# RGD-PIPELINE: ftp-file-extracts
# MODULE: strains   build Mar 13, 2024
# GENERATED-ON: 2024/09/28
# PURPOSE: information about active rat strains extracted from RGD database
# CONTACT: rgd.data@mcw.edu
# FORMAT: tab delimited text
# NOTES: multiple values in a single column are separated by ';'
#        as of Oct 15, 2021, new columns were added: CITATION_ID, MRATBN_7.2_CHR, MRATBN_7.2_START_POS, MRATBN_7.2_STOP_POS, MRATBN_7.2_METHOD
#        as of Feb 08, 2024, column ORIGIN was renamed to ORIGINATION, and new column DESCRIPTION was added
RGD_ID	STRAIN_SYMBOL	FULL_NAME	ORIGINATION	SOURCE	STRAIN_TYPE	LAST_KNOWN_STATUS	RESEARCH_USE	ALLELES	ALLELE_RGD_IDS	RGSC_3.4_CHR	RGSC_3.4_START_POS	RGSC_3.4_STOP_POS	RGSC_3.4_METHOD	RNOR_5.0_CHR	RNOR_5.0_START_POS	RNOR_5.0_STOP_POS	RNOR_5.0_METHOD	RNOR_6.0_CHR	RNOR_6.0_START_POS	RNOR_6.0_STOP_POS	RNOR_6.0_METHOD	MRATBN_7.2_CHR	MRATBN_7.2_START_POS	MRATBN_7.2_STOP_POS	MRATBN_7.2_METHOD	CITATION_ID	DESCRIPTION
10000	ACI/N	A X C 9935, Irish	<a href= http://www.rrrc.us/Strain/?x=142>Rat Resource and Research Center</a>	<a href= http://www.rrrc.us/Strain/?x=142>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery	spontaneous tumors; chronic renal disease; congenital malformations	Tnfrsf1a	621237																	RRID:RRRC_00142	Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR)
10001	AVN/Orl		Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France.		inbred	Unknown																				RRID:RGD_10001	
10002	BBDP/Rhw				inbred	Unknown																				RRID:RGD_10002	S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle.
10003	BBDR/Rhw		R. H. William Laboratory, University of Washington, Seattle, Washington		inbred	Unknown																				RRID:RGD_10003	S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle.
10004	BC/CpbU		Central Laboratory Animal Institute of Utrecht University, The Netherlands.		inbred	Unknown																				RRID:RGD_10004	Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands.
10005	BDIX/Han				inbred	Unknown																				RRID:RGD_10005	unknown
10006	BDVII/Cub		Charles University, Department of Biology, Prague, 		inbred	Unknown																				RRID:RGD_10006	Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype.
10008	BN/SsNHsd			Harlan	inbred	Unknown																				RRID:RGD_10008	Obtained by HSD from nucleus colony at NIH
10009	BP/Cub		Charles University, Department of Biology, Prague, 		inbred	Unknown																				RRID:RGD_10009	
10010	BUF/Pit	Buffalo			inbred	Unknown																				RRID:RGD_10010	
10011	COP/OlaHsd			Harlan	inbred	Unknown																				RRID:RGD_10011	These are derived from the original colony which was developed by Dr. W.F. Dunning.
10012	DA/PitN				inbred	Extinct																				RRID:RRRC_00154	Unknown
10013	DON/Melb				inbred	Unknown																				RRID:RGD_10013	
10014	F344/Pit				inbred	Unknown																				RRID:RGD_10014	
10015	FHH/Eur		Erasmus University-Rotterdam		inbred	Unknown																				RRID:RGD_10015	An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.
10016	GH/Omr	Genetically Hypertensive	University of Otago Wellcome Med. Res. Inst, New Zealand.		inbred	Unknown																				RRID:RGD_10016	This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations.
10017	GK/KyoSwe	Goto Kakizaki	Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden		inbred	Unknown																				RRID:RGD_10017	Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975).
10018	IS/Kyo	ishibashi rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=5 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=5 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Osteosis																			RRID:RGD_10018	Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978.
10019	LE/Mol	Long Evans	M & B A/S, Denmark.		inbred	Unknown																				RRID:RGD_10019	
10020	LEW/Pit	Lewis			inbred	Unknown																				RRID:RGD_10020	
10021	LH/Mav		Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France		inbred	Unknown																				RRID:RGD_10021	In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).
10022	LN/Mav		Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France		inbred	Unknown																				RRID:RGD_10022	In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).
10023	LOU/CHan	Louvain			inbred	Unknown																				RRID:RGD_10023	unknown
10024	M520/N		NIH Animal Genetic Resource	<a href=http://www.rrrc.us/Strain/?x=168>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo																				RRID:RRRC_00168	To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49.
10025	MHS/Gib	Milan Hypertensive Strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		inbred	Unknown																				RRID:RGD_10025	Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure
10026	MNR/N	Maudsely non-reactive	NIH Animal Genetic Resource		inbred	Extinct																				RRID:RRRC_00174	To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.
10027	MNRA/N		NIH Animal Genetic Resource		inbred	Unknown																				RRID:RGD_10027	To Harrington in 1965 at F25 (Harrington 1981).
10028	MNS/Gib	Milan Normotensive Strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		inbred	Unknown																				RRID:RGD_10028	Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.
10029	MR/Pit				inbred	Unknown																				RRID:RGD_10029	As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).
10030	NEDH/K		Central Institute for Diabetes, Karlsburg, Germany.		inbred	Unknown																				RRID:RGD_10030	Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.
10031	NP9				inbred	Unknown																				RRID:RGD_10031	From Wistar
10032	ODU/N	Osaka Dental University	NIH Animal Genetic Resource		inbred	Extinct																				RRID:RRRC_00176	From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982).
10033	OKA/Wsl		Professor Herve Bazin, Universite de Louvain, France		inbred	Unknown																				RRID:RGD_10033	
10034	OM/Ztm	Osborne-Mendel			inbred	Unknown																				RRID:RGD_10034	unknown
10035	P5C				inbred	Unknown																				RRID:RGD_10035	
10036	PVG/Pit				inbred	Unknown																				RRID:RGD_10036	
10037	SD/Rij			Harlan Rijswijk	inbred	Unknown																				RRID:RGD_10037	From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984).
10038	SHR/OlaHsd	Spontaneously Hypertensive Rat		Harlan Sprague Dawley, Inc.	inbred	Unknown																				RRID:RGD_10038	
10039	SHRSP/Riv	Spontaneously Hypertensive Rat, Stroke Prone			inbred	Unknown																				RRID:RGD_10039	
10040	SR/Jr	Salt Resistant	Dr. John P. Rapp, Medical College of Ohio, USA	<a href=http://www.rrrc.us/Strain/?x=56>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00056	Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b).
10041	SS/Jr	Salt Sensitive	Dr. John P. Rapp, Medical College of Ohio, USA	<a href=http://www.rrrc.us/Strain/?x=55>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm		Hmox1	2806																	RRID:RRRC_00055	Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982)
10042	WAG/RijKyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=14 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=14 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_10042	Rij > Kyo (1979, F?, GF)
10043	WF/Pit	Wistar Furth			inbred	Unknown																				RRID:RGD_10043	
10044	WIST/Nhg	Wistar	Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany.		inbred	Unknown		Ugt1a1|Abcd2	3935|69244																	RRID:RGD_10044	From outbred Wistar stock in 1967.
10045	WN/N	Inbred Wistar; W/N	NIH Animal Genetic Resource		inbred	Unknown																				RRID:RGD_10045	Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15.
10046	WKY/OlaHsd			Harlan Sprague Dawley, Inc.	inbred	Unknown																				RRID:RGD_10046	
10047	WTC/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=18 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=18 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)																				RRID:RGD_10047	WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015).
60984	GH				inbred	Unknown																				RRID:RGD_60984	University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973).
60985	BN	BN	<a href=http://www.criver.com/index.html>Charles River Laboratories</a>	<a href=http://www.criver.com/index.html>Charles River Laboratories</a>	inbred	Unknown		Cd36|Tnfrsf1a	2301|621237																	RRID:RGD_60985	Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b).
60986	BUF/N		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Extinct																				RRID:RGD_60986	Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.
60987	MHS/N	Milan Hypertensive Strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		inbred	Extinct		Add1|Add2	2041|2042																	RRID:RRRC_00169	Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).
60988	LOU/M				inbred	Unknown																				RRID:RGD_60988	Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978).
60989	BP				inbred	Unknown																				RRID:RGD_60989	Strain selected for resistance to Walker 256 tumour.
60990	LH/MavRrrc	Lyon Hypertensive	<a href=http://www.rrrc.us/Strain/?x=57>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=57>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13)																				RRID:RRRC_00057	Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).
60991	LE	Long Evans			inbred	Unknown																				RRID:RGD_60991	Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984).
60992	MNS	Milan normotensive strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		inbred	Unknown																				RRID:RGD_60992	Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974).
60993	FHH	Fawn Hooded Hypertensive	University of Colorado Health Science Center, Denver, Colorado		inbred	Unknown																				RRID:RGD_60993	An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.
60994	F344	Fischer	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_60994	Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.
60995	DRY		Sankyo Co., Ltd., Tokyo, Japan		inbred	Unknown																				RRID:RGD_60995	Recombinant inbred strain used as normotensive control in studies of hypertension.
60996	DON	Donryu rat			inbred	Unknown																				RRID:RGD_60996	R. Sato 1950 by inbreeding Japanese albino rats.
60997	DA	DA			inbred	Unknown		Ednrb|Tnfrsf1a	2536|621237																	RRID:RGD_60997	Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case.
60998	COP				inbred	Unknown																				RRID:RGD_60998	This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research.
60999	LEW	Lewis		Harlan Sprague Dawley Inc. Indianapolis, United States	inbred	Unknown		Fgf2|Tnfrsf1a	2609|621237																	RRID:RGD_60999	Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992)
61000	SHR	Spontaneously Hypertensive Rat			inbred	Unknown		Agtr1b|Cd36|Ephx2	2071|2301|620732																	RRID:RGD_61000	Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648).
61001	NEDH				inbred	Unknown																				RRID:RGD_61001	Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.
61002	BDIX				inbred	Unknown																				RRID:RGD_61002	Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
61003	BC				inbred	Unknown																				RRID:RGD_61003	Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973.
61004	WIST/Zihk				inbred	Unknown																				RRID:RGD_61004	From Wistar outbred stock in 1978.
61005	OM/N	Osborne-Mendel	NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_61005	Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).
61006	PVG	PVG			inbred	Unknown																				RRID:RGD_61006	Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).
61007	WF	Wistar Furth			inbred	Unknown																				RRID:RGD_61007	J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995).
61008	WAG	Wistar Albino Glaxo			inbred	Unknown																				RRID:RGD_61008	AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984).
61009	AVN				inbred	Unknown																				RRID:RGD_61009	 Unknown. Keil University from O Stark, Charles University, Prague.
61010	SHRSP	Spontaneously Hypertensive Rat, Stroke Prone	Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch		inbred	Unknown																				RRID:RGD_61010	The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994).
61011	BB/N	BioBreeding rat			inbred	Extinct																				RRID:RRRC_00144	Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).
61013	E3				inbred	Unknown																				RRID:RGD_61013	Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968.
61014	OLETF	Otsuka Long-Evans Tokushima fatty	Otsuka Research Institute, Tokushima, Japan		inbred	Unknown																				RRID:RGD_61014	Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence'
61015	LN/MavRrrc	lyon normotensive	<a href=http://www.rrrc.us/Strain/?x=58>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=58>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00058	(taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).
61096	SHR/NCruk	Spontaneously Hypertensive Rat	<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UK	<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UK	inbred	Unknown																				RRID:RGD_61096	NIH derived strain maintained at the Charles River, United Kingdom.
61097	WKY/NCruk		<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UK	<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UK	inbred	Unknown																				RRID:RGD_61097	NIH derived strain maintained at the Charles River, United Kingdom.
61098	BXH/Ipcv		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_61098	These recombinant inbred strains are derived from the (BN-<i>Lx</i>/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic
61099	HXB/Ipcv		Institute of Physiology, Czech Academy of Sciences, Charles University, Prague		recombinant_inbred	Unknown																				RRID:RGD_61099	Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published.
61100	SHR/Ola		Czech Academy of Sciences, Prague, Czech Republic		inbred	Unknown																				RRID:RGD_61100	Strain originated from an inbred SHR strain from Harlan UK Ltd.
61103	WKY		Medical College of Ohio, Toledo, Ohio		inbred	Unknown		Cd36|Nos3	2301|3186																	RRID:RGD_61103	This strain was maintained at Medical College of Ohio, Toledo, Ohio
61104	LEW/NCrl		<a href=http://www.geneticmodels.com/RM/rats/rats_a_c.html>Charles River Laboratories USA </a>	<a href=http://www.geneticmodels.com/RM/rats/rats_a_c.html>Charles River Laboratories USA </a>	inbred	Unknown																				RRID:RGD_61104	Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34.
61105	WKY/NHsd		<a href =https://www.envigo.com/model/wky-nhsd?selctry=U.S.&ctry=/> Envigo</a	<a href =https://www.envigo.com/model/wky-nhsd?selctry=U.S.&ctry=/> Envigo</a	inbred	Unknown																				RRID:RGD_61105	Derived from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. and maintained at Harlan Indianapolis, Indiana U.S.A.
61106	SHR.BN-(<i>D8Mit5-D8Mgh6</i>)/Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				8	32203394	64762616	1 - by flanking markers	8	33603024	65467051	1 - by flanking markers	8	33558660	65717592	1 - by flanking markers	8	30848154	61290444	1 - by flanking markers	RRID:RGD_61106	A segment of chr. 8 is transferred from the normotensive BN-<i>Lx</i>/Cub rat to the SHR/Ola.
61107	BB/OK	BioBreeding rat	Central Institute for Diabetes, Karlsburg, Germany	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=512> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Sperm	Diabetes Obesity; Immunology	Asns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk5	2162|2280|2332|2481|2794|3082|3726|3807|69430|70514																	RRID:RGD_61107	This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada.
61109	F344/NHsd	F344/NHsd	<a href =http://www.envigo.com/model/f344-nhsd/>Envigo</a>, <a href =http://www.envigo.com/model/f344-nhsd-aged/>Envigo aged</a>	<a href =http://www.envigo.com/model/f344-nhsd/>Envigo</a>, <a href =http://www.envigo.com/model/f344-nhsd-aged/>Envigo aged</a>	inbred	Unknown																				RRID:RGD_61109	Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.
61110	SHR/Mol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_61110	Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes.
61111	DA/Slc	dark agouti	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=380 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=380 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_61111	These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983.
61112	13M		Laboratory of Human Behavior and Metabolism, Rockefeller University		inbred	Unknown																				RRID:RGD_61112	This is a Leprfa/Leprfa substrain derived from the Zucker rat.
61113	BN-<I>Lx</I>				mutant	Unknown																				RRID:RGD_61113	These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.
61114	DA/Bkl		Bantin and Kingman, Fremont, California		inbred	Unknown																				RRID:RGD_61114	Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls.
61115	BN/SsN		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_61115	To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.
61116	SHRSP/A3		Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan		inbred	Unknown																				RRID:RGD_61116	Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness.
61117	BN-<i>Lx</i>/Cub	Brown Norway with polydactyly-luxate	Charles University, Department of Biology, Prague		inbred	Unknown																				RRID:RGD_61117	These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background.
61118	BUF/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=458 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=458 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Cancer; Urology	Bsis	2221																	RRID:RGD_61118	Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.
61119	WKY/NCrlCrlj			Charles River Laboratories Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=477> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo (as of 2023-05-30)																				RRID:RGD_61119	Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR strain.
61498	BN/NHsdMcwi		PhysGen	<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Program at <a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>	inbred	Live Animals; Cryorecovery																				RRID:RGD_61498	Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115)
61499	SS/JrHsdMcwi		PhysGen	<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>	inbred	Live Animals; Cryorecovery																				RRID:RGD_61499	Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115).
61517	FHL/Eur	Fawn Hooded Low blood pressure	Erasmus University-Rotterdam		inbred	Unknown																				RRID:RGD_61517	An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage
67934	WOKA				inbred	Unknown																				RRID:RGD_67934	Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.
67935	WOKW		Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany		inbred	Unknown																				RRID:RGD_67935	Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.
67936	WR				inbred	Unknown																				RRID:RGD_67936	 Sykora, Rosice (Stark et al 1968b). No further infromation.
67937	WST				inbred	Unknown																				RRID:RGD_67937	 Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986).
67938	Y59				inbred	Unknown																				RRID:RGD_67938	 Strain developed in Zagreb, Jugoslavia.
67939	YA/N				inbred	Extinct																				RRID:RRRC_00191	No further information.
67940	YO				inbred	Unknown																				RRID:RGD_67940	 Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992)
67941	Z61				inbred	Unknown																				RRID:RGD_67941	Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours.
67942	ZI				inbred	Unknown																				RRID:RGD_67942	 A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989).
67943	SHE/N-cp				inbred	Unknown																				RRID:RGD_67943	Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94.
67945	IS				inbred	Unknown																				RRID:RGD_67945	from a cross between a wild male and a Wistar female, with sib mating since 1968.
67948	JC				inbred	Unknown																				RRID:RGD_67948	 LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984).
67957	APR				inbred	Unknown																				RRID:RGD_67957	Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).
67958	AS	Albino Surgery	National Institute for Medical Research, Mill Hill, UK		inbred	Unknown																				RRID:RGD_67958	University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973).
67959	AS2				inbred	Unknown																				RRID:RGD_67959	Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968).
67960	AUG				inbred	Unknown																				RRID:RGD_67960	Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England.
67962	AN				inbred	Unknown																				RRID:RGD_67962	Outbred Wistar Imamichi strain.
67965	AXC				recombinant_inbred	Unknown																				RRID:RGD_67965	 A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976.
67966	B				inbred	Unknown																				RRID:RGD_67966	 Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85.
67967	B/1N				inbred	Extinct																				RRID:RGD_67967	No further information.
67971	BBZ				inbred	Unknown																				RRID:RGD_67971	Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3
67974	BDE				inbred	Unknown																				RRID:RGD_67974	Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring.
67975	BDI				inbred	Unknown																				RRID:RGD_67975	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67976	BDII				inbred	Unknown																				RRID:RGD_67976	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67977	BDIII				inbred	Unknown																				RRID:RGD_67977	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67978	BDIV				inbred	Unknown																				RRID:RGD_67978	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67981	BDV				inbred	Unknown																				RRID:RGD_67981	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67983	BDVI				inbred	Unknown																				RRID:RGD_67983	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67984	BDVII				inbred	Unknown																				RRID:RGD_67984	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976)
67986	BDVIII				inbred	Unknown																				RRID:RGD_67986	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67987	BDX				inbred	Unknown		Lypd3	69053																	RRID:RGD_67987	Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.
67988	BEG				inbred	Unknown																				RRID:RGD_67988	from a cross between SC and TE.
67989	BH				inbred	Unknown																				RRID:RGD_67989	 D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973.
67990	BI				inbred	Unknown																				RRID:RGD_67990	 Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992)
67991	BIL/1		NIH Autoimmune Rat Model Repository		inbred	Unknown																				RRID:RGD_67991	University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.
67993	BIL/2		NIH Autoimmune Rat Model Repository		inbred	Unknown																				RRID:RGD_67993	University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.
68000	BIRMB				inbred	Unknown																				RRID:RGD_68000	same as BIRMA.
68001	BLK/N				inbred	Extinct		Asip	2003																	RRID:RGD_68001	This strain has an agouti mutation
68007	BROFO				inbred	Unknown																				RRID:RGD_68007	 Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions.
68008	BS				inbred	Unknown																				RRID:RGD_68008	 University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966).
68011	C				inbred	Unknown																				RRID:RGD_68011	No further information.
68012	CAP				inbred	Unknown																				RRID:RGD_68012	 Polish Academy of Sciences, Krakow (Stark et al 1968a).
68013	CAR/N	Hunt-Hoppert caries resistant; CA/R	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_68013	Hunt 1937, developed for resistance to dental caries (Hunt et al 1955).
68014	CAS				inbred	Unknown																				RRID:RGD_68014	Hunt 1937, developed for high incidence of dental caries.
68015	CBH				inbred	Unknown																				RRID:RGD_68015	Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded).
68018	CPB-WE				inbred	Unknown																				RRID:RGD_68018	Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands.
68019	CRDH	Cohen Rosenthal Diabetic Hypertensive	Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		inbred	Unknown																				RRID:RGD_68019	 As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995).
68020	CWS				inbred	Unknown																				RRID:RGD_68020	R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open.
68022	DB				inbred	Unknown																				RRID:RGD_68022	No further information.
68023	DEBR	Dundee experimental bald rat			inbred	Unknown																				RRID:RGD_68023	The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains.
68026	DSS/1N				inbred	Extinct																				RRID:RRRC_00155	Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).
68027	DSS/2N				inbred	Extinct																				RRID:RRRC_00156	Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).
68028	DSS/3N				inbred	Extinct																				RRID:RRRC_00157	Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).
68029	DXE-1				recombinant_inbred	Unknown																				RRID:RGD_68029	Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover)
68031	ET		Taisho Pharmaceutical Co. Ltd		inbred	Unknown																				RRID:RGD_68031	 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).
68032	EXBH				inbred	Unknown																				RRID:RGD_68032	Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990)
68034	F6R				inbred	Unknown																				RRID:RGD_68034	Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985).
68035	FCH				inbred	Unknown																				RRID:RGD_68035	Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol.
68036	FH				inbred	Unknown		Rab38<sup>ru</sup>	1600311																	RRID:RGD_68036	 Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics.
68038	FHL				inbred	Unknown																				RRID:RGD_68038	see FHH.
68040	FNL				inbred	Unknown																				RRID:RGD_68040	Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH).
68041	G				inbred	Unknown																				RRID:RGD_68041	 Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977)
68042	GEPR				inbred	Unknown																				RRID:RGD_68042	Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a).
68044	GHA				inbred	Unknown																				RRID:RGD_68044	 The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973).
68046	HCS				inbred	Unknown																				RRID:RGD_68046	Harvard to Liverpool, UK in 1960.
68047	HMT				inbred	Unknown																				RRID:RGD_68047	Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor".
68048	HS				inbred	Unknown																				RRID:RGD_68048	 Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus.
68049	HXB-1-43/Ipcv		Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands		recombinant_inbred	Unknown																				RRID:RGD_68049	Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs.
68050	IIM				inbred	Unknown																				RRID:RGD_68050	Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study.
68051	INR/N				inbred	Extinct																				RRID:RRRC_00160	Harrington 1962 from a stock selected by CS Hall for low open field defaecation.
68052	IR				inbred	Unknown																				RRID:RGD_68052	Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981).
68057	K				inbred	Unknown																				RRID:RGD_68057	 Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973).
68058	KGH/PitN				inbred	Extinct																				RRID:RRRC_00162	Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).
68059	KIRBY-B				inbred	Unknown																				RRID:RGD_68059	 From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980).
68060	KX				inbred	Unknown																				RRID:RGD_68060	 developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977)
68061	KYN/Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=69 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=69 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_68061	Makino, Hokkaido University 1960 from stock the carrying the
68062	LA/N		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_68062	from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).
68063	LA/N-<i>cp</i>		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_68063	The corpulent (LA/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis.
68065	LEA				inbred	Unknown																				RRID:RGD_68065	 Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993)
68066	LEC				inbred	Unknown																				RRID:RGD_68066	In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975.
68067	LEJ/Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=72 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=72 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_68067	Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication).
68068	LEM				inbred	Unknown		Ckb	2357																	RRID:RGD_68068	 Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980).
68069	LEO				inbred	Unknown																				RRID:RGD_68069	 from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).
68070	LEP				inbred	Unknown																				RRID:RGD_68070	 Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)
68071	LER/N				inbred	Extinct																				RRID:RRRC_00164	Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.
68072	LET				inbred	Unknown																				RRID:RGD_68072	 from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1
68073	LETL				inbred	Unknown																				RRID:RGD_68073	 A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan
68074	LETO				inbred	Unknown																				RRID:RGD_68074	THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome.
68077	LL/MavRrrc	Lyon hypotensive	<a href=http://www.rrrc.us/Strain/?x=59>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=59>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00059	Lyon Low-Tensive. See LH
68079	LOU		Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France		inbred	Unknown																				RRID:RGD_68079	 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).
68082	LUDW				inbred	Unknown																				RRID:RGD_68082	Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU.
68083	LXB				recombinant_inbred	Unknown																				RRID:RGD_68083	 Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover)
68084	M14				inbred	Unknown																				RRID:RGD_68084	 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum.
68085	M17				inbred	Unknown																				RRID:RGD_68085	AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum.
68086	M520				inbred	Unknown																				RRID:RGD_68086	Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992).
68087	MAXX				inbred	Unknown																				RRID:RGD_68087	From a cross of BNxLEW with subsequent inbreeding.
68088	MF				inbred	Unknown																				RRID:RGD_68088	Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).
68091	MLCS	Milan low-calpastatin strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		recombinant_inbred	Unknown																				RRID:RGD_68091	From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity.
68097	MSUBL				inbred	Unknown																				RRID:RGD_68097	 Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977).
68098	MW	Munich Wistar			inbred	Unknown																				RRID:RGD_68098	Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS.
68099	MWF				inbred	Unknown																				RRID:RGD_68099	From outbred Wistar rats selected for large numbers of superficial glomeruli.
68100	NBL				inbred	Unknown																				RRID:RGD_68100	 Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990).
68103	NER	noda epileptic rat			inbred	Unknown																				RRID:RGD_68103	From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has.
68104	NIG-III/Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=73 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=73 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_68104	From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987).
68106	NSD/N		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_68106	NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.
68107	NZR				inbred	Unknown																				RRID:RGD_68107	Subline of AS2 separated at F32.
68109	ODUS				inbred	Unknown																				RRID:RGD_68109	As for ODU, but maintained at Osaka Dental University.
68113	OXYR/Nov		Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia		inbred	Unknown																				RRID:RGD_68113	Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain.
68114	OXYS/Nov		Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia		inbred	Unknown																				RRID:RGD_68114	Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats.
68115	P77PMC				inbred	Unknown																				RRID:RGD_68115	Wistar rats from Beijing Medical College in 1977.
68116	PA				inbred	Unknown																				RRID:RGD_68116	 King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction.
68117	PETH/N	Royal College of Surgeons, RCS	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_68117	 Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS.
68118	PKD	PKD	Central Institute for Laboratory Animal Breeding, Hanover, Germany		inbred	Unknown																				RRID:RGD_68118	Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991.
68119	PSDO/N				inbred	Extinct																				RRID:RRRC_00178	Reserved symbol for strain in development now at F6 (NIH 1989).
68121	R				inbred	Unknown																				RRID:RGD_68121	Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R.
68122	RCS/N				inbred	Extinct																				RRID:RRRC_00180	Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.
68123	RHA/N	Roman high avoidance	NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_68123	Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.
68124	RII/1				inbred	Unknown																				RRID:RGD_68124	 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991).
68125	RII/2				inbred	Unknown																				RRID:RGD_68125	 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991).
68126	RLA/N				inbred	Unknown																				RRID:RGD_68126	Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains.
68127	RP/AEurRij				inbred	Unknown																				RRID:RGD_68127	Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991).
68128	S5B				inbred	Unknown																				RRID:RGD_68128	 Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating.
68129	SBH	Sabra hypertensive	Barzilai Medical Center, Ashkelon, Israel		inbred	Unknown																				RRID:RGD_68129	Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics).
68130	SBN				inbred	Unknown																				RRID:RGD_68130	 As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984).
68131	SC				inbred	Unknown																				RRID:RGD_68131	 Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360)
68133	SDJ/Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=74 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=74 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm		Slc2a2	3705																	RRID:RGD_68133	Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966.
68134	SDNK				inbred	Unknown																				RRID:RGD_68134	Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan.
68136	SEL				inbred	Unknown																				RRID:RGD_68136	Dunning 1948. Probably extinct.
68137	SHHF				inbred	Unknown		Grk2|Grk3	2062|2063																	RRID:RGD_68137	 JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile.
68140	SPRD/Hsd		Harlan	Harlan	outbred	Unknown																				RRID:RGD_68140	Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony.
68143	TA				inbred	Unknown																				RRID:RGD_68143	Outbred Wistar Imamichi.
68144	TE				inbred	Unknown																				RRID:RGD_68144	Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987).
68145	TF				inbred	Unknown																				RRID:RGD_68145	From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988).
68146	THA				inbred	Unknown																				RRID:RGD_68146	 Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990).
68147	THE/Utp	Tsukuba high-emotional rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=516 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=516 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Behavior																			RRID:RGD_68147	Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE).
68148	TLE/Utp	Tsukuba low-emotional rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=515 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=515 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Behavior																			RRID:RGD_68148	Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE).
68149	TM	Tester Moriyama rat	Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan		inbred	Unknown																				RRID:RGD_68149	 Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication).
68150	TMB				inbred	Unknown																				RRID:RGD_68150	 PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).
68151	TMD				inbred	Unknown																				RRID:RGD_68151	 PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).
68152	TO/Hok	Tokyo rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=75 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=75 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_68152	A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994).
68154	TOM				inbred	Unknown																				RRID:RGD_68154	 Toma Institute, Japan (Ikadai, personal communication, 1991)
68155	TS				inbred	Unknown																				RRID:RGD_68155	 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).
68156	TS1				inbred	Unknown																				RRID:RGD_68156	 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).
68157	TS3/N				inbred	Extinct																				RRID:RRRC_00185	Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).
68158	TT				inbred	Unknown																				RRID:RGD_68158	 outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991).
68160	TU				inbred	Unknown																				RRID:RGD_68160	 From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991)
68161	TW				inbred	Unknown																				RRID:RGD_68161	 Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985).
68162	TX				inbred	Unknown																				RRID:RGD_68162	 From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991)
68163	U				inbred	Unknown																				RRID:RGD_68163	 Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990).
68164	UChA		University of Chile, Casilla, Chile		inbred	Unknown																				RRID:RGD_68164	 Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.
68165	UChB		University of Chile, Casilla, Chile		inbred	Unknown																				RRID:RGD_68165	 Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.
68166	W/Hok				inbred	Unknown																				RRID:RGD_68166	 Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977).
68167	W/Nhg				inbred	Unknown																				RRID:RGD_68167	 Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany.
68168	WA				inbred	Unknown																				RRID:RGD_68168	 St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983.
68169	WAB				inbred	Unknown																				RRID:RGD_68169	 Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977).
68171	WBB/1N				inbred	Extinct																				RRID:RRRC_00186	No further information
68172	WBB/2N				inbred	Extinct																				RRID:RRRC_00187	No further information.
68173	WBN				inbred	Unknown																				RRID:RGD_68173	 Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived.
68174	WCF				inbred	Unknown																				RRID:RGD_68174	 R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot.
68175	WDF				inbred	Unknown																				RRID:RGD_68175	Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus.
68176	WEC				inbred	Unknown																				RRID:RGD_68176	 Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).
68177	WEK				inbred	Unknown																				RRID:RGD_68177	 Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).
68178	WELS				inbred	Unknown																				RRID:RGD_68178	Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984)
68180	WIN				inbred	Unknown																				RRID:RGD_68180	WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986).
68183	WKA				inbred	Unknown																				RRID:RGD_68183	 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992)
68184	WKAH/Hok	Wistar-King Aptekman Hokkaido	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=76 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=76 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo																				RRID:RGD_68184	King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA.
68185	WKAM				inbred	Unknown																				RRID:RGD_68185	 King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA.
68186	WKHA/N				inbred	Extinct																				RRID:RRRC_00188	From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.
68187	WKHT/N				inbred	Extinct																				RRID:RRRC_00189	From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).
68188	WKS				inbred	Unknown																				RRID:RGD_68188	 National Institute of Genetics, Mishima, Japan.
68189	HTX/Hcj		Department of Pharmacology, University of Florida, Gainesville.		inbred	Unknown																				RRID:RGD_68189	D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30.
69369	SS		Brookhaven National Laboratories, Upton, New York		inbred	Unknown																				RRID:RGD_69369	From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension.
69638	BN/Ka	Brown Norway Katholiek (kininogen or kinin deficient)	Kitasato University, Kanagawa, Japan.		inbred	Unknown																				RRID:RGD_69638	Kitasato University, Kanagawa, Japan.
69643	F344/DuCrlCrlj		<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=537> National BioResource Project for the Rat in Japan</a>	<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=537> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Neurobiology; Cardio Hypertension																			RRID:RGD_69643	This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976.
70410	AA	Alko, Alcohol	Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland		inbred	Unknown																				RRID:RGD_70410	Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure.
70411	ANA	Alko, Non-Alcohol	Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland		inbred	Unknown																				RRID:RGD_70411	Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure.
70413	WBB				inbred	Unknown																				RRID:RGD_70413	
70416	ACH				inbred	Unknown																				RRID:RGD_70416	Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research.
70417	A28807/N		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RRRC_00141	Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982).
70418	A35322				inbred	Unknown																				RRID:RGD_70418	Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990.
70419	A7322				inbred	Unknown																				RRID:RGD_70419	Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus.
70420	A990				inbred	Unknown																				RRID:RGD_70420	Curtiss 1921 at Columbia University Institute for Cancer Research.
70421	AAW				inbred	Unknown																				RRID:RGD_70421	Atomic Energy Commission, Melbourne (Adams et al 1984).
70422	ABH		Nishimura, Hammatsu University School of Medicine, Japan.		inbred	Unknown																				RRID:RGD_70422	Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan.
70423	ACP				inbred	Unknown																				RRID:RGD_70423	Dunning to National Cancer Institute 1967 at F54.
70424	AGA				inbred	Unknown																				RRID:RGD_70424	Nakic, Zagreb (Stark et al 1968b). Used for immunological studies.
70425	AGUS				inbred	Unknown																				RRID:RGD_70425	Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26.
70426	ALB/N	Albany	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_70426	Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer.
70427	AM				inbred	Unknown																				RRID:RGD_70427	Torres, Rio de Janeiro, from outbred stock.
70428	AMDIL				inbred	Unknown																				RRID:RGD_70428	Torres, Rio de Janeiro, from outbred stock
70429	AO				inbred	Unknown																				RRID:RGD_70429	From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995).
70440	BIRMA				inbred	Unknown																				RRID:RGD_70440	AM Mandl 1952 from Albino rats purchased from Birmingham market.
70446	LIH/Lac	Liverpool Hooded			inbred	Unknown																				RRID:RGD_70446	"Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981).
70447	MNR	Maudsely non-reactive			inbred	Unknown																				RRID:RGD_70447	PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982).
70448	MNRA				inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)																				RRID:RRRC_00692	Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981).
70449	MR/N	Maudsely reactive	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_70449	Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).
70450	NBR				inbred	Unknown																				RRID:RGD_70450	Poiley 1966 from heterogeneous stock
70451	OKA				inbred	Unknown																				RRID:RGD_70451	From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days.
70452	OM	Osborne-Mendel	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	outbred	Unknown																				RRID:RGD_70452	Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).
70453	SR				inbred	Unknown																				RRID:RGD_70453	Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen.
70454	WKY/N		<a href=http://dvrnet.ors.od.nih.gov/ratcenter/index.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=190>Rat Resource and Research Center</a>	<a href=http://dvrnet.ors.od.nih.gov/ratcenter/index.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=190>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo (as of 2019-02-01)																				RRID:RRRC_00190	National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain.
70455	WKYO/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=17 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=17 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_70455	Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991).
70456	WM				inbred	Unknown																				RRID:RGD_70456	Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951.
70457	WMS				inbred	Unknown																				RRID:RGD_70457	Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF
70458	WN				inbred	Unknown																				RRID:RGD_70458	Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions.
70459	ZDF	Vancouver diabetic fatty Zucker	Animal Model Core Facility, University of California at Davis		inbred	Unknown																				RRID:RGD_70459	"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b).
70508	SD	Sprague-Dawley			outbred	Unknown		Aqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f1	2141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892																	RRID:RGD_70508	This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock.
70509	F344/NRrrc		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=158>Rat Resource and Research Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=158>Rat Resource and Research Center</a>	inbred	Cryopreserved Sperm		Cdkn2a|Gfap|Tnfrsf1a	2323|2679|621237																	RRID:RRRC_00158	Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.
625624	LE<i>Tsc2<sup>Eker</sup></i>/Hin		Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan		mutant	Unknown		Tsc2|Tsc2<sup>Eker</sup>	3908|12791989	10	13848210	13883189	7	10	13778990	13813725	7	10	13962006	13996684	7	10	13621135	13655773	7	RRID:RGD_625624	Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.
625659	DRH/Seac		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=111 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=111 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_625659	Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3
628372	ACI.FHH-(<i>D1Mit34-D1Rat156</i>)/Eur		Animal Research Center of the Erasmus University, Rotterdam, The Netherlands		congenic	Unknown				1	230963695	253410500	1 - by flanking markers	1	252776360	279213254	1 - by flanking markers	1	245529606	245529710	1 - by flanking markers	1	225126575	225126682	1 - by flanking markers	RRID:RGD_628372	The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI.
628486	NER/Kyo	Noda epileptic rat, GMS	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=26 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=26 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_628486	Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan.
628525	Ni/Hin		Clea Japan Inc. Shiga		inbred	Unknown																				RRID:RGD_628525	Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream
628907	SHR.BN-RT1<sup>n</sup>				congenic	Unknown																				RRID:RGD_628907	This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR.
628908	SHR.BN-(<i>D1Mit3-Igf2</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown		Igf2|Sa|Scnn1b|Scnn1g	2870|3616|3640|3641	1	146971846	202915231	1 - by flanking markers	1	162692213	222733868	1 - by flanking markers	1	156446196	215839081	1 - by flanking markers	1	144267353	197831802	1 - by flanking markers	RRID:RGD_628908	Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating.
628909	SHR.BN-(<i>D13Arb5-Ren1</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				13	25430110	64281346	1 - by flanking markers	13	14281836	72173144	1 - by flanking markers	13	9016742	67207219	1 - by flanking markers	13	5994668	62022792	1 - by flanking markers	RRID:RGD_628909	Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity.
629459	ZUC-<i>Lepr<sup>faSteJrpz-/-</sup></i>		Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA		mutant	Unknown																				RRID:RGD_629459	Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.
629462	ZUC-<I>Lepr</I><sup>faSte-/-</sup>		University of California Davis, Davis, CA		mutant	Unknown		Lepr<sup>fa</sup>	13432153	5	122320075	122503449	7	5	124380327	124556585	7	5	120597857	120597857	8	5	116389200	116389200	8	RRID:RRRC_00839	This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.
629463	ZUC-<I>Lepr</I><sup>+Ste</sup>		University of California Davis, Davis, CA		mutant	Unknown		Lepr	3001	5	122320075	122503449	7	5	124380327	124556585	7	5	120503475	120682281	7	5	116294409	116477904	7	RRID:RGD_629463	This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype.
629464	ZUC-<I>Lepr</I><sup>fa</sup>				mutant	Unknown		Lepr<sup>fa</sup>	13432153	5	122320075	122503449	7	5	124380327	124556585	7	5	120597857	120597857	8	5	116389200	116389200	8	RRID:RGD_629464	This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions.
629465	SHR/NCrlCrlj		Charles River Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=478> National BioResource Project for the Rat in Japan</a>	Charles River Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=478> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_629465	NIH derived strain maintained at the Charles River, Japan.
629481	SHR.WKY-(<i>D1Wox33-D1Got194</i>)		Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, France		congenic	Unknown				1;2	160754901;198300754	208638156;198300855	1 - by flanking markers;1 - by flanking markers	1;2	174300636;224991853	228298222;224991955	1 - by flanking markers;1 - by flanking markers	1	221363524	221363653	1 - by flanking markers	1	203293397	203293528	1 - by flanking markers	RRID:RGD_629481	This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background.
629482	WKY.SHR-(<i>D1Wox19-D1Mit2</i>)/Njs		University of Leicester, Leicester, UK		congenic	Unknown				1	134980526	185691036	1 - by flanking markers	1	204942418	204942572	1 - by flanking markers	1	197963658	197963812	1 - by flanking markers	1	181133855	181134010	1 - by flanking markers	RRID:RGD_629482	Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY
629484	LEW-<i>tl</i>		Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD		congenic	Unknown		Csf1|Csf1<sup>tl</sup>	621063|12910954																	RRID:RGD_629484	The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N.
629485	LE/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=265 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=265 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_629485	The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.
629486	PVG/OlaHsd			<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/pvg-inbred-rat/> Envigo</a>	inbred	Cryorecovery																				RRID:RGD_629486	black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992
629487	SHR.WKY-(<i>D1Wox19-D1Wox34</i>)/Njs		University of Leicester, Leicester, UK		congenic	Unknown				1	168382195	185691036	1 - by flanking markers	1	182435050	204942572	1 - by flanking markers	1	175447029	197963812	1 - by flanking markers	1	164747424	181134010	1 - by flanking markers	RRID:RGD_629487	Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR
629488	SI-Tg(Ednrb)Ywa	transgenic spotting lethal	University of Texas Southwestern Medical Center, Dallas, Texas		transgenic	Unknown		Ednrb|Ednrb<sup>sl</sup>	2536|10755424																	RRID:RGD_629488	A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals.
629489	Eker-Tg(Tsc2)5Hin		Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan		transgenic	Unknown		Tsc2	3908																	RRID:RGD_629489	Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.
629490	DA.F344-Aia1/1		National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland		congenic	Unknown				20	2790511	32560683	1 - by flanking markers	20	5249981	36993999	1 - by flanking markers	20	3151815	3172069	1 - by flanking markers	20	2646395	2666654	1 - by flanking markers	RRID:RGD_629490	genomic segments with region of interest from chr 20 were inserted to DA strain
629491	DA.F344-Aia1/2		National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland		congenic	Unknown				4	36592628	85014222	1 - by flanking markers	4	37534124	151090861	1 - by flanking markers	4	37685175	86438507	1 - by flanking markers	4	39505275	85379614	1 - by flanking markers	RRID:RGD_629491	genomic segments with region of interest from chr 4 were inserted to DA strain
629492	Sl		Institute of Animal Reproduction, Omiya, Japan		inbred	Unknown		Ednrb|Ednrb<sup>sl</sup>	2536|10755424	15	87893141	87898700	7	15	91500400	91531979	7	15	88034987	88035287	8	15	80670748	80671048	8	RRID:RGD_629492	Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat.
629493	DA.F344-Aia1/3		National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland		congenic	Unknown				4	54879077	54879214	1 - by flanking markers	4	55118586	55118722	1 - by flanking markers	4	55375865	55376001	1 - by flanking markers	4	56698790	56698927	1 - by flanking markers	RRID:RGD_629493	genomic segments with region of interest from chr 4 were inserted to DA strain
629494	DA.F344-Aia1/4		National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland		congenic	Unknown				10	24006429	24006612	1 - by flanking markers	10	24340447	107484761	1 - by flanking markers	10	24483076	107857673	1 - by flanking markers	10	23444813	104060283	1 - by flanking markers	RRID:RGD_629494	genomic segments with region of interest from chr 10 were inserted to DA strain
629495	WKY.SHRSP-(<i>Mt1pa-D1Rat57</i>)/Bbb		Freie Universitdt Berlin, Berlin, Germany		congenic	Unknown		Mt1-ps1	3118	1	177313819	185690396	1 - by flanking markers	1	195736433	204941832	1 - by flanking markers	1	188794419	197963072	1 - by flanking markers	1	173421600	181133270	1 - by flanking markers	RRID:RGD_629495	Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY
629499	BXS/Ipcv		Czechoslovak Academy of Sciences, Prague		recombinant_inbred	Unknown																				RRID:RGD_629499	These recombinant inbred strains are obtained by crossing normotensive BN-<i>Lx</i>/Cub with hypertensive SHR/Ola progenitor strains.
629500	LEXF/Stm		Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan		recombinant_inbred	Unknown																				RRID:RGD_629500	Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating.
629501	SD-Tg(Ren2)27		Center for Genome Research, University of Edinburgh, UK		transgenic	Unknown		Agtr1b|Ace	2071|2493																	RRID:RGD_629501	This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background.
629502	SHR.BN-(<i>Il6-Npy</i>)		MRC Clinical Centre, London, UK		congenic	Unknown		Il6|Npy	2901|3197	4	456799	78045187	1 - by flanking markers	4	3095536	144240956	1 - by flanking markers	4	3043231	79565059	1 - by flanking markers	4	5214602	78888495	1 - by flanking markers	RRID:RGD_629502	This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes
629503	SHR.BN-(<i>D19Rat57-D19Mit7</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown		Agt	2069	19	57234802	57235101	1 - by flanking markers	19	59599823	70892142	1 - by flanking markers	19	48798983	60220581	1 - by flanking markers	19	44306955	55283277	1 - by flanking markers	RRID:RGD_629503	The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating.
629504	WKY.SHR-(<i>D1Mit3-D1Rat57</i>)/Iwai		Shiga University of Medical Science, Otsu, Japan		congenic	Unknown				1	146971846	177313977	1 - by flanking markers	1	162692213	195736590	1 - by flanking markers	1	156446196	188794576	1 - by flanking markers	1	144267353	173421758	1 - by flanking markers	RRID:RGD_629504	Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY
629505	SS.MNS-(<i>D10Mit11-D10M11Mit119</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	101848470	101848683	1 - by flanking markers													RRID:RGD_629505	fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr
629506	LEW-<i>tl</i>.BN-(<i>D2Arb16-D2Wox8</i>)		Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD		congenic	Unknown		Csf1	621063	2	198312439	212776982	1 - by flanking markers	2	225003539	237636701	1 - by flanking markers	2	205572952	219581453	1 - by flanking markers	2	190602746	204499414	1 - by flanking markers	RRID:RGD_629506	LEW.<i>tl</i> carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2.
629509	FHH/EurMcwi		PhysGen	<a href=http://www.rrrc.us/Strain/?x=293>Rat Resource and Research Center</a>, <a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>	inbred	Live Animals; Cryorecovery																				RRID:RRRC_00293	An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.
629510	SS.BN-(<i>D12Arb13-D12Rat79</i>)/Mcwi		PhysGen		congenic	Live Animals				18	2848113	62229060	1 - by flanking markers	18	2761846	61177004	1 - by flanking markers	18	2745212	61985812	1 - by flanking markers	18	59796478	59796643	1 - by flanking markers	RRID:RGD_629510	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629511	SS-Chr 2<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629511	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629512	FHH-Chr 12<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629512	A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed
629513	SS-Chr 4<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629513	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629514	SS-Chr 6<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Sperm																				RRID:RGD_629514	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629515	SS-Chr 7<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629515	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629516	SS-Chr 8<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629516	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629517	SS-Chr Y<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629517	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629518	SS-Chr 9<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629518	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629519	SS.BN-(<i>D13Mgh13-D13Mit4</i>)/Mcwi		PhysGen		congenic	Unknown				13	90551150	90551272	1 - by flanking markers	13	41256240	97381801	1 - by flanking markers	13	36147533	92916783	1 - by flanking markers	13	31241331	86800898	1 - by flanking markers	RRID:RGD_629519	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629520	FHH-Chr 1<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Sperm																				RRID:RGD_629520	A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed
629521	SS-Chr 11<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629521	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629522	SS-Chr 20<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629522	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629523	SS-Chr 13<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_629523	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629524	SS-Chr 16<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Sperm																				RRID:RGD_629524	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629525	SS-Chr 18<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_629525	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
629548	SHR.BN-(<i>D1Mit3-Igf2</i>)/1lpcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown																				RRID:RGD_629548	SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv.
629578	SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio.		congenic	Unknown				5	32701659	168174140	1 - by flanking markers	5	36590997	171686754	1 - by flanking markers	5	31926122	168109659	1 - by flanking markers	5	31663789	161481680	1 - by flanking markers	RRID:RGD_629578	 A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations
631158	DXE1/Ztm		Zentralinstitut Fur Versuchstierzucht, Hannover, Germany		recombinant_inbred	Unknown																				RRID:RGD_631158	DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.
631160	DXE2/Ztm		Zentralinstitut Fur Versuchstierzucht, Hannover, Germany		recombinant_inbred	Unknown																				RRID:RGD_631160	Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats
631161	DXE3/Ztm		Zentralinstitut Fur Versuchstierzucht, Hannover, Germany		recombinant_inbred	Unknown																				RRID:RGD_631161	Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.
631163	LE/BluGill		University of Illinois at Urbana-Champaign		inbred	Unknown																				RRID:RGD_631163	This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock.
631182	DA/BklArbN		NIH, Arthritis and Rheumatism Branch, Bethesda MD		inbred	Extinct																				RRID:RRRC_00091	This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.
631219	SDT/Jcl		<a href =https://www.clea-japan.com/en/products/diabetes/item_a0140> CLEA Japan, Inc</a>	<a href =https://www.clea-japan.com/en/products/diabetes/item_a0140> CLEA Japan, Inc</a>	inbred	Live Animals (as of 2021-04-23)																				RRID:RGD_631219	Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating.
631220	SS.LEW-(<i>D10Mco1-D10Mco31</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				10	69986912	84284667	1 - by flanking markers	10	68786307	83220224	1 - by flanking markers	10	69123603	83411656	1 - by flanking markers	10	66743655	80537228	1 - by flanking markers	RRID:RGD_631220	Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment
631275	WKY/Cfd	WKY/Cfd	Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA		inbred	Unknown																				RRID:RGD_631275	Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA)
631276	WKHA/Cfd	WKHA/Cfd	Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA		inbred	Unknown																				RRID:RGD_631276	Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)
631278	SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown		Fst|Gstm1|Vcam1|S1pr1	2633|2755|3952|61958	2	46542246	210636169	1 - by flanking markers	2	65576721	235592880	1 - by flanking markers	2	46537589	217498710	1 - by flanking markers	2	46123260	202447032	1 - by flanking markers	RRID:RGD_631278	Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background.
631279	SHRSP.WKY-(<I>D2Rat13-D2Mit5</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown		Fst	2633	2	46542246	66680209	1 - by flanking markers	2	65576721	86560306	1 - by flanking markers	2	46537589	66828236	1 - by flanking markers	2	46123260	66118463	1 - by flanking markers	RRID:RGD_631279	Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.
631280	WKY.SHRSP-(<I>D2Mit5-D2Mgh12</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown		Pklr	3336	2	66680022	181223505	1 - by flanking markers	2	86560119	207874394	1 - by flanking markers	2	66828049	188458034	1 - by flanking markers	2	66118275	174551863	1 - by flanking markers	RRID:RGD_631280	Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.
631281	WKY.SHRSP-(<I>Fst-Pklr</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown		Fst|Pklr	2633|3336	2	46542246	181223505	1 - by flanking markers	2	65576721	207874394	1 - by flanking markers	2	46537589	188458034	1 - by flanking markers	2	46123260	174551863	1 - by flanking markers	RRID:RGD_631281	Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.
631282	DA.F344-(<I>D10Arb20-D10Arb22</I>)/Arb		Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA		congenic	Extinct				10	24006429	24006612	1 - by flanking markers	10	24340447	107484761	1 - by flanking markers	10	24483076	107857673	1 - by flanking markers	10	23444813	104060283	1 - by flanking markers	RRID:RGD_631282	This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.
631283	DA.F344-(<I>D10Arb21-D10Arb22</I>)/Arb		Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA		congenic	Extinct				10	14721135	14721325	1 - by flanking markers	10	14644150	107484761	1 - by flanking markers	10	14827894	107857673	1 - by flanking markers	10	14487011	104060283	1 - by flanking markers	RRID:RGD_631283	This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.
631285	IER/Ihr		Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=732> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Neurobiology; Ophthalmology																			RRID:RGD_631285	A mutant rat strain which is a useful model for human cataract.
631286	WKY/Izm	Wistar-Kyoto	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=412 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=412 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_631286	WKY strain from the Izumo colony
631294	F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe		Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden		congenic	Unknown		Cyp2c12	2470	1	267110921	267111153	1 - by flanking markers	1	266156838	289137268	1 - by flanking markers	1	258709726	281795785	1 - by flanking markers	1	238699859	259647894	1 - by flanking markers	RRID:RGD_631294	This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background
631571	SS.LEW-(<i>D1Uia8-D1Mco38</i>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1	110818690	110818887	1 - by flanking markers	1	117836211	117836407	1 - by flanking markers	1	116680361	116680557	1 - by flanking markers	1	110159449	110159650	1 - by flanking markers	RRID:RGD_631571	Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.
631572	SBH/Ygl	Sabra hypertension prone	Ben Gurion University Barzilai Medical Center, Ashkelon, Israel	Available at the Barzilai University Medical Center in Ashkelon, Israel	inbred	Live Animals (as of 2024-07-15)																				RRID:RGD_631572	Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai University Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl.
631573	SBN/Ygl	Sabra hypertension resistant	Ben Gurion University Barzilai Medical Center, Ashkelon, Israel	Available at the Barzilai University Medical Center in Ashkelon, Israel	inbred	Live Animals (as of 2024-07-15)																				RRID:RGD_631573	Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl
631574	Wild/K		Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany		wild	Unknown																				RRID:RGD_631574	Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.
631576	LEW/CrlCrlj			Charles River, Atsugi, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=776> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Immunology; Osteosis																			RRID:RGD_631576	Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34.
631577	SHR/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=411 > National BioResource Project for the Rat in Japan</a>, Funabashi Farm, Chiba, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=411 > National BioResource Project for the Rat in Japan</a>, Funabashi Farm, Chiba, Japan	inbred	Live Animals	Cardio Hypertension																			RRID:RGD_631577	Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).
631578	SHR.BN-(<I>D2Rat171-D2Arb24</I>)/Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic.		congenic	Unknown				2	116874922	221284686	1 - by flanking markers	2	135770850	248088631	1 - by flanking markers	2	116075644	228737869	1 - by flanking markers	2;9	112456140;67703258	212696837;67703293	1 - by flanking markers;1 - by flanking markers	RRID:RGD_631578	This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background
631579	LEW/OlaHsd		Harlan France	Harlan France	inbred	Unknown																				RRID:RGD_631579	Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands.
631581	LEW.1F		Zentralinstitut fur versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_631581	Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1<sup>f</sup> haplotype into the LEW stock
631582	SS.WKY-(<i>Mme-D2Wox18</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Mme	3098	2	153031724	174727552	1 - by flanking markers	2	173193501	201402094	1 - by flanking markers	2	153799203	181987474	1 - by flanking markers	2	147686913	168355276	1 - by flanking markers	RRID:RGD_631582	Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr
631583	SS.WKY-(<i>D2Mgh8-D2Mgh9</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown																				RRID:RGD_631583	Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr
631585	SS.LEW-(<I>D16Mit2-D16Rat12</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				16	350121	4304517	1 - by flanking markers	16	1084304	5038806	1 - by flanking markers	16	1090054	5098704	1 - by flanking markers	16	380245	4227730	1 - by flanking markers	RRID:RGD_631585	This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background
631586	SS.MNS-(<I>D10Mco14-D10Mit11</I>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	45105978	102587587	1 - by flanking markers	10	44914976	101157704	1 - by flanking markers	10	45157430	101482600	1 - by flanking markers	10	43593509	98003205	1 - by flanking markers	RRID:RGD_631586	This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.
631587	SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown		Ace	2493	10	69986912	102587587	1 - by flanking markers	10	68786307	101157704	1 - by flanking markers	10	69123603	101482600	1 - by flanking markers	10	66743655	98003205	1 - by flanking markers	RRID:RGD_631587	This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.
631588	SS.MNS-(<i>D10Mit11-Vamp2</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Vamp2	3949	10	55848264	101848683	1 - by flanking markers	10	55418231	55422465	1 - by flanking markers	10	55675171	55679405	1 - by flanking markers	10	53793581	53797815	1 - by flanking markers	RRID:RGD_631588	Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr
631589	SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs		Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK		congenic	Unknown				1	168382195	170218440	1 - by flanking markers	1	182435050	184213712	1 - by flanking markers	1	175447029	177235302	1 - by flanking markers	1	164747424	166533203	1 - by flanking markers	RRID:RGD_631589	Congenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHR
631590	SHR.WKY-(<i>D1Wox34-Sah</i>)/Njs		Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK		congenic	Unknown		Acsm3	62086	1	168382195	178081751	1 - by flanking markers	1	182435050	196475596	1 - by flanking markers	1	175447029	189541233	1 - by flanking markers	1	164747424	174159966	1 - by flanking markers	RRID:RGD_631590	Congenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHR
631591	WKY.SHR-(<i>D1Rat56-D1M7Mit206</i>)/Njs		Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK		congenic	Unknown				1	172926151	172926455	1 - by flanking markers	1	191393321	191393468	1 - by flanking markers	1	184419946	184420093	1 - by flanking markers	1	169112897	169113045	1 - by flanking markers	RRID:RGD_631591	Congenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>DWox19-D1Mit2</i>) to WKY
631592	WKY.SHR-(<i>D1Rat236-D1M7Mit206</i>)/Njs		Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK		congenic	Unknown				1	155183458	155183662	1 - by flanking markers	1	169098399	169098603	1 - by flanking markers	1	162891429	162891633	1 - by flanking markers	1	152234464	152234669	1 - by flanking markers	RRID:RGD_631592	Congenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>D1Wox19-D1Mit2</i>) to WKY
631593	LEW/Rj		Hopital Purpan, Toulouse Cedex, France		inbred	Unknown																				RRID:RGD_631593	Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).
631594	BN/Rj		Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, France		inbred	Unknown																				RRID:RGD_631594	Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).
631595	LEW.1AV1.DA-(<i>D10Rat92-D10Rat135</i>)/Ubc		Biomedical Center in Uppsala, Sweden		congenic	Unknown				10	78170416	108776963	1 - by flanking markers	10	77132487	108145987	1 - by flanking markers	10	77269759	108540162	1 - by flanking markers	10	74585846	104670812	1 - by flanking markers	RRID:RGD_631595	LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain.
631596	LEW.1AV1.DA-(<i>D10Rat92-D10Wox17</i>)/Ubc		Biomedical Center in Uppsala, Sweden		congenic	Unknown				10	78170416	91168491	1 - by flanking markers	10	77132487	89831596	1 - by flanking markers	10	77269759	90042115	1 - by flanking markers	10	74585846	87055282	1 - by flanking markers	RRID:RGD_631596	Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2.
631597	LEW.1AV1.DA-(<i>D10Wox17-D10Rat135</i>)/Ubc		Biomedical Center in Uppsala, Sweden		congenic	Unknown				10	91168332	108776963	1 - by flanking markers	10	89831438	108145987	1 - by flanking markers	10	90041957	108540162	1 - by flanking markers	10	87055121	104670812	1 - by flanking markers	RRID:RGD_631597	Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2
631598	LEW.1AV1.DA-(<i>D10Got154-D10Rat135</i>)/Ubc		Biomedical Center in Uppsala, Sweden		congenic	Unknown				10	101532360	108776963	1 - by flanking markers	10	100150192	108145987	1 - by flanking markers	10	100460820	108540162	1 - by flanking markers	10	97010147	104670812	1 - by flanking markers	RRID:RGD_631598	Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2
631599	SHRSP/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=409 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=409 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension; Neurobiology																			RRID:RGD_631599	Strain has been maintained at Kyoto University.
631600	WKY.SHRSP-(<i>Mt1pa-D1Rat200</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany.		congenic	Unknown		Mt1-ps1	3118	1	126938969	185690396	1 - by flanking markers	1	134116233	204941832	1 - by flanking markers	1	133076978	197963072	1 - by flanking markers	1	125611501	181133270	1 - by flanking markers	RRID:RGD_631600	Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY
631601	WKY.SHRSP-(<i>Asgr1-Vamp2</i>)/Bbb		Max-Delbruck Center for Molecular Medicine, Germany		congenic	Unknown		Asgr1|Vamp2	2160|3949	10	55848264	56903173	1 - by flanking markers	10	55418231	56411205	1 - by flanking markers	10	55675171	56666086	1 - by flanking markers	10	53793581	54779642	1 - by flanking markers	RRID:RGD_631601	Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki
631602	BN/Elh		Department of Surgery and Biochemistry, University of Otago		inbred	Unknown																				RRID:RGD_631602	These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony.
631603	WKY/Snk		Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan		inbred	Unknown																				RRID:RGD_631603	The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.
631604	SHR/Snk		Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan		inbred	Unknown																				RRID:RGD_631604	The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.
631605	SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	65068360	77547622	1 - by flanking markers	10	65339106	73694285	1 - by flanking markers	10	76420583	76420889	1 - by flanking markers	10	73887148	73887455	1 - by flanking markers	RRID:RGD_631605	Congenic strain originated from an inbred SS/Jr strain.
631606	SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	97152234	101848683	1 - by flanking markers	10	95701164	95701443	1 - by flanking markers	10	95967019	95967298	1 - by flanking markers	10	92698959	92699242	1 - by flanking markers	RRID:RGD_631606	Congenic strain originated from an inbred SS/Jr strain.
631607	SS.WKY-(<i>D2N35-Mme</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Mme	3098	2	153031724	153114515	1 - by flanking markers	2	173193501	173278946	1 - by flanking markers	2	153799203	153880910	1 - by flanking markers	2	147686913	147803808	1 - by flanking markers	RRID:RGD_631607	Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr
631610	SS.LEW-(<i>D1Rat39-D1Rat131</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	125983422	145648920	1 - by flanking markers	1	133172202	159182239	1 - by flanking markers	1	132134307	152871103	1 - by flanking markers	1	124668437	142990467	1 - by flanking markers	RRID:RGD_631610	Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.
631691	SHRSP/A3Izm		Research Institute, International Medical Center of Japan		inbred	Unknown																				RRID:RGD_631691	Substrain originates from the SHRSP/Izm strain.
631693	WKY.SHRSP-(<i>Shbg-Atp1b2</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Atp1b2|Shbg	2171|3671	10	56418323	56435654	1 - by flanking markers	10	55951260	55983036	1 - by flanking markers	10	56205622	56237354	1 - by flanking markers	10	54318698	54350409	1 - by flanking markers	RRID:RGD_631693	This strain has the blood pressure locus from chr 10
631694	WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown				1	126938969	185923619	1 - by flanking markers	1	134116233	205161264	1 - by flanking markers	1	133076978	133164521	1 - by flanking markers	1	125611501	125611741	1 - by flanking markers	RRID:RGD_631694	This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)
631695	SS/JrRkb		Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany.		inbred	Unknown																				RRID:RGD_631695	This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin
631696	SHR/FubRkb		Freie Universitat Berlin		inbred	Unknown																				RRID:RGD_631696	Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin.
631697	BBDP/Hri		Hagedorn Research Institute, Gentofte, Denmark		inbred	Unknown																				RRID:RGD_631697	This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977.
631698	BN/Mol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_631698	This strain is maintained at the Mollegaard breeding center.
631699	BB.SHR-(<i>D6Rat184-D6Rat101</i>)/K		University of Greifswald, Germany		congenic	Unknown				6	121381065	135964844	1 - by flanking markers	6	130448688	144756005	1 - by flanking markers	6	121224054	135658578	1 - by flanking markers	6	116506292	130245370	1 - by flanking markers	RRID:RGD_631699	Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females.
631700	BB.SHR-(<i>Gnal-D18Mit9</i>)/K		Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany		congenic	Unknown		Gnal	2715	18	63595606	80370517	1 - by flanking markers	18	61991738	79748387	1 - by flanking markers	18	62805406	80696375	1 - by flanking markers	18	60622311	77209844	1 - by flanking markers	RRID:RGD_631700	Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long.
631703	SS.LEW-(<i>D10Rat207-D10Mgh1</i>)/Ayd		Research Centre-CHUM		congenic	Unknown				10	89896421	89896564	1 - by flanking markers	10	88662536	88662678	1 - by flanking markers	10	88865454	88865596	1 - by flanking markers	10	85887040	85887185	1 - by flanking markers	RRID:RGD_631703	Congenic strain originated from an inbred SS strain
631844	Iusm:HAD1	high-alcohol-drinking	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		outbred	Unknown																				RRID:RGD_631844	These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2).
631845	Iusm:LAD1	low-alcohol-drinking	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		outbred	Unknown																				RRID:RGD_631845	These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2).
631846	F344.GK-(<i>D1Mgh10-D1Rat90</i>)/Swe		Karolinska Institute		congenic	Unknown				1	204280278	267111153	1 - by flanking markers	1	223910550	289137268	1 - by flanking markers	1	217054291	281795785	1 - by flanking markers	1	199050459	259647894	1 - by flanking markers	RRID:RGD_631846	Congenic strain originated from an inbred F344/Mcwi strain
631847	F344.GK-(<i>D1Mit7-D1Mgh25</i>)/Swe		Karolinska Institute		congenic	Unknown				1	235677487	240980321	1 - by flanking markers	1	257430524	262617374	1 - by flanking markers	1	250195095	250195290	1 - by flanking markers	1	229550480	229550676	1 - by flanking markers	RRID:RGD_631847	Congenic strain originated from an inbred F344 strain
631848	SHR/OlaIpcv		Czech Academy of Sciences, Prague, Czech Republic		inbred	Unknown		Sbf1<i><sup>m1Ipcv</sup></i>	10002755																	RRID:RGD_631848	These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain.
634359	WF.WKY-(<i>D5Pas1-D5Uwm37</i>)/Uwm		University of Wisconsin-Madison		congenic	Unknown				5	26938679	130527490	1 - by flanking markers	5	30952629	132652105	1 - by flanking markers	5	26251767	128812854	1 - by flanking markers	5	26141669	123935338	1 - by flanking markers	RRID:RGD_634359	WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region.
634363	LEW/NIcoCrlf			Charles River, France	inbred	Unknown																				RRID:RGD_634363	A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.
634364	SHR/NIcoCrlf			Charles River, France	inbred	Unknown																				RRID:RGD_634364	A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.
634365	SS/Hsd			Harlan, Indianapolis, Indiana	inbred	Unknown																				RRID:RGD_634365	This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.
634366	SR/Hsd			Harlan, Indianapolis, Indiana	inbred	Unknown																				RRID:RGD_634366	This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.
634367	BN/CrlCrlj		<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>,<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=777> National BioResource Project for the Rat in Japan</a>	<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>,<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=777> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Ophthalmology; Immunology																			RRID:RGD_634367	1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced.
634369	WBN/KobSlc	wistar bonn/kobori	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=378 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=378 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Diabetes Obesity; Ophthalmology																			RRID:RGD_634369	This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1.
634370	F344.GK-(<i>D1Mgh10-D1Rat119</i>)/Swe		Karolinska Institute		congenic	Unknown				1	204280278	242586311	1 - by flanking markers	1	223910550	264429516	1 - by flanking markers	1	217054291	256949019	1 - by flanking markers	1	199050459	236036450	1 - by flanking markers	RRID:RGD_634370	GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain.
634372	GHS		Department of Medicine and Physiology, University of Rochester, Rochester, New York		inbred	Unknown																				RRID:RGD_634372	SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain.
634373	DA/ZtmRhd		Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden		inbred	Unknown																				RRID:RGD_634373	DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.
634374	E3/ZtmRhd		Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden		inbred	Unknown																				RRID:RGD_634374	E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.
634376	LEA/Ncu		Nagoya City University Medical School, Nagoya, Aichi, Japan		inbred	Unknown																				RRID:RGD_634376	These rats were established from a closed colony of Long-Evans.
634377	BN/Sea	BN/Sea	Sea Life Supply, Sand City, CA	<a href=http://www.sealifesupply.com> Sea Life Supply </a>	inbred	Unknown																				RRID:RGD_634377	This inbred strain was obtained from Sea life Supply
634380	iP/Iusm	inbred alcohol-preferring	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		inbred	Unknown		Npy	3197																	RRID:RGD_634380	These were inbred alcohol-preferring rats developed from outbred alcohol-preferring rats (Iusm:P) at generation 30 at Indiana University for high-alcohol-preferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding.
634381	iNP/Iusm	alcohol-nonpreferring	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		inbred	Unknown		Npy	3197																	RRID:RGD_634381	These were inbred alcohol-nonpreferring rats developed from outbred alcohol-nonpreferring rats (Iusm:NP) at generation 30 at Indiana University for high-alcohol-nonpreferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding.
634382	SHR.BN-(<i>D5Wox12-D5Wox20</i>)/Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				5	147065698	147065912	1 - by flanking markers	5	149494416	149494629	1 - by flanking markers	5	145726049	145726262	1 - by flanking markers	5	139989554	139989768	1 - by flanking markers	RRID:RGD_634382	This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background
634743	BIL		NIH Autoimmune Rat Model Repository		inbred	Unknown																				RRID:RGD_634743	University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.
724569	MWF/FubRkb	Munich Wistar Fromter	Freie Universitdt Berlin, Berlin, Germany		inbred	Unknown																				RRID:RGD_724569	The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm).
724570	LEW/Rkb		Freie Universitdt Berlin, Berlin, Germany		inbred	Unknown																				RRID:RGD_724570	The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany.
724571	MITE/Mna		Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan		inbred	Unknown																				RRID:RGD_724571	This strain was established from captured Japanese wild rats.
724572	SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	71294871	77092169	1 - by flanking markers	10	70062921	74127968	1 - by flanking markers	10	70428844	75983805	1 - by flanking markers	10	68011827	73453136	1 - by flanking markers	RRID:RGD_724572	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
724573	SS/JrTol	Dahl salt-sensitive (SS/Jr) rats	Housed at the University of Toledo College of Medicine and Life Sciences.		inbred	Live Animals (as of 2021-06-08)																				RRID:RGD_724573	In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet.
724574	SHR/NHsd		<a href=https://www.envigo.com/model/shr-nhsd/>Envigo</a>	<a href=https://www.envigo.com/model/shr-nhsd/>Envigo</a>	inbred	Unknown																				RRID:RGD_724574	SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN)
724575	SS.LEW-(<i>D10Rat17-D10Mgh1</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	95066219	95066632	1 - by flanking markers	10	93641751	93641934	1 - by flanking markers	10	93886117	93886300	1 - by flanking markers	10	90627439	90627625	1 - by flanking markers	RRID:RGD_724575	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
724576	KDP/Tky	Komeda diabetes-prone rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=15 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=15 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Diabetes Obesity; Immunology	Cblb	620535																	RRID:RGD_724576	This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross.
724577	SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown		Igfbp4	2875	10	77091834	87834315	1 - by flanking markers	10	74127825	86759484	1 - by flanking markers	10	75983662	86962563	1 - by flanking markers	10	73452992	84007272	1 - by flanking markers	RRID:RGD_724577	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728133	BN-<I>RT1<SUP>n</SUP></I>/Rj		The Center dElevage R. Janvier, France.		coisogenic	Unknown																				RRID:RGD_728133	This coisogenic strain was produced by selecting BN rats with the <I>RT1<SUP>n</SUP></I> allele.
728134	SS.LEW-(<I>D1Rat35-D1Rat49</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	124748920	157498254	1 - by flanking markers	1	131958920	171330794	1 - by flanking markers	1	130917121	165129939	1 - by flanking markers	1	123479780	154464242	1 - by flanking markers	RRID:RGD_728134	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.
728135	SS.LEW-(<I>D5Uwm14-D5Uwm31</I>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614		congenic	Unknown				5	48908533	48908825	1 - by flanking markers	5	52440414	52440705	1 - by flanking markers	5	47842131	47842422	1 - by flanking markers	5	47002982	47003274	1 - by flanking markers	RRID:RGD_728135	S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain
728137	SS.LEW-(<I>D10Rat141-D10Mgh1</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				19	38295381	38295550	1 - by flanking markers	19	51402312	51402480	1 - by flanking markers	10;19	91548145;40571888	91548388;40572056	1 - by flanking markers;1 - by flanking markers	19	36511450	36511619	1 - by flanking markers	RRID:RGD_728137	Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment
728138	SS.MNS-(<I>Mme-Gca</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown		Atp1a1|Mme|Npr1	2167|3098|3195	2	153031724	182740242	1 - by flanking markers	2	173193501	209287892	1 - by flanking markers	2	153799203	189857032	1 - by flanking markers	2	147686913	175950118	1 - by flanking markers	RRID:RGD_728138	Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive
728139	WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown																				RRID:RGD_728139	This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(<I>Shbg-Atp1b2</I>) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(<I>Shbg-Atp1b2</I>) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs
728140	SS.LEW-(<I>D10Rat11-D10Mgh1</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				10;19	100633512;38295381	100633982;38295550	1 - by flanking markers;1 - by flanking markers	10;19	99184058;51402312	99184250;51402480	1 - by flanking markers;1 - by flanking markers	10;19	99492217;40571888	99492409;40572056	1 - by flanking markers;1 - by flanking markers	10;19	96120911;36511450	96121100;36511619	1 - by flanking markers;1 - by flanking markers	RRID:RGD_728140	Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment
728142	BN.SHR-(<i>Il6-Cd36</i>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown		Cd36|Il6	2301|2901	4	456799	13554416	1 - by flanking markers	4	3095536	14166434	1 - by flanking markers	4	3043231	14191498	1 - by flanking markers	4	5214602	17410084	1 - by flanking markers	RRID:RGD_728142	This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR.
728143	SS.LEW-(<I>D1Mco38-D1Rat49</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	110818690	157498254	1 - by flanking markers	1	117836211	171330794	1 - by flanking markers	1	116680361	165129939	1 - by flanking markers	1	110159449	154464242	1 - by flanking markers	RRID:RGD_728143	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.
728144	BN.PD-(<I>D8Rat39-D8Rat35</I>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown				8	49035642	64617259	1 - by flanking markers	8	48981076	65325374	1 - by flanking markers	8	50356432	50356607	1 - by flanking markers	8	46358478	46358654	1 - by flanking markers	RRID:RGD_728144	This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM.
728145	SS.LEW-(<I>D5Rat130-D5Rat108</I>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614		congenic	Unknown				5	32701659	134872385	1 - by flanking markers	5	36590997	137108002	1 - by flanking markers	5	31926122	133313852	1 - by flanking markers	5	31663789	128034027	1 - by flanking markers	RRID:RGD_728145	S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain
728146	F344.BN-(<I>D3Mgh13-D3Mgh7</I>)/Dlw		Department of Biological Sciences, Oakland University, Rochester, MI		congenic	Unknown				3	112319451	112319585	1 - by flanking markers	3	11139240	123812293	1 - by flanking markers	3	5775856	117288411	1 - by flanking markers	3	10549351	112272465	1 - by flanking markers	RRID:RGD_728146	This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA
728147	BN.PD-(<I>D8Rat39-D8Rat35</I>),SHR-(<I>D4Mgh2-Cd36</I>),SHR-(<I>D20Wox3-D20Mgh5</I>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown																				RRID:RGD_728147	This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM.
728148	SS.LEW-(<I>D16Uia2-D16Rat12</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				16	350121	4304517	1 - by flanking markers	16	1084304	5038806	1 - by flanking markers	16	1090054	5098704	1 - by flanking markers	16	380245	4227730	1 - by flanking markers	RRID:RGD_728148	Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment
728151	UPL/Ncc		Hiroshima University, School of Medicine, Hiroshima, Japan		inbred	Unknown																				RRID:RGD_728151	The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony.
728152	SS.LEW-(<I>D1Rat196-D1Mgh7</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	55083934	106445306	1 - by flanking markers	1	59282428	114601028	1 - by flanking markers	1	58354072	113593716	1 - by flanking markers	1	57336763	106047988	1 - by flanking markers	RRID:RGD_728152	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.
728153	SS.LEW-(<I>D1Rat196-D1Rat49</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	55083934	157498254	1 - by flanking markers	1	59282428	171330794	1 - by flanking markers	1	58354072	165129939	1 - by flanking markers	1	57336763	154464242	1 - by flanking markers	RRID:RGD_728153	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.
728155	BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/1Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown				4	75732943	75733127	1 - by flanking markers	4	141978848	141979031	1 - by flanking markers	4	77307388	79562753	1 - by flanking markers	4	76647384	78886189	1 - by flanking markers	RRID:RGD_728155	This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.
728156	SS.LEW-(<I>D5Mco34-D5Mco10</I>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614		congenic	Unknown				5	168173895	168174140	1 - by flanking markers	5	171686510	171686754	1 - by flanking markers	5	168109415	168109659	1 - by flanking markers	5	161481433	161481680	1 - by flanking markers	RRID:RGD_728156	SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain
728157	SS.LEW-(<I>D5Rat130-D5Mit19</I>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614		congenic	Unknown				5	32701659	140744137	1 - by flanking markers	5	36590997	142892672	1 - by flanking markers	5	31926122	139102349	1 - by flanking markers	5	31663789	133752767	1 - by flanking markers	RRID:RGD_728157	SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain
728158	SS.LEW-(<I>D5Uia4-D5Mco10</I>)/Jr		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614		congenic	Unknown				5	144865363	168174140	1 - by flanking markers	5	147288554	171686754	1 - by flanking markers	5	143523348	168109659	1 - by flanking markers	5	137790781	161481680	1 - by flanking markers	RRID:RGD_728158	SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain
728159	SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	124748920	146189942	1 - by flanking markers	1	131958920	160138947	1 - by flanking markers	1	130917121	153834227	1 - by flanking markers	1	123479780	143506731	1 - by flanking markers	RRID:RGD_728159	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.
728161	PD/Cub	polydactylous	Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		inbred	Unknown																				RRID:RGD_728161	Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome.
728162	SS.LEW-(<I>D1Mco87-D1Rat71</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	145648742	206567907	1 - by flanking markers	1	159182062	226102807	1 - by flanking markers	1	152870926	219232156	1 - by flanking markers	1	142990289	201278233	1 - by flanking markers	RRID:RGD_728162	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.
728163	SS.LEW-(<I>D1Uia2-D1Rat49</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	157497884	157498254	1 - by flanking markers	1	171330622	171330794	1 - by flanking markers	1	165129767	165129939	1 - by flanking markers	1	154464069	154464242	1 - by flanking markers	RRID:RGD_728163	Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.
728165	SS.LEW-(<I>D1Rat196-D1Mco36</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	55083934	122992360	1 - by flanking markers	1	59282428	130268180	1 - by flanking markers	1	58354072	129209407	1 - by flanking markers	1	57336763	121834139	1 - by flanking markers	RRID:RGD_728165	Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.
728166	WKY.SHRSP-(<I>D1Rat112-D1Wox29</I>)/Izm		Shimane Medical University, Izumo, Japan		congenic	Unknown				1	124614679	206574346	1 - by flanking markers	1	131822204	226109267	1 - by flanking markers	1	130779148	219238616	1 - by flanking markers	1	123350408	201284693	1 - by flanking markers	RRID:RGD_728166	A segment from SHRSP/Izm was transferred on a WKY/Izm background
728167	SS.LEW-(<I>Nos2-D10M11Mit119</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown		Nos2	3185	10	65036884	65072453	1 - by flanking markers	10	65423626	65456957	1 - by flanking markers	10	66188290	66221621	1 - by flanking markers	10	63815308	63851208	1 - by flanking markers	RRID:RGD_728167	Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment
728168	WOK		Diabetes Research Center, Karlsberg, Germany		inbred	Unknown																				RRID:RGD_728168	The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany
728170	SS.MNS-(<I>Mme-D2Mit14</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown		Atp1a1|Mme	2167|3098	2	153031724	197256313	1 - by flanking markers	2	173193501	224018437	1 - by flanking markers	2	153799203	204585731	1 - by flanking markers	2	147686913	189599348	1 - by flanking markers	RRID:RGD_728170	Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain
728171	LEW-<I>RT1<SUP>1</SUP></I>/Rj		The Center dElevage R. Janvier, France.		coisogenic	Unknown																				RRID:RGD_728171	This coisogenic strain was produced by selecting LEW rats with the <I>RT1<SUP>1</SUP></I> allele.
728172	SS.MNS-(<I>D2Mit6-Adh1</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown		Adh1c|Agtr1b|Atp1a1	2044|2071|2167	2	77630629	235811584	1 - by flanking markers	2	98037122	262102977	1 - by flanking markers	2	78321410	243562243	1 - by flanking markers	2	76539322	226808892	1 - by flanking markers	RRID:RGD_728172	Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS
728183	WF/N		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	inbred	Unknown																				RRID:RGD_728183	To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia.
728184	SHRSP/A3N		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct (as of 2020-04-21)																				RRID:RGD_728184	To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517)
728185	N:NIH				outbred	Extinct																				RRID:RRRC_00237	Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony.
728186	LEW/SsN		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_728186	To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.
728187	ACI/N-j		NIH Autoimmune Rat Model Repository and Development Center		congenic	Extinct																				RRID:RGD_728187	Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.
728188	LOU/MN		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct (as of 2020-09-04)																				RRID:RGD_728188	To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence.
728189	SHR/N-<I>di</I>		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728189	Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.
728190	RCS-<I>rdy-c</I>	Albino retinal dystrophy	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728190	This congenic strain is obtained from pink-eyed, tan-hooded RCS rats
728191	LOU/CN		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_728191	To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)
728192	RCS-rdy-p		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728192	This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks.
728193	N:SD	Sprague-Dawley	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=239>Rat Resource and Research Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=239>Rat Resource and Research Center</a>	outbred	Extinct																				RRID:RRRC_00239	To N 1945 from Sprague Dawley, Inc. Colony closed since then.
728194	SHR/N		NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_728194	To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.
728195	SHR/N-<i>cp</i>		<a href=http://www.rrrc.us/Strain/?x=231>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=231>Rat Resource and Research Center</a>	congenic	Cryopreserved Embryo (as of 2021-01-20)																				RRID:RRRC_00231	The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis.
728196	RHA/N-<i>j</i>		NIH Autoimmune Rat Model Repository and Development Center		congenic	Extinct																				RRID:RGD_728196	Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.
728197	RCS-rdy-+		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728197	This congenic strain is obtained from pink-eyed, tan-hooded RCS rats
728198	BHE/N	Bureau of Home Economics	NIH Autoimmune Rat Model Repository and Development Center		inbred	Extinct																				RRID:RGD_728198	To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.
728199	RHA	Roman high avoidance	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728199	Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965).
728200	ACI/N-<I>di</I>		<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728200	Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41.
728358	SB		R. Kalman, Authority for Animal Facilities		outbred	Unknown																				RRID:RGD_728358	This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear.
728383	UPL/Cas	Upjohn Pharmaceuticals Limited	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=472 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=472 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown		Gja8<sup>m1Cas</sup>	13524999																	RRID:RGD_728383	In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating.
728384	SS.LEW-(<i>D10Rat24-Igfbp4</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown		Igfbp4	2875	10	79229067	87834315	1 - by flanking markers	10	78194957	86759484	1 - by flanking markers	10	78343027	86962563	1 - by flanking markers	10	75631887	84007272	1 - by flanking markers	RRID:RGD_728384	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728385	WF.COP-(<i>D2Rat2-D2M13Mit286</i>)/Uwm		University of Wisconsin, Madison, Wisconsin, USA		congenic	Unknown				2	14747814	14747981	1 - by flanking markers	2	14095321	14095488	1 - by flanking markers	2	14237830	14237997	1 - by flanking markers	2	16491740	16491908	1 - by flanking markers	RRID:RGD_728385	A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.
728386	SS.LEW-(<i>D10Rat119-D10Rat133</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	53675361	65668639	1 - by flanking markers	10	53273326	64823355	1 - by flanking markers									RRID:RGD_728386	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728387	WF.COP-(<i>D2Mit29-D2Uwm13</i>)/Uwm		University of Wisconsin, Madison, Wisconsin, USA		congenic	Unknown				2	5601528	11957973	1 - by flanking markers	2	5396621	11387756	1 - by flanking markers	2	5417336	11522696	1 - by flanking markers	2	7887772	13840758	1 - by flanking markers	RRID:RGD_728387	A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.
728388	SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	53675361	53675478	1 - by flanking markers	10	53273326	53273444	1 - by flanking markers									RRID:RGD_728388	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728389	WF.COP-(<i>D2Mit29-D2Rat201</i>)/Uwm		University of Wisconsin, Madison, Wisconsin, USA		congenic	Unknown				2	5601528	49691646	1 - by flanking markers	2	5396621	68633866	1 - by flanking markers	2	5417336	50260392	1 - by flanking markers	2	7887772	49657252	1 - by flanking markers	RRID:RGD_728389	A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.
728391	WF.COP-(<i>D2Rat253-D2Uwm17</i>)/Uwm		University of Wisconsin, Madison, Wisconsin, USA		congenic	Unknown				2	25663274	32051637	1 - by flanking markers	2	44171519	50382003	1 - by flanking markers	2	25012974	31224929	1 - by flanking markers	2	26559817	32374088	1 - by flanking markers	RRID:RGD_728391	A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.
728392	RHA/N-<I>di</I>	Roman high avoidance-<i>di</i> mutation	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>	congenic	Unknown																				RRID:RGD_728392	Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.
728393	SS.LEW-(<i>D10Got125-D10Rat120</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	86983905	92373412	1 - by flanking markers	10	85965754	91041690	1 - by flanking markers	10	86168841	91270722	1 - by flanking markers	10	83212828	88132643	1 - by flanking markers	RRID:RGD_728393	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728394	SS.LEW-(<i>D10Rat55-D10Rat13</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	89167104	97152587	1 - by flanking markers	10	87933406	95701443	1 - by flanking markers	10	88140923	95967298	1 - by flanking markers	10	85160679	92699242	1 - by flanking markers	RRID:RGD_728394	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728395	SS.LEW-(<i>D10Rat55-D10Rat120</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	89167104	92373412	1 - by flanking markers	10	87933406	91041690	1 - by flanking markers	10	88140923	91270722	1 - by flanking markers	10	85160679	88132643	1 - by flanking markers	RRID:RGD_728395	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
728396	SS.LEW-(<i>D10Mco15-D10Mgh1</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown				10	98392296	98392508	1 - by flanking markers	10	97028717	97028928	1 - by flanking markers	10	97308358	97308569	1 - by flanking markers	10	93995749	93995963	1 - by flanking markers	RRID:RGD_728396	A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
731185	MWF/Fub	Munich Wistar Fromter	Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany		inbred	Unknown																				RRID:RGD_731185	Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany
731186	SHR/Fub		Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany		inbred	Unknown																				RRID:RGD_731186	Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany
731187	Iusm:HAD2	high-alcohol-drinking	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		outbred	Unknown																				RRID:RGD_731187	These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2).
731188	Iusm:LAD2	low-alcohol-drinking	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		outbred	Unknown																				RRID:RGD_731188	These were developed by selective breeding for alcohol preference and consumption from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2).
731189	SHRSP.WKY-(<i>Klk1-D1Rat116</i>)/Izm		Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan		congenic	Unknown																				RRID:RGD_731189	A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method.
731190	SS.LEW-(<i>D1Rat211-D1Rat18</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				17;1	1147796;43747374	1148037;43747532	1 - by flanking markers;1 - by flanking markers	1	35077728	50297622	1 - by flanking markers	1	33667777	49454378	1 - by flanking markers	1	31050840	49268520	1 - by flanking markers	RRID:RGD_731190	A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.
731191	SHRSP.WKY-(<i>D2Rat14-D2Mgh12</i>)/Gcrc		University of Glasgow, Glasgow, UK		congenic	Unknown				2	210636008	210636169	1 - by flanking markers	2	61825950	235592880	1 - by flanking markers	2	42776916	217498710	1 - by flanking markers	2	42804607	202447032	1 - by flanking markers	RRID:RGD_731191	A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.
731192	SS.LEW-(<i>D3Rat52-D3Rat130</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	14051872	44551542	1 - by flanking markers	3	19410399	55227748	1 - by flanking markers	3	14090411	48562146	1 - by flanking markers	3	18311454	47233430	1 - by flanking markers	RRID:RGD_731192	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd
731193	DA.PVG-(<i>D4Rat141-D4Mgh11</i>)		Department of Medicine, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	151158666	171204531	1 - by flanking markers	4	210231569	230565226	1 - by flanking markers	4	146942075	168047091	1 - by flanking markers	4	148090542	167139601	1 - by flanking markers	RRID:RGD_731193	PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies.
731194	SS.LEW-(<i>D3Chm64-D3Rat17</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	52127226	121619110	1 - by flanking markers	3	62850379	133513825	1 - by flanking markers	3	56217734	127023997	1 - by flanking markers	3	54740735	121056321	1 - by flanking markers	RRID:RGD_731194	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd
731195	DA.E3-(<i>D14Wox8-D14Rat64</i>)/Rhd		Medical Inflammation Research, BMC, University of Lund, Lund, Sweden		congenic	Unknown				14	68573958	68574165	1 - by flanking markers	14	67969510	67969716	1 - by flanking markers	14	67944692	67944898	1 - by flanking markers	14	63618971	63619178	1 - by flanking markers	RRID:RGD_731195	The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain.
734471	SS.LEW-(<i>D1Mgh7-D1Mco41</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	106445165	227693454	1 - by flanking markers	1	114600888	249451438	1 - by flanking markers	1	113593576	242177304	1 - by flanking markers	1	106047847	221920075	1 - by flanking markers	RRID:RGD_734471	This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background.
734472	SS.LEW-(<i>D1Mco2-D1Wox6</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	131956599	131956825	1 - by flanking markers	1	58687835	138778112	1 - by flanking markers	1	57761120	137787460	1 - by flanking markers	1	56732484	56732668	1 - by flanking markers	RRID:RGD_734472	This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background.
734473	SS.LEW-(<i>D17Mco3-D17Mco10</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				17	28967455	70289318	1 - by flanking markers	17	24748228	66699053	1 - by flanking markers	17	22774867	64946465	1 - by flanking markers	17	23080368	59555289	1 - by flanking markers	RRID:RGD_734473	SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.
734474	SS.LEW-(<i>D5Mit9-D5Mco10</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				5	62555131	168174140	1 - by flanking markers	5	66128197	171686754	1 - by flanking markers	5	61612600	168109659	1 - by flanking markers	5	60293434	161481680	1 - by flanking markers	RRID:RGD_734474	SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.
734475	DA/OlaHsd		<a href =http://www.envigo.com//model/da-olahsd/> inotiv</a>	<a href =http://www.envigo.com//model/da-olahsd/> inotiv</a>	inbred	Unknown																				RRID:RGD_734475	Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965.
734476	Crl:CD(SD)		<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	outbred	Unknown																				RRID:RGD_734476	Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system.
734478	F344/DuCrl		<a href=https://www.criver.com/products-services/find-model/fischer-cdf-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/fischer-cdf-rat?region=3611> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_734478	This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960.
734479	SS.LEW-(<i>D1Mco2-D1Rat49</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	157497884	157498254	1 - by flanking markers	1	58687835	171330794	1 - by flanking markers	1	57761120	165129939	1 - by flanking markers	1	56732484	154464242	1 - by flanking markers	RRID:RGD_734479	This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background.
734480	SS.LEW-(<i>D10Mit10-D10Mgh1</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	27184741	102587587	1 - by flanking markers	10	27082535	101157704	1 - by flanking markers	10	27237530	101482600	1 - by flanking markers	10	26521957	98003205	1 - by flanking markers	RRID:RGD_734480	SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.
734481	SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Sa	3616	1	238358625	238358813	1 - by flanking markers	1	58687835	259930393	1 - by flanking markers	1	57761120	252708858	1 - by flanking markers	1	56732484	231916666	1 - by flanking markers	RRID:RGD_734481	SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background.
734482	SS.LEW-(<i>D1Rat45-D1Mco41</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Sa	3616	1	146189650	227693454	1 - by flanking markers	1	160138797	249451438	1 - by flanking markers	1	153834077	242177304	1 - by flanking markers	1	143506580	221920075	1 - by flanking markers	RRID:RGD_734482	This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.
734483	SS.LEW-(<i>D1Rat42-D1Wox10</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	135418152	220639653	1 - by flanking markers	1	142342107	244066407	1 - by flanking markers	1	141381406	236763528	1 - by flanking markers	1	133587283	214537671	1 - by flanking markers	RRID:RGD_734483	This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.
734526	OLETF/Got	Otsuka Long Evans Tokushima	Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan		inbred	Unknown																				RRID:RGD_734526	Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating.
734527	OLETF.F344-(<i>D1Rat169-D1Rat459</i>)/Got		Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan		congenic	Unknown				1	229876870	267593558	1 - by flanking markers	1	251652807	289700417	1 - by flanking markers	1	244401175	282365384	1 - by flanking markers	1	224054293	260122809	1 - by flanking markers	RRID:RGD_734527	Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.
734528	OLETF.BN-(<i>D1Rat76-D1Rat459</i>)/Got		Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan		congenic	Unknown				1	230411091	267593558	1 - by flanking markers	1	252243728	289700417	1 - by flanking markers	1	244992467	282365384	1 - by flanking markers	1	224569538	260122809	1 - by flanking markers	RRID:RGD_734528	Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.
734531	OLETF.F344-(<i>D1Rat306-D1Rat461</i>)/Got		Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan		congenic	Unknown				1	248583506	266234812	1 - by flanking markers	1	268967725	288207792	1 - by flanking markers	1	280850604	280850810	1 - by flanking markers	1	258843780	258843987	1 - by flanking markers	RRID:RGD_734531	Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation.
734758	DA/Ham	Dark-agouti	Shizuoka Laboratory Animal Center Hamamatsu, Japan		inbred	Unknown																				RRID:RGD_734758	Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).
734759	SHRSP/Gcrc	Spontaneously hypertensive rat, stroke prone	University of Glasgow, Western Infirmary, Glasgow, UK		inbred	Unknown																				RRID:RGD_734759	SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH
734760	WKY/Gcrc	Wistar-Kyoto	University of Glasgow, Western Infirmary, Glasgow, UK		inbred	Unknown																				RRID:RGD_734760	WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH
734761	WF/Kga	Wistar-Furth	Kagoshima University Dental School, Kagoshima, Japan		inbred	Unknown																				RRID:RGD_734761	Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan).
737657	LEW.1AV1		National Veterinary Institute, Uppsala, Sweden		congenic	Extinct																				RRID:RRRC_00201	Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1<sup>av1</sup> haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.
737658	PVG.1AV1	Piebald-Virol-Glaxo		Harlan UK, Blackthorn, Bicester, UK	congenic	Unknown																				RRID:RGD_737658	Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany
737690	F344/Crli			Charles River, Calco, Italy	inbred	Unknown																				RRID:RGD_737690	These animals were from Charles River Italia, Calco, LC, Italy
737691	BN/Crli		<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italy	<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italy	inbred	Unknown																				RRID:RGD_737691	These animals were from Charles River Italia, Calco, LC, Italy
737703	LEW-Tg(HLA-B*0702,B2M)120-4Trg<sup>Tg/Tg</sup>		<a href=http://www.rrrc.us/Strain/?x=42>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=42>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08)																				RRID:RRRC_00042	Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity.
737857	DA.PVG.1AV1-(<i>D4Rat155-D4Rat84</i>)		Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden		congenic	Unknown				4	185398415	185398530	1 - by flanking markers	4	47848402	246313537	1 - by flanking markers	4	48053950	182171018	1 - by flanking markers	4	49524674	180699135	1 - by flanking markers	RRID:RGD_737857	Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.
737858	DA.PVG.1AV1-(<i>D4Rat155-Spr</i>)		Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden		congenic	Unknown		Spr	3753	4	119365578	119369308	1 - by flanking markers	4	47848402	181496612	1 - by flanking markers	4	48053950	116916073	1 - by flanking markers	4	49524674	117676292	1 - by flanking markers	RRID:RGD_737858	Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.
737859	DA.PVG.1AV1-(<i>D4Mgh17-D4Rat56</i>)		Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden		congenic	Unknown				4	116611031	143663540	1 - by flanking markers	4	177782842	204673386	1 - by flanking markers	4	113100978	113247809	1 - by flanking markers	4	114921280	114921417	1 - by flanking markers	RRID:RGD_737859	Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.
737861	DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)		Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden		congenic	Unknown				4	156442644	161435775	1 - by flanking markers	4	219683260	224843794	1 - by flanking markers	4	152598827	157826751	1 - by flanking markers	4	153274175	158112799	1 - by flanking markers	RRID:RGD_737861	Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.
737862	SHRSP.WKY-(<i>D2Rat14-D2Mit5</i>)/Gcrc		University of Glasgow, Glasgow, UK		congenic	Unknown				2	66680022	66680209	1 - by flanking markers	2	61825950	86560306	1 - by flanking markers	2	42776916	66828236	1 - by flanking markers	2	42804607	66118463	1 - by flanking markers	RRID:RGD_737862	A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.
737863	SHRSP.WKY-(<i>D2Wox9-D2Mgh12</i>)/Gcrc		University of Glasgow, Glasgow, UK		congenic	Unknown		Gstm1	2755	2	141259937	210636169	1 - by flanking markers	2	161271919	235592880	1 - by flanking markers	2	141583337	217498710	1 - by flanking markers	2	136445150	202447032	1 - by flanking markers	RRID:RGD_737863	A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP
737864	SS.SR-(<i>D13Mit9-D13Mit1</i>)/Jr		J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA		congenic	Unknown				13	25430110	55033994	1 - by flanking markers	13	14281836	63533335	1 - by flanking markers	13	9016742	58537177	1 - by flanking markers	13	5994668	53050594	1 - by flanking markers	RRID:RGD_737864	Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain.
737865	WKY.SHRSP-(<i>D2Rat14-D2Mgh12</i>)		University of Glasgow, Glasgow, UK		congenic	Unknown				2	210636008	210636169	1 - by flanking markers	2	61825950	235592880	1 - by flanking markers	2	42776916	217498710	1 - by flanking markers	2	42804607	202447032	1 - by flanking markers	RRID:RGD_737865	A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY.
737866	WKY.SHRSP-(<I>D2Rat14-D2Mit5</I>)		University of Glasgow, Glasgow, UK		congenic	Unknown				2	66680022	66680209	1 - by flanking markers	2	61825950	86560306	1 - by flanking markers	2	42776916	66828236	1 - by flanking markers	2	42804607	66118463	1 - by flanking markers	RRID:RGD_737866	A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY
737867	SS.SR-(<I>D13N1-D13Mit1</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				13	25430110	38985930	1 - by flanking markers	13	14281836	48881269	1 - by flanking markers	13	9016742	43785939	1 - by flanking markers	13	5994668	37902821	1 - by flanking markers	RRID:RGD_737867	Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strain
737868	SS.SR-(<I>Syt2-D13Mit1</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Syt2	3804	13	25430110	47699094	1 - by flanking markers	13	14281836	56630530	1 - by flanking markers	13	9016742	51577824	1 - by flanking markers	13	5994668	46197976	1 - by flanking markers	RRID:RGD_737868	Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strain
737869	OLETF.BN-(<I>D1Rat461-D1Rat459</I>)/Got		Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan		congenic	Unknown				1	266234605	267593558	1 - by flanking markers	1	288207586	289700417	1 - by flanking markers	1	280850604	282365384	1 - by flanking markers	1	258843780	260122809	1 - by flanking markers	RRID:RGD_737869	Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study.
737870	DA.E3-(<i>D20Wox3-D20Mgh4</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				20	3660646	6880472	1 - by flanking markers	20	6935875	7910747	1 - by flanking markers	20	4855475	5875448	1 - by flanking markers	20	3621656	6691706	1 - by flanking markers	RRID:RGD_737870	A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA.
737871	DA.E3-(<i>D12Got46-D12Rat26</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				12	23362298	23845733	1 - by flanking markers	12	27316608	30964880	1 - by flanking markers	12	25307118	29014362	1 - by flanking markers	12	22297209	22692658	1 - by flanking markers	RRID:RGD_737871	This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.
737872	DA.E3-(<i>D4Mit16-D4Mgh11</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				4	130228504	171204531	1 - by flanking markers	4	192286223	230565226	1 - by flanking markers	4	127777294	168047091	1 - by flanking markers	4	128289450	167139601	1 - by flanking markers	RRID:RGD_737872	This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.
737873	DA.E3-(<i>D6Wox5-D6Rat90</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				6	117361909	117362003	1 - by flanking markers	6	126582753	126582846	1 - by flanking markers	6	117355600	117355693	1 - by flanking markers	6	112636280	112636374	1 - by flanking markers	RRID:RGD_737873	This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.
737885	RHA/Kun	Roman high avoidance	Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands		inbred	Unknown																				RRID:RGD_737885	Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands
737886	BDX/Cub		Dept of Biology, Charles University, Prague, Czech Republic		inbred	Unknown																				RRID:RGD_737886	Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands
737887	AO/OlaHsd		<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ao-inbred-rat/> Envigo</a>	<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ao-inbred-rat/> Envigo</a>	inbred	Cryorecovery																				RRID:RGD_737887	These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands
737888	LEW/NHsdCpb			Harlan Sprague Dawley, Inc., Indianapolis, IN	inbred	Unknown																				RRID:RGD_737888	These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands
737889	LEW/Ipcv				inbred	Unknown																				RRID:RGD_737889	These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands
737891	Crl:SD			Charles River Laboratories, Inc., Wilmington, MA	outbred	Unknown																				RRID:RGD_737891	Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory.
737892	ACI/SegHsd		<a href =http://www.envigo.com/model/aci-seghsd/> Envigo</a>	<a href =http://www.envigo.com/model/aci-seghsd/> Envigo</a>	inbred	Unknown	Carcinogenesis; Estrogen-induced pituitary growth; Transplant immunology																			RRID:RGD_737892	This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc.
737893	F344/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737893	Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover
737894	LEW/Orl		Institut de Transgenose, Orleans, France		inbred	Unknown																				RRID:RGD_737894	Substrain of Lewis rats, maintained in Orleans, France
737895	WKY/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737895	Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover
737896	BN/Maas		Erasmus MC, DR Rotterdam, The Netherlands		inbred	Unknown																				RRID:RGD_737896	Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands
737897	ACI/Kun		Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands		inbred	Unknown																				RRID:RGD_737897	Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands
737898	WOKA/K		Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany		inbred	Unknown																				RRID:RGD_737898	Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany
737899	BN/Cub		Dept of Biology, Charles University, Prague, Czech Republic		inbred	Unknown																				RRID:RGD_737899	Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands
737900	WF/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737900	Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany
737901	LH/Ztu				inbred	Unknown																				RRID:RGD_737901	A substrain of LH
737902	BDIX/Orl		Institut de Transgenose, Orleans, France		inbred	Unknown																				RRID:RGD_737902	Substrain of BDIX, now maintained in Orleans, France
737903	Hsd:SD	Sprague Dawley		<a href =https://www.envigo.com/model/hsd-sprague-dawley-sd/>Envigo</a>	outbred	Unknown																				RRID:RGD_737903	Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony.
737904	U/A		The Netherlands Cancer Institute, Amsterdam, The Netherlands		inbred	Unknown																				RRID:RGD_737904	Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute
737905	LEW/Maas		University of Limburg, Netherlands		inbred	Unknown																				RRID:RGD_737905	Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers.
737906	MWF/Hsd	Munich Wistar Fromter		Harlan	inbred	Unknown (as of 2020-04-03)																				RRID:RGD_737906	Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley
737907	SS.SR-<i>Inha</i>/Jr		J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA		congenic	Unknown																				RRID:RGD_737907	A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain
737908	WF/NHsd		<a href =https://www.envigo.com/model/wf-nhsd/> Envigo</a>	<a href =https://www.envigo.com/model/wf-nhsd/> Envigo</a>	inbred	Cryopreserved Embryo (as of 2022-03-24)																				RRID:RGD_737908	Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley.
737909	R/A		The Netherlands Cancer Institute, Amsterdam, The Netherlands		inbred	Unknown																				RRID:RGD_737909	Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute
737910	ARISTORAT/Wsl		Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium		inbred	Unknown																				RRID:RGD_737910	Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium
737911	BUF/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737911	Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany
737912	SS/JrIpcv		Czech Academy of Sciences		inbred	Unknown																				RRID:RGD_737912	strain originated from Dr. John P. Rapp, Medical College of Ohio, USA
737913	E3/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737913	Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany
737914	SDL/Ipcv				inbred	Unknown																				RRID:RGD_737914	Substrain of SDL
737915	R/AWa		Dept of Genetics, Agricultural University, Wageningen, The Netherlands		inbred	Unknown																				RRID:RGD_737915	Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986
737916	DZB/Gro		Center for Biology Kerklaan, University of Groningen, The Netherlands		inbred	Unknown																				RRID:RGD_737916	Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen
737917	WF/Mol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_737917	Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark
737918	BN/Orl		Institut de Transgenose, Orleans, France		inbred	Unknown																				RRID:RGD_737918	Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France
737919	LEW/Han		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737919	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany
737920	BH/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737920	Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973
737921	BDIV/lfz				inbred	Unknown																				RRID:RGD_737921	Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971)
737922	LEW/SsNHsd		<a href=https://www.envigo.com/model/lew-lew-ssnhsd> ENVIGO </a>	<a href=https://www.envigo.com/model/lew-lew-ssnhsd> ENVIGO </a>	inbred	Unknown																				RRID:RGD_737922	Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015.
737923	SHR/Maas		Erasmus MC, DR Rotterdam, The Netherlands		inbred	Unknown																				RRID:RGD_737923	Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands
737924	WAG/Rij			Harlan Sprague Dawley, Indianapolis, IN	inbred	Unknown																				RRID:RGD_737924	Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979
737925	BN/Gro		Center for Biology Kerklaan, University of Groningen, The Netherlands		inbred	Unknown																				RRID:RGD_737925	Substrain of BN, from Billingham and Silvers 1958, to U of Groningen
737926	F344/NCrl		<a href=https://www.criver.com/products-services/find-model/fischer-sas-fisch-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/fischer-sas-fisch-rat?region=3611> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_737926	Derived from NIH stock in 1992 by SASCO. To Charles River in 1996.
737927	ALC/Colle				inbred	Unknown																				RRID:RGD_737927	Substrain of ALC
737928	BN/NHsdCpb			Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN	inbred	Unknown																				RRID:RGD_737928	Substrain of BN, from Billingham and Silvers 1958
737929	Crl:WI	Wistar rats	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	outbred	Unknown																				RRID:RGD_737929	To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis.
737930	LEW/Ztm	LEW/Ztm	Tierlaboratorium der Medizinischen Hochschule Hannover, Germany		inbred	Unknown		Ncf1	61307																	RRID:RGD_737930	This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany
737931	GC/Kun				inbred	Unknown																				RRID:RGD_737931	
737932	LEW/Crl	Lewis	<a href=https://www.criver.com/products-services/find-model/lewis-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/lewis-rat?region=3611> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_737932	Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34.
737933	SD/A		The Netherlands Cancer Institute, Amsterdam, The Netherlands		inbred	Unknown																				RRID:RGD_737933	Sprague-Dawley stock initiated by R. Dawley in 1925
737934	BN/RijKun		Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands		inbred	Unknown																				RRID:RGD_737934	Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University
737935	LEW/Nhg		Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany		inbred	Unknown																				RRID:RGD_737935	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany
737936	SR/JrIpcv		Baylor College of Medicine, Houston, TX		inbred	Unknown																				RRID:RGD_737936	Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962)
737937	SDH/Ztu				inbred	Unknown																				RRID:RGD_737937	unknown
737938	AUG/OlaHsd		<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/aug-inbred-rat/> Envigo</a>	<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/aug-inbred-rat/> Envigo</a>	inbred	Cryorecovery																				RRID:RGD_737938	Substrain of AUG, derived from US August substrains in 1951
737939	BBWB/Mol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_737939	unknown
737940	PAR/Wsl		Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium		inbred	Unknown																				RRID:RGD_737940	unknown
737941	LEP/Cub		Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic		inbred	Unknown																				RRID:RGD_737941	Substrain of LEP, from Charles University cross of outbred animals
737942	LE/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737942	Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973
737943	R/AEurRij		Dr. Adam Goedde,	Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN	inbred	Unknown																				RRID:RGD_737943	Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986
737944	BN/RijN			Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN	inbred	Extinct (as of 2023-12-14)																				RRID:RGD_737944	Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk
737945	BN/Han		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737945	Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973.
737946	WAG/OlaHsd			Harlan Sprague Dawley, Inc., Indianapolis, IN	inbred	Unknown																				RRID:RGD_737946	Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley
737947	BDII/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737947	Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971)
737948	BDE/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737948	Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color.
737949	A2/Colle		Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME		inbred	Unknown																				RRID:RGD_737949	unknown
737950	DA/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737950	Substrain of DA/OlaHsd, to Hannover after 1965
737951	CAP/Kuv		Dr. HU Wottge, Universitat Kiel, Kiel, Germany		inbred	Unknown																				RRID:RGD_737951	unknown
737952	ACI/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737952	unknown
737953	LEW/Gut				inbred	Unknown																				RRID:RGD_737953	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany
737954	AS/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737954	unknown
737955	Hooded/Colle		Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME		inbred	Unknown																				RRID:RGD_737955	unknown
737956	WF/Gut				inbred	Unknown																				RRID:RGD_737956	substrain of Wistar Furth stock, from J Furth in 1945
737957	WOKW/K		Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=513 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown	Diabetes Obesity; Metabolism																			RRID:RGD_737957	Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991
737958	CHOC/Cub		Institute of Physiology, Czech Academy of Sciences, Charles University, Prague		inbred	Unknown																				RRID:RGD_737958	unknown
737959	RNU/Mol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_737959	unknown
737960	Hsd:WI	Wistar		<a href =https://www.envigo.com/model/hsd-wi/>Envigo</a>	outbred	Unknown																				RRID:RGD_737960	These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan.
737961	SR/JrMol		Mollegaard Breeding Centre Ltd., Denmark		inbred	Unknown																				RRID:RGD_737961	Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard
737962	SPRD/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737962	Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976
737963	LEW/Cub		Institute of Physiology, Czech Academy of Sciences, Charles University, Prague		inbred	Unknown																				RRID:RGD_737963	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague
737964	BN/OlaHsd			Harlan	inbred	Unknown																				RRID:RGD_737964	Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis
737965	AGUS/OlaHsd			Harlan	inbred	Unknown																				RRID:RGD_737965	Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968
737966	LEW/Kuv		Universitat Kiel, Kiel, Germany		inbred	Unknown																				RRID:RGD_737966	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany
737967	BS/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_737967	Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988
737968	BN/Gut				inbred	Unknown																				RRID:RGD_737968	Substrain of BN, from Billingham and Silvers 1958
737969	NAR/SaU	non-albumin rat	Dept of Laboratory Animal Science, University of Utrecht, The Netherlands		inbred	Unknown																				RRID:RGD_737969	Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht
737970	AMORAT/Wsl		Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium		inbred	Unknown																				RRID:RGD_737970	unknown
737971	SHRSP/Rivm		National Institute of Public Health and Environmental Protection, The Netherlands		inbred	Unknown																				RRID:RGD_737971	unknown
737972	BN/Crl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_737972	Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976.
738038	HEP	high ethanol preferring	Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France		inbred	Unknown																				RRID:RGD_738038	High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA
738120	LEW-Tg(HLA-B*2705m1,B2M)133-1Trg<sup>Tg/Tg</sup>		<a href=http://www.rrrc.us/Strain/?x=43>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=43>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20)																				RRID:RRRC_00043	This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating.
738122	SD-Tg(UBC-EGFP)1BalRrrc		<a href=http://www.rrrc.us/Strain/?x=52>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=52>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)																				RRID:RRRC_00052	This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals.
1298093	LEW/NHsd			<a href=https://www.envigo.com/model/lew-ssnhsd/>Envigo</a>	inbred	Unknown																				RRID:RGD_1298093	Descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. Maintained at Harlan-Sprague Dawley (Indianapolis, Indiana) .
1299868	SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108875615	113014423	1 - by flanking markers	7	112367543	116100169	1 - by flanking markers	7	112429186	112429483	1 - by flanking markers	7	103146217	103146515	1 - by flanking markers	RRID:RGD_1299868	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
1299869	SS.SR-(<I>Cyp11b1</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown																				RRID:RGD_1299869	Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain
1299870	SS.LEW-(<I>D5Uia8-D5Rat108</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				5	121964356	134872385	1 - by flanking markers	5	124025017	137108002	1 - by flanking markers	5	133313668	133313852	1 - by flanking markers	5	128033842	128034027	1 - by flanking markers	RRID:RGD_1299870	SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain
1299871	DA.F344-(<I>D20Arb2-D20Arb8</I>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				20	2790511	2811567	1 - by flanking markers	20	5249981	5270235	1 - by flanking markers	20	3151815	3172069	1 - by flanking markers	20	2646395	2666654	1 - by flanking markers	RRID:RGD_1299871	Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.
1299872	DA.F344-(<I>D8Arb15-D8Arb22</I>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				8	71843628	124310337	1 - by flanking markers	8	77653284	127239929	1 - by flanking markers	8	73320439	128033168	1 - by flanking markers	8	68133439	119085047	1 - by flanking markers	RRID:RGD_1299872	Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.
1299873	SS.LEW-(<I>D5Mco34-D5Rat108</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				5	134871897	134872385	1 - by flanking markers	5	137107818	137108002	1 - by flanking markers	5	133313668	133313852	1 - by flanking markers	5	128033842	128034027	1 - by flanking markers	RRID:RGD_1299873	SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain
1299874	OLETF.F344-(<i>D1Rat166-D1Rat90</i>)/Tj		Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=94 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			1	255026793	267111153	1 - by flanking markers	1	276721459	289137268	1 - by flanking markers	1	269279863	281795785	1 - by flanking markers	1	248393012	259647894	1 - by flanking markers	RRID:RGD_1299874	Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol.
1299875	DA.F344-(<i>D7Rat22-D7Mit2</i>)/Nsi		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland.	<a href=http://www.rrrc.us/Strain/?x=679>Rat Resource and Research Center</a>	congenic	Cryopreserved Sperm (as of 2019-02-19)	arthritis/autoimmunity studies			7	76615341	123191874	1 - by flanking markers	7	125794079	125794357	1 - by flanking markers	7	126080176	126080454	1 - by flanking markers	7	116294265	116294546	1 - by flanking markers	RRID:RRRC_00679	Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state
1299876	SS.LEW-(<I>D5Rat54-D5Rat108</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				5	126386030	134872385	1 - by flanking markers	5	128816449	137108002	1 - by flanking markers	5	124957483	133313852	1 - by flanking markers	5	120182440	128034027	1 - by flanking markers	RRID:RGD_1299876	SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain
1299877	DA.F344-(<I>D10Rat204-D10Arb22</I>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				10	95695076	95695218	1 - by flanking markers	10	94240348	107484761	1 - by flanking markers	10	107857524	107857673	1 - by flanking markers	10	104060133	104060283	1 - by flanking markers	RRID:RGD_1299877	Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.
1299878	DA.F344-(<I>D4Arb30-D4Arb4</I>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				4	73972453	154937227	1 - by flanking markers	4	216606296	216606455	1 - by flanking markers	4	150682435	150682594	1 - by flanking markers	4	151805502	151805662	1 - by flanking markers	RRID:RGD_1299878	The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley
1299879	SS.SR-(<I>D7Mco7-D7Wox19</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	113044000	113044249	1 - by