanking markers RRID:RGD_4145091
4145374 ACI.FHH-(D1Mit18-D1Rat90)(D14Rat98-D14Hmgc18)/Mcwi Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_4145374
4889411 SHRSP.WKY-(D1Smu13-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio- Hypertension 1;2 160754901;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 2;1 224991853;173074640 224991955;174300801 1 - by flanking markers;1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 1 156170341 156170557 1 - by flanking markers RRID:RGD_4889411
4889414 WKY.SHRSP-(D1Rat171-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1;2 158964262;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 1;2 172767534;224991853 174300801;224991955 1 - by flanking markers;1 - by flanking markers 1 166577232 166577467 1 - by flanking markers 1 155866514 155866750 1 - by flanking markers RRID:RGD_4889414
4889450 DA.PVG.1AV1-(D1Rat248-D1Rat10)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 6253932 25271177 1 - by flanking markers 1 7306802 86917075 1 - by flanking markers 1 5655772 85706974 1 - by flanking markers 1 5925877 24697545 1 - by flanking markers RRID:RGD_4889450
4889464 GK/Ox Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK inbred Unknown RRID:RGD_4889464
4889499 CDS-Chr 4CDR/Ygl Homozygous male CDS/Ygl were bred with CDR/Ygl females; F1 heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889499
4889817 SBN-Chr 1SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889817
4889820 SBH-Chr 1SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889820
4889822 SBN-Chr 17SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889822
4889875 SBH-Chr 2SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889875
4889877 SBH-Chr 20SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889877
4889879 SBH-Chr XSBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889879
4889882 SBH-Chr 17SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889882
4889890 DA.PVG.1AV1-(D17Rat8-D17Rat37)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Immunology 17 27618789 75802944 1 - by flanking markers 17 25486196 69844594 1 - by flanking markers 17 23522321 68114865 1 - by flanking markers 17 21782841 64759263 1 - by flanking markers RRID:RGD_4889890
4891048 SS.LEW-(D7Rat73-D7Rat128)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891048
4891051 LEW.SS-(D7Rat73-D7Rat128)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891051
4891103 WMI/EerRrrc WKY most immobile 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center inbred Unknown RRID:RRRC_00973
4891107 WLI/EerRrrc WKY least immobile 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois. Rat Resource and Research Center inbred Unknown RRID:RRRC_00967
4891165 Wig/Ymas wiggling These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan congenic Unknown RRID:RGD_4891165
4891380 SS.SR-(D9Mco95-D9Mco98)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 80946065 1 - by flanking markers 9 81100315 81180041 1 - by flanking markers 9 75403227 75482161 1 - by flanking markers RRID:RGD_4891380
4891383 SS.SR-(D9Mco98-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891383
4891386 SS.SR-(D9Mco98-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891386
4891388 SS.SR-(D9Mco95-D9Mco100)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891388
4891390 SS.SR-(D9Mco95-D9Mco100)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891390
4891392 SS.SR-(D9Mco95-D9Mco102)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81641213 1 - by flanking markers 9 81100315 81878831 1 - by flanking markers 9 75403227 76175576 1 - by flanking markers RRID:RGD_4891392
4891394 SS.SR-(D9Mco101-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 81611825 82246695 1 - by flanking markers 9 81847677 82477136 1 - by flanking markers 9 76145766 76771824 1 - by flanking markers RRID:RGD_4891394
4891396 SS.SR-(D9Mco72-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 44842118 74558151 1 - by flanking markers 9 52352690 82246695 1 - by flanking markers 9 52686874 82477136 1 - by flanking markers 9 47902208 76771824 1 - by flanking markers RRID:RGD_4891396
4891400 SS.SR-(D9Mco14-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891400
4891402 SS.SR-(D9Mco14-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891402
4891404 SS.SR-(D9Mco14-Resp18)/3Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891404
4892563 WF.WKY-(D5Rat26-D5Uwm42)/Uwm WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region. University of Wisconsin-Madison congenic Unknown 5 119332868 153554465 1 - by flanking markers 5 121495621 156871691 1 - by flanking markers 5 117554114 153097789 1 - by flanking markers 5 113558156 146996127 1 - by flanking markers RRID:RGD_4892563
5130721 HXB1/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5130721
5131094 BN-Lx/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California mutant Unknown RRID:RGD_5131094
5131095 BXH13/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131095
5131097 BXH12/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131097
5131099 BXH11/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131099
5131101 BXH10/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131101
5131104 BXH9/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131104
5131106 BXH8/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131106
5131108 BXH6/CubPrin Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131108
5131110 BXH5/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131110
5131113 HXB31/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131113
5131115 HXB29/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131115
5131118 HXB27/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131118
5131120 HXB26/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131120
5131122 HXB25/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131122
5131124 HXB23/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131124
5131126 HXB20/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131126
5131128 HXB17/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131128
5131130 HXB15/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131130
5131132 HXB13/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131132
5131134 HXB10/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained by Printz laboratory for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131134
5131136 HXB7/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131136
5131138 HXB4/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131138
5131140 HXB3/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131140
5131142 HXB2/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131142
5131144 HXB18/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131144
5131910 SS-Acad10em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Acad10em2Mcwi 5131905 12 36070275 36075844 7 12 42285817 42328189 7 12 40458754 40458763 8 12 34901211 34943973 7 RRID:RGD_5131910
5131911 SS-Alms1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Alms1em1Mcwi 5131906 4 119846037 119946085 7 4 181947469 182048235 7 4 117371972 117371988 8 4 118125581 118226005 7 RRID:RGD_5131911
5131912 SS-Aldh2em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Aldh2em2Mcwi 5131907 12 36081778 36116445 7 12 42334057 42366049 7 12 40486398 40486404 8 12 34949549 34982527 7 RRID:RGD_5131912
5131920 SS-Apoeem8Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct Apoeem8Mcwi 5131915 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_5131920
5131921 SS-Apoeem7Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct Apoeem7Mcwi 5131918 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_5131921
5131922 SS-Cdh13em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cdh13em1Mcwi 5131919 19 48507173 49575123 7 19 61621434 62720155 7 19 50848896 50848903 8 19 46349562 47387462 7 RRID:RGD_5131922
5131932 SS-Cyp1a1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1em1Mcwi 5131928 8 61462207 61468237 7 8 62249046 62255081 7 8 62476212 62476230 8 8 58096021 58102130 7 RRID:RGD_5131932
5131933 SS-Cybaem1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cybaem1Mcwi 5131930 19 52713150 52721609 7 19 65959818 65967224 7 19 55257747 55257782 8 19 50487598 50495669 7 RRID:RGD_5131933
5131934 SS-Cyp1a1em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Cyp1a1em5Mcwi 5131929 8 61462207 61468237 7 8 62249046 62255081 7 8 62472087 62478122 7 8 58096021 58102130 7 RRID:RGD_5131934
5131950 SS-Msraem3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msraem3Mcwi 5131945 15 43509775 43756283 7 15 51307920 51550758 7 15 47488333 47800662 7 15 38676395 38676412 8 RRID:RGD_5131950
5131951 SS-Prokr1em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1em2Mcwi 5131947 4 121750651 121758116 7 4 183939201 183949822 7 4 119375790 119386551 7 4 120022301 120033367 7 RRID:RGD_5131951
5131952 SS-Mas1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Mas1em1Mcwi 5131946 1 42154786 42185750 7 1 51644462 51675365 7 1 48076761 48108218 7 1 47910103 47910112 8 RRID:RGD_5131952
5131953 SS-Prokr1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1em1Mcwi 5131948 4 121750651 121758116 7 4 183939201 183949822 7 4 119375790 119386551 7 4 120022301 120033367 7 RRID:RGD_5131953
5131954 SS-Mstnem2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mstnem2Mcwi 5131949 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48452533 48458933 7 RRID:RGD_5131954
5131963 SS-Nox4em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nox4em1Mcwi 5131428 1 143415816 143603554 7 1 157106652 157285107 7 1 150861998 150862002 8 1 140900886 141078844 7 RRID:RGD_5131963
5131964 SS-Mstnem3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstnem3Mcwi 5131962 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456670 8 RRID:RGD_5131964
5131965 SS-Mthfrem1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mthfrem1Mcwi 5131961 5 165112850 165126885 7 5 168502556 168522350 7 5 164844642 164864360 7 5 158467728 158467755 8 RRID:RGD_5131965
5131966 SS-Plod1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Plod1em1Mcwi 5131960 5 164987252 165012581 7 5 168379092 168405534 7 5 164720629 164747071 8 5 158340674 158367581 7 RRID:RGD_5131966
5131974 SS-Rasgrp3em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3em1Mcwi 5131968 6 19808453 19871923 7 6 30966364 31065175 7 6 21072634 21171619 7 6 19914449 19914451 8 RRID:RGD_5131974
5131975 SS-Ptpn11em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ptpn11em1Mcwi 5131970 12 36501886 36558055 7 12 42762630 42822760 7 12 40895515 40955999 7 12 35390381 35390397 8 RRID:RGD_5131975
5131976 SS-Ptpn11em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ptpn11em4Mcwi 5131969 12 36501886 36558055 7 12 42762630 42822760 7 12 40895515 40955999 7 12 35365436 35424925 7 RRID:RGD_5131976
5131987 SS-Tgfb1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Tgfb1em1Mcwi 5131986 1 80894705 80911020 7 1 83742151 83758472 7 1 82480875 82497196 7 1 81196532 81212848 7 RRID:RGD_5131987
5131988 SS-Wdr72em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72em2Mcwi 5131978 8 78891358 79050751 7 8 80586841 80744090 7 8 80965734 81125710 7 8 74838338 75020938 7 RRID:RGD_5131988
5131989 SS-Tgfb1em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tgfb1em3Mcwi 5131980 1 80894705 80911020 7 1 83742151 83758472 7 1 82480875 82497196 7 1 81196532 81212848 7 RRID:RGD_5131989
5131990 SS-Slc30a8em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8em2Mcwi 5131981 7 88583770 88617145 7 7 92476024 92512365 7 7 91832988 91869329 7 7 83603467 83603483 8 RRID:RGD_5131990
5131991 SS-Slc30a8em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8em1Mcwi 5131979 7 88583770 88617145 7 7 92476024 92512365 7 7 91832988 91869329 7 7 83603469 83603485 8 RRID:RGD_5131991
5134683 WF.WKY-(D7Rat171-D7Rat128)/1Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 7 20238970 114528048 1 - by flanking markers RRID:RGD_5134683
5134685 WF.WKY-(D7Rat171-D7Rat128)/2Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 7 20238970 114528048 1 - by flanking markers RRID:RGD_5134685
5134687 WF.WKY-(D7Rat51-D7Rat128)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 50833677 121524220 1 - by flanking markers 7 54558231 124236725 1 - by flanking markers 7 54534996 124246733 1 - by flanking markers 7 47251783 114528048 1 - by flanking markers RRID:RGD_5134687
5134689 WF.WKY-(D7Uwm25-D7Rat128)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 121523977 121524220 1 - by flanking markers 7 89318050 124236725 1 - by flanking markers 7 89283487 124246733 1 - by flanking markers 7 81134174 114528048 1 - by flanking markers RRID:RGD_5134689
5134692 WF.WKY-(D7Rat171-D7Rat45)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 68057251 1 - by flanking markers 7 26490428 71522360 1 - by flanking markers 7 26359973 71352127 1 - by flanking markers 7 20238970 63902784 1 - by flanking markers RRID:RGD_5134692
5134951 WF.COP-(D7Rat39-D7Uwm12)/1Uwm Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 7 81116229 81116402 1 - by flanking markers RRID:RGD_5134951
5134953 WF.COP-(D7Rat39-D7Uwm12)/2Uwm Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 7 81116229 81116402 1 - by flanking markers RRID:RGD_5134953
5135031 BN.MES-Cyba/Sna mutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlc Department of Aging Biology, Institute on Aging and Adaptation, Shinshu University, Matsumoto, Japan congenic Unknown RRID:RGD_5135031
5135472 ACI.BN-(D5Uwm70-D5Rat32)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 139659415 139659574 1 - by flanking markers 5 141933225 141933383 1 - by flanking markers 5 138123799 138123957 1 - by flanking markers 5 132686313 132686472 1 - by flanking markers RRID:RGD_5135472
5135473 ACI.BN-(D5Uwm70-D5Got42)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 130756424 130756605 1 - by flanking markers 5 132878119 132878299 1 - by flanking markers 5 129038716 129038896 1 - by flanking markers 5 124160767 124160948 1 - by flanking markers RRID:RGD_5135473
5135475 ACI.BN-(D5Rat60-D5Rat115)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 106262697 118138413 1 - by flanking markers 5 109291409 120337480 1 - by flanking markers 5 105304453 116395137 1 - by flanking markers 5 101467719 112419733 1 - by flanking markers RRID:RGD_5135475
5135477 ACI.BN-(D5Uwm70-D5Mgh15)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 167844579 167844737 1 - by flanking markers 5 171364494 171364652 1 - by flanking markers 5 167739539 167739697 1 - by flanking markers 5 161165494 161165651 1 - by flanking markers RRID:RGD_5135477
5135479 ACI.BN-(D5Rat113-D5Rat36)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 145187034 1 - by flanking markers 5 79957402 147610238 1 - by flanking markers 5 75809470 143846372 1 - by flanking markers 5 73483796 138113774 1 - by flanking markers RRID:RGD_5135479
5135481 ACI.BN-(D5Mgh17-D5Rat98)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 100017265 1 - by flanking markers 5 19190627 103451257 1 - by flanking markers 5 14408903 99421638 1 - by flanking markers 5 14529225 95774399 1 - by flanking markers RRID:RGD_5135481
5143940 ACI.FHH-(D1Rat74-D1Rat90)/Eur Congenic substrain that originated from ACI.FHH-(D1Rat298-D1Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 227005311 267111153 1 - by flanking markers 1 248763714 289137268 1 - by flanking markers 1 241482188 281795785 1 - by flanking markers 1 221264111 259647894 1 - by flanking markers RRID:RGD_5143940
5143941 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi Triple congenic ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of Wisconsin Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5143941
5143942 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_5143942
5143943 ACI.FHH-(D14Mit11-D14Rat82)/Eur Congenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Cryopreserved Sperm 14 4995006 30258439 1 - by flanking markers 14 4874267 30225437 1 - by flanking markers 14 4878162 30412508 1 - by flanking markers 14 3857038 28203397 1 - by flanking markers RRID:RGD_5143943
5143984 SS-Plekha7em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plekha7em1Mcwi 5143978 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483657 8 1 170364524 170547843 7 RRID:RGD_5143984
5143985 SS-Mstnem1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstnem1Mcwi 5143964 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456680 8 RRID:RGD_5143985
5143986 SS-Ulk3em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3em1Mcwi 5143968 8 61343722 61348824 7 8 62146130 62152150 7 8 62368548 62375229 7 8 57992396 58000220 7 RRID:RGD_5143986
5143987 SS-Gpr183em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em3Mcwi 5143961 15 107056367 107067887 7 15 111751148 111763869 7 15 108365659 108365666 8 15 99037764 99050550 7 RRID:RGD_5143987
5143988 SS-Gpr183em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em2Mcwi 5143955 15 107056367 107067887 7 15 111751148 111763869 7 15 108365665 108365668 8 15 99037764 99050550 7 RRID:RGD_5143988
5143989 SS-Agtrapem4Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrapem4Mcwi 5143963 5 165154252 165164570 7 5 168546202 168556520 7 5 164891661 164891744 8 5 158507427 158519036 7 RRID:RGD_5143989
5143990 SS-Ulk3em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3em4Mcwi 5143971 8 61343722 61348824 7 8 62146130 62152150 7 8 62368548 62375229 7 8 57992396 58000220 7 RRID:RGD_5143990
5143991 SS-Gpr183em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em1Mcwi 5143957 15 107056367 107067887 7 15 111751148 111763869 7 15 108365661 108365667 8 15 99037764 99050550 7 RRID:RGD_5143991
5143992 SS-Rasgrp3em3Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3em3Mcwi 5143946 6 19808453 19871923 7 6 30966364 31065175 7 6 21072634 21171619 7 6 19914439 19914458 8 RRID:RGD_5143992
5143993 SS-Plcd3em4Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3em4Mcwi 5143954 10 92234651 92275433 7 10 90937117 90958001 7 10 91164801 91186054 8 10 88026707 88048080 7 RRID:RGD_5143993
5143994 SS-Plcd3em7Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3em7Mcwi 5143976 10 92234651 92275433 7 10 90937117 90958001 7 10 91164801 91186054 8 10 88026707 88048080 7 RRID:RGD_5143994
5143995 SS-Plekha7em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 8. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Plekha7em4Mcwi 5143979 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483656 8 1 170420191 170420209 8 RRID:RGD_5143995
5143996 SS-Agtrapem8Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrapem8Mcwi 5143970 5 165154252 165164570 7 5 168546202 168556520 7 5 164891578 164891677 8 5 158507427 158519036 7 RRID:RGD_5143996
5144101 SS-Kcnq1em14Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Kcnq1em14Mcwi 5144083 1 203383401 203803687 7 1 223154713 223490458 7 1 216293087 216630339 8 1 198291711 198624683 7 RRID:RGD_5144101
5144102 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Asipem1Mcwi 5144099 3 145445175 145536831 7 3 156860395 156949277 7 3 150492010 150579870 7 3 143473584 143561170 7 RRID:RGD_5144102
5144103 SS-Ldlrem1Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlrem1Mcwi 5144090 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 8 8 20270020 20292981 7 RRID:RGD_5144103
5144104 SS-Ncf2em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Ncf2em1Mcwi 5144089 13 67806516 67834105 7 13;13;13;13 75200283;75200283;75200283;75200283 75200287;75200287;75200287;75200287 8;8;8;8 13 70229196 70229200 8 13 64958217 64958221 8 RRID:RGD_5144104
5144105 SS-Hexim2em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hexim2em4Mcwi 5144095 10 92306494 92312256 7 10 90988728 90994491 7 10 91217079 91222841 8 10 88077870 88084776 7 RRID:RGD_5144105
5144106 SS-Kcnq1em9Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnq1em9Mcwi 5144076 1 203383401 203803687 7 1 223154713 223490458 7 1 216293087 216630339 8 1 198291711 198624683 7 RRID:RGD_5144106
5144107 SS-Itga9em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Itga9em1Mcwi 5144077 8 123526904 123838241 7 8 126493359 126795566 7 8 127271029 127576709 7 8 118383417 118383503 8 RRID:RGD_5144107
5144108 SS-Ldlrem4Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlrem4Mcwi 5144075 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 8 8 20270020 20292981 7 RRID:RGD_5144108
5144110 ACI.BN-(D5Mgh17-D5Mgh15)/Shul This congenic strain is developed by further genotyping ACI.BN-(D5Mgh17-D5Rat205)/Shul. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 167844737 1 - by flanking markers 5 19190627 171364652 1 - by flanking markers 5 14408903 167739697 1 - by flanking markers 5 14529225 161165651 1 - by flanking markers RRID:RGD_5144110
5147594 FHH.PCK-(D9Rat35-D9Rat70)/Mcwi A FHH/EurMcwi male was crossed with a PCK/CrljCrl-Pkhd1pck/Crl female, and the male progeny were backcrossed to FHH/EurMcwi females for five generations by marker assisted breeding. In each generation, males were genotyped by fluorescent genotyping for three markers within the Pkhd1 gene, and 98 markers evenly spaced throughout the genome. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Pkhd1pck 11535943 9 12916127 21667256 1 - by flanking markers 9 18672124 27914444 1 - by flanking markers 9 19794101 29075268 1 - by flanking markers 9 17220476 25268236 1 - by flanking markers RRID:RGD_5147594
5490515 FHH.BN(D1Rat265-D1Rat76)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Extinct 1 90448902 230411453 1 - by flanking markers 1 95453405 252243871 1 - by flanking markers 1 94364073 244992610 1 - by flanking markers 1 90664883 224569684 1 - by flanking markers RRID:RGD_5490515
5490516 FHH.BN(D14Rat80-D14Hmgc4)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 13778105 21435476 1 - by flanking markers 14 13914610 21463742 1 - by flanking markers 14 13971208 21555302 1 - by flanking markers 14 12326866 19848266 1 - by flanking markers RRID:RGD_5490516
5490517 FHH.BN(D14Rat78-D14Hmgc4)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 17564855 21435476 1 - by flanking markers 14 17417347 21463742 1 - by flanking markers 14 17499969 21555302 1 - by flanking markers 14 15995099 19848266 1 - by flanking markers RRID:RGD_5490517
5508304 WUN-Abcc2TR-/HsdRrrc Spontaneous 1-bp deletion mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). This mutation at amino acid 393 resulting a frameshift and premature stop at position 401. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-08-02) Abcc2|Abcc2TR- 2366|12792941 1 270999832 271057750 7 1 263554426 263612556 7 1 242664657 242723239 7 RRID:RRRC_00442
5508305 F344-Dpp4DPPIV-/DchcHsdRrrc The DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-16) Dpp4DPPIV 12792942 3 44279255 44360283 7 3 54957146 55038628 7 3 48291055 48372672 7 3 46962233 47043870 7 RRID:RRRC_00443
5508356 SS-Gucy1a3em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Extinct Gucy1a3em1Mcwi 5508351 2 173756824 173818316 7 2 200453480 200515219 7 2 181045694 181103321 7 2 167418615 167482293 7 RRID:RGD_5508356
5508357 SS-Tfdp2em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tfdp2em2Mcwi 5508332 8 101256112 101392512 7 8 103489105 103629520 7 8 104040795 104181228 7 8 96760459 96901466 7 RRID:RGD_5508357
5508358 SS-Wdr72em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72em1Mcwi 5508327 8 78891358 79050751 7 8 80586841 80744090 7 8 80965734 81125710 7 8 74838338 75020938 7 RRID:RGD_5508358
5508359 SS-Pruneem3Mcwi This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 130-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pruneem3Mcwi 5508348 2 190165356 190192807 7 2 215924545 215954221 7 2 196427714 196457105 7 2 182859142 182859271 8 RRID:RGD_5508359
5508360 SS-Dguokem4Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Dguokem4Mcwi 5508323 4 117697251 117725383 7 4 179770727 179798683 7 4 115180433 115208061 7 4 115987101 116014733 7 RRID:RGD_5508360
5508361 SS-Bcas3em4Mcwi This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Bcas3em4Mcwi 5508329 10 73617547 74078190 7 10 72660671 73177317 7 10 72756587 72756593 8 10 70213710 70673080 7 RRID:RGD_5508361
5508362 SS-Ncf2em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ncf2em4Mcwi 5508342 13 67806516 67834105 7 13 75197561 75229600 7 13 70226441 70259019 7 13 64958078 64958221 8 RRID:RGD_5508362
5508363 SS-Sorcs2em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs2em4Mcwi 5508326 14 79968072 80344330 7 14 79176694 79547823 7 14 79538911 79912333 7 14 74711199 74711203 8 RRID:RGD_5508363
5508364 SS-Pruneem1Mcwi This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pruneem1Mcwi 5508341 2 190165356 190192807 7 2 215924545 215954221 7 2 196427714 196457105 7 2 182858954 182859151 8 RRID:RGD_5508364
5508365 SS-Agtr1aem5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtr1aem5Mcwi 5508318 17 40629318 40684982 7 17 37217810 37270540 7 17 35908756 35908774 8 17 34173446 34226892 7 RRID:RGD_5508365
5508366 SS-Tfdp2em5Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Tfdp2em5Mcwi 5508334 8 101256112 101392512 7 8 103489105 103629520 7 8 104040795 104181228 7 8 96760459 96901466 7 RRID:RGD_5508366
5508367 SS-Ulk4em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk4em3Mcwi 5508340 8 125992455 126284263 7 8 128829597 129125286 7 8 129631003 129919080 7 8 120670879 120966026 7 RRID:RGD_5508367
5508368 SS-Trafd1em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Trafd1em1Mcwi 5508352 12 36301824 36315741 7 12 42562635 42576553 7 12 40695520 40709438 7 12 35165606 35179525 7 RRID:RGD_5508368
5508369 SS-Myadml2em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Myadml2em1Mcwi 5508317 10 110039330 110040967 7 10 109418559 109420196 7 10 109822170 109827328 7 10 105922557 105927867 7 RRID:RGD_5508369
5508370 SS-Nppbem2Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nppbem2Mcwi 5508324 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5508370
5508371 SS-Mylipem3Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct Mylipem3Mcwi 5508336 17 25308147 25329887 7 17 21703590 21725205 7 17 19682040 19703681 7 17 19286649 19308295 7 RRID:RGD_5508371
5508380 SS-TgTn(T2ONC)2Mcwi These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. PhysGen Knockouts transgenic Cryopreserved Sperm RRID:RGD_5508380
5508381 SS-TgTn(T2ONC)1Mcwi These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. PhysGen Knockouts transgenic Cryopreserved Sperm RRID:RGD_5508381
5508392 HsdHlr:ZUC-Leprfa Derived from a colony obtained in 1992 from Hoffmann-la-Roche, Nutley, New Jersey. Envigo outbred Unknown Leprfa 13432153 RRID:RGD_5508392
5508393 BN/RijHsd These were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Envigo. Envigo inbred Unknown RRID:RGD_5508393
5508394 F344BNF1/Hsd Offspring of a cross between the F344/NHsd inbred female and a BN male rat. Harlan hybrid Unknown RRID:RGD_5508394
5508395 Hsd:RH-Foxn1rnu Athymic Nude Derived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland. Envigo outbred Unknown RRID:RGD_5508395
5508396 HsdRccHan:WIST Derived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc. in 1993 (nomenclature HsdHan:WIST). Harlan became Envigo in 2015. In 2004 Envigo acquired RCC Ltd. and new breeding stock was transferred in 2008 (nomenclature RccHan:WIST). Unlike competitive models, the RccHan:WIST rat has been maintained from the original nucleus of 156 breeding pairs in Hannover, Germany. ENVIGO outbred Unknown RRID:RGD_5508396
5508397 HotHsd:SD Sprague Dawley Originally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986. Envigo outbred Unknown RRID:RGD_5508397
5508398 BluHsd:LE Long Evans (Blue Spruce) From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015. Harlan/Envigo outbred Unknown RRID:RGD_5508398
5509086 ACI.BN-(D5Rat72-D5Rat36)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 120983238 145187034 1 - by flanking markers 5 123027973 147610238 1 - by flanking markers 5 119124918 143846372 1 - by flanking markers 5 114973303 138113774 1 - by flanking markers RRID:RGD_5509086
5509087 ACI.BN-(D5Rat113-D5Rat159)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 76707563 1 - by flanking markers 5 79957402 79957599 1 - by flanking markers 5 75809470 75809667 1 - by flanking markers 5 73483796 73483994 1 - by flanking markers RRID:RGD_5509087
5509988 SS-Nppbem4Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Nppbem4Mcwi 5509979 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5509988
5509989 SS-Msraem4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msraem4Mcwi 5509977 15 43509775 43756283 7 15 51307920 51550758 7 15 47488333 47800662 7 15 38676398 38676402 8 RRID:RGD_5509989
5509990 SS-Cyp1a1em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1em2Mcwi 5509976 8 61462207 61468237 7 8 62249046 62255081 7 8 62476131 62476318 8 8 58096021 58102130 7 RRID:RGD_5509990
5509991 SS-Mylipem2Mcwi This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp deletion and one G insertion causing frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mylipem2Mcwi 5508333 17 25308147 25329887 7 17 21703590 21725205 7 17 19682040 19703681 7 17 19308054 19308102 8 RRID:RGD_5509991
5509992 SS-Ube2q2em3Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ube2q2em3Mcwi 5509987 8 58688257 58749088 7 8 58292660 58349722 7 8 59709972 59754102 7 8 55518402 55578342 7 RRID:RGD_5509992
5509993 SS-Tcf7l2em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tcf7l2em1Mcwi 5509981 1 262031823 262226710 7 1 283387566 284118928 7 1 276686911 276730517 7 1 254785956 254978967 7 RRID:RGD_5509993
5509994 SS-Sh2b3em2Mcwi This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em2Mcwi 5509982 12 35954679 35958446 7 12 42132947 42136714 7 12 40261990 40265757 7 12 34750773 34750773 8 RRID:RGD_5509994
5509995 SS-Adra2aem1Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adra2aem1Mcwi 5509986 1 282178475 282181275 7 1 274766841 274766847 8 1 253061480 253064280 7 RRID:RGD_5509995
5509996 SS-Stk39em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Extinct Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5509996
5509997 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Nckap5em4Mcwi 5509975 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_5509997
5529230 ACI.FHH-(D1Hmgc16-D1Rat225)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 261180160 261180301 1 - by flanking markers 1 275301183 283061559 1 - by flanking markers 1 267871151 271693968 1 - by flanking markers 1 246983819 246984013 1 - by flanking markers RRID:RGD_5529230
5529529 ACI.FHH-(D1Hmgc1-D1Hmgc19)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 249745626 249745784 1 - by flanking markers 1 271889649 277901651 1 - by flanking markers 1 264446896 270462479 1 - by flanking markers 1 243559115 249583894 1 - by flanking markers RRID:RGD_5529529
5529731 ACI.FHH-(D1Hmgc20-D1Hmgc21)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 274674350 276466399 1 - by flanking markers 1 267241552 269024803 1 - by flanking markers 1 246355367 248138424 1 - by flanking markers RRID:RGD_5529731
5683886 SS-Chr 12BN.SS-(D12Arb13-D12Mit2)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 7382721 20932776 1 - by flanking markers 12 10334114 24663199 1 - by flanking markers 12 8249608 22650918 1 - by flanking markers 12 6833190 19611091 1 - by flanking markers RRID:RGD_5683886
5683888 SS-Chr 12BN.SS-(D12Hmgc3-D12Rat79)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 36223785 36224090 1 - by flanking markers 12 17102817 42485122 1 - by flanking markers 12 15085585 40618007 1 - by flanking markers 12 13008296 35088624 1 - by flanking markers RRID:RGD_5683888
5683890 SS-Chr 12BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 17102817 24300160 1 - by flanking markers 12 15085585 22283507 1 - by flanking markers 12 13008296 19212979 1 - by flanking markers RRID:RGD_5683890
5685369 SS-Agtr1aem1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Agtr1aem1Mcwi 5508331 17 40629318 40684982 7 17 37217810 37270540 7 17 35908769 35908770 8 17 34173446 34226892 7 RRID:RGD_5685369
5686300 SS-Adra2aem1Mcwi-/- SS-Adra2aem1Mcwi-/Adra2aem1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Adra2aem1Mcwi 5509986 1 282178475 282181275 7 1 274766841 274766847 8 1 253061480 253064280 7 RRID:RGD_5686300
5686302 SS-Adra2aem1Mcwi+/+ SS-Adra2aem1Mcwi+/Adra2aem1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686302
5686304 SS-Agtrapem4Mcwi-/- SS-Agtrapem4Mcwi-/Agtrapem4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Embryo (as of 2018-09-05) RRID:RGD_5686304
5686306 SS-Agtrapem4Mcwi+/+ SS-Agtrapem4Mcwi+/Agtrapem4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686306
5686308 SS-Hexim2em4Mcwi-/- SS-Hexim2em4Mcwi-/Hexim2em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686308
5686311 SS-Hexim2em4Mcwi+/+ SS-Hexim2em4Mcwi+/Hexim2em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686311
5686314 SS-Rasgrp3em1Mcwi-/- SS-Rasgrp3em1Mcwi-/Rasgrp3em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686314
5686316 SS-Rasgrp3em1Mcwi+/+ SS-Rasgrp3em1Mcwi+/Rasgrp3em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686316
5686318 SS-Sh2b3em1Mcwi-/- SS-Sh2b3em1Mcwi-/Sh2b3em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 . PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_5686318
5686320 SS-Sh2b3em1Mcwi+/+ SS-Sh2b3em1Mcwi+/Sh2b3em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686320
5686322 SS-Sh2b3em1Mcwi-/+ SS-Sh2b3em1Mcwi-/Sh2b3em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_5686322
5686326 SS-Ulk3em4Mcwi-/- SS-Ulk3em4Mcwi-/Ulk3em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686326
5686328 SS-Ulk3em4Mcwi+/+ SS-Ulk3em4Mcwi+/Ulk3em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686328
5686330 SS-Ulk3em4Mcwi-/+ SS-Ulk3em4Mcwi-/Ulk3em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686330
5686332 SS-Wdr72em2Mcwi-/- SS-Wdr72em2Mcwi-/Wdr72em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686332
5686335 SS-Wdr72em2Mcwi+/+ SS-Wdr72em2Mcwi+/Wdr72em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686335
5686652 SS-Agtr1aem1Mcwi-/- SS-Agtr1aem1Mcwi-/Agtr1aem1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686652
5686654 SS-Agtr1aem1Mcwi+/+ SS-Agtr1aem1Mcwi+/Agtr1aem1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686654
5686657 SS-Agtr1aem5Mcwi-/- SS-Agtr1aem5Mcwi-/Agtr1aem5Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686657
5686659 SS-Agtrapem8Mcwi-/- SS-Agtrapem8Mcwi-/Agtrapem8Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686659
5686662 SS-Agtrapem8Mcwi+/+ SS-Agtrapem8Mcwi+/Agtrapem8Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686662
5686664 SS-Aldh2em2Mcwi-/- SS-Aldh2em2Mcwi-/Aldh2em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686664
5686666 SS-Aldh2em2Mcwi+/+ SS-Aldh2em2Mcwi+/Aldh2em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686666
5686668 SS-Cdh13em1Mcwi-/- SS-Cdh13em1Mcwi-/Cdh13em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686668
5686670 SS-Cdh13em1Mcwi+/+ SS-Cdh13em1Mcwi+/Cdh13em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686670
5686672 SS-Cyp1a1em1Mcwi-/- SS-Cyp1a1em1Mcwi-/Cyp1a1em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-11-06) RRID:RGD_5686672
5686676 SS-Cyp1a1em1Mcwi+/+ SS-Cyp1a1em1Mcwi+/Cyp1a1em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686676
5686678 SS-Cyp1a1em2Mcwi-/- SS-Cyp1a1em2Mcwi-/Cyp1a1em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686678
5686680 SS-Cyp1a1em2Mcwi+/+ SS-Cyp1a1em2Mcwi+/Cyp1a1em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686680
5686684 SS-Cyp1a1em5Mcwi-/- SS-Cyp1a1em5Mcwi-/Cyp1a1em5Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686684
5686687 SS-Cyp1a1em5Mcwi+/+ SS-Cyp1a1em5Mcwi+/Cyp1a1em5Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686687
5686689 SS-Prokr1em1Mcwi-/- SS-Prokr1em1Mcwi-/Prokr1em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686689
5686692 SS-Prokr1em1Mcwi+/+ SS-Prokr1em1Mcwi+/Prokr1em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686692
5686695 SS-Prokr1em2Mcwi-/- SS-Prokr1em2Mcwi-/Prokr1em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686695
5686697 SS-Prokr1em2Mcwi+/+ SS-Prokr1em2Mcwi+/Prokr1em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686697
5686700 SS-Kcnq1em14Mcwi-/- SS-Kcnq1em14Mcwi-/Kcnq1em14Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686700
5686702 SS-Kcnq1em14Mcwi+/+ SS-Kcnq1em14Mcwi+/Kcnq1em14Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686702
5686704 SS-Msraem3Mcwi-/- SS-Msraem3Mcwi-/Msraem3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686704
5686706 SS-Msraem3Mcwi+/+ SS-Msraem3Mcwi+/Msraem3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686706
5686708 SS-Msraem4Mcwi-/- SS-Msraem4Mcwi-/Msraem4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686708
5686710 SS-Msraem4Mcwi+/+ SS-Msraem4Mcwi+/Msraem4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686710
5686713 SS-Mstnem1Mcwi-/- SS-Mstnem1Mcwi-/Mstnem1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstnem1Mcwi 5143964 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456680 8 RRID:RGD_5686713
5686715 SS-Mstnem1Mcwi+/+ SS-Mstnem1Mcwi+/Mstnem1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686715
5686718 SS-Mstnem3Mcwi-/- SS-Mstnem3Mcwi-/Mstnem3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstnem3Mcwi 5131962 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456670 8 RRID:RGD_5686718
5686721 SS-Mstnem3Mcwi+/+ SS-Mstnem3Mcwi+/Mstnem3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686721
5686723 SS-Mstnem3Mcwi-/+ SS-Mstnem3Mcwi-/Mstnem3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686723
5686725 SS-Nppaem4Mcwi-/- SS-Nppaem4Mcwi-/Nppaem4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686725
5686728 SS-Nppaem4Mcwi+/+ SS-Nppaem4Mcwi+/Nppaem4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686728
5686730 SS-Nppbem2Mcwi-/- SS-Nppbem2Mcwi-/Nppbem2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown Nppbem2Mcwi 5508324 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5686730
5686732 SS-Nppbem2Mcwi+/+ SS-Nppbem2Mcwi+/Nppbem2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686732
5686734 SS-Nppbem4Mcwi-/- SS-Nppbem4Mcwi-/Nppbem4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686734
5686736 SS-Nppbem4Mcwi+/+ SS-Nppbem4Mcwi+/Nppbem4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686736
5686738 SS-Plcd3em4Mcwi-/- SS-Plcd3em4Mcwi-/Plcd3em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686738
5686740 SS-Plcd3em4Mcwi+/+ SS-Plcd3em4Mcwi+/Plcd3em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686740
5686742 SS-Plcd3em7Mcwi-/- SS-Plcd3em7Mcwi-/Plcd3em7Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686742
5686744 SS-Plcd3em7Mcwi+/+ SS-Plcd3em7Mcwi+/Plcd3em7Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686744
5686747 SS-Plekha7em1Mcwi-/- SS-Plekha7em1Mcwi-/Plekha7em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686747
5686749 SS-Plekha7em1Mcwi+/+ SS-Plekha7em1Mcwi+/Plekha7em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686749
5686758 SS-Plekha7em4Mcwi-/- SS-Plekha7em4Mcwi-/Plekha7em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Plekha7em4Mcwi 5143979 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483656 8 1 170420191 170420209 8 RRID:RGD_5686758
5686760 SS-Plekha7em4Mcwi+/+ SS-Plekha7em4Mcwi+/Plekha7em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686760
5686762 SS-Plod1em1Mcwi-/- SS-Plod1em1Mcwi-/Plod1em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686762
5686764 SS-Plod1em1Mcwi+/+ SS-Plod1em1Mcwi+/Plod1em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686764
5686766 SS-Sh2b3em2Mcwi-/- SS-Sh2b3em2Mcwi-/Sh2b3em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em2Mcwi 5509982 12 35954679 35958446 7 12 42132947 42136714 7 12 40261990 40265757 7 12 34750773 34750773 8 RRID:RGD_5686766
5686768 SS-Slc30a8em1Mcwi-/- SS-Slc30a8em1Mcwi-/Slc30a8em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686768
5686770 SS-Slc30a8em1Mcwi+/+ SS-Slc30a8em1Mcwi+/Slc30a8em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686770
5686772 SS-Slc30a8em2Mcwi-/- SS-Slc30a8em2Mcwi-/Slc30a8em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686772
5686776 SS-Slc30a8em2Mcwi+/+ SS-Slc30a8em2Mcwi+/Slc30a8em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686776
5686778 SS-Stk39em2Mcwi-/- SS-Stk39em2Mcwi-/Stk39em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5686778
5686780 SS-Stk39em2Mcwi+/+ SS-Stk39em2Mcwi+/Stk39em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686780
5686782 SS-Stk39em2Mcwi-/+ SS-Stk39em2Mcwi-/Stk39em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5686782
5686784 SS-Tcf7l2em1Mcwi-/- SS-Tcf7l2em1Mcwi-/Tcf7l2em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686784
5686786 SS-Tcf7l2em1Mcwi+/+ SS-Tcf7l2em1Mcwi+/Tcf7l2em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686786
5686788 SS-Tcf7l2em1Mcwi-/+ SS-Tcf7l2em1Mcwi-/Tcf7l2em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686788
5686790 SS-Ulk3em1Mcwi-/- SS-Ulk3em1Mcwi-/Ulk3em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686790
5686792 SS-Ulk3em1Mcwi+/+ SS-Ulk3em1Mcwi+/Ulk3em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686792
5686794 SS-Ulk3em1Mcwi-/+ SS-Ulk3em1Mcwi-/Ulk3em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686794
5686797 SS-Wdr72em1Mcwi-/- SS-Wdr72em1Mcwi-/Wdr72em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686797
5686799 SS-Wdr72em1Mcwi+/+ SS-Wdr72em1Mcwi+/Wdr72em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5686799
5686826 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_5686826
5686829 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat6-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5686829
5686832 ACI.FHH-(D1Mit18-D1Rat90)(D3Got102-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Multicongenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5686832
5687688 FHH-Tg(CAG-Rab38)1Mcwi A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion mapped to chromosome 14, roughly 13.2-Mbp, and was more than 100-kbp away from the nearest gene (downstream of Antrx2). Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_5687688
5687689 FHH-Tg(CAG-Rab38)2Mcwi A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion in line 2 was found to be within a long interspersed nuclear element (LINE) sequence and could not be unambiguously mapped to a specific chromosome location. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_5687689
5687969 ACI.BN-(D2Rat251-D2Mgh3)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 6332896 63001078 1 - by flanking markers 2 6118364 81156651 1 - by flanking markers 2 6155132 63538449 1 - by flanking markers 2 8634571 62516896 1 - by flanking markers RRID:RGD_5687969
5687971 ACI.BN-(D2Rat10-D2Rat202)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 35874553 51821161 1 - by flanking markers 2 54092967 70871600 1 - by flanking markers 2 34967269 52507805 1 - by flanking markers 2 36023184 51729300 1 - by flanking markers RRID:RGD_5687971
5687973 ACI.BN-(D18Rat30-D18Rat89)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 18 5682011 63697215 1 - by flanking markers 18 5795276 62092559 1 - by flanking markers 18 5825946 62905769 1 - by flanking markers 18 5584537 60722497 1 - by flanking markers RRID:RGD_5687973
5687974 SS-Chr 5BN-Cyp4a2em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. PhysGen Knockouts mutant Extinct Cyp4a2em1Mcwi 5687724 5 135765673 135773006 7 5 137989327 138000302 7 5 134196910 134207888 7 5 128922355 128934188 7 RRID:RGD_5687974
5687975 SS-Prex1em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Prex1em2Mcwi 5687719 3 157693897 157863943 7 3 169494331 169575981 7 3 163329580 163477822 7 3 155306950 155456688 7 RRID:RGD_5687975
5687977 SS-Acad10em2Mcwi+/+ SS-Acad10em2Mcwi+/Acad10em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RGD_5687977
5687979 SS-Acad10em2Mcwi-/- SS-Acad10em2Mcwi-/Acad10em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The homozygous mutant carries a 10-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-07-18) Acad10em2Mcwi 5131905 12 36070275 36075844 7 12 42285817 42328189 7 12 40458754 40458763 8 12 34901211 34943973 7 RRID:RGD_5687979
5687981 SS-Alms1em1Mcwi-/- SS-Alms1em1Mcwi-/Alms1em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Alms1em1Mcwi 5131906 4 119846037 119946085 7 4 181947469 182048235 7 4 117371972 117371988 8 4 118125581 118226005 7 RRID:RGD_5687981
5687983 SS-Alms1em1Mcwi+/+ SS-Alms1em1Mcwi+/Alms1em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown RRID:RG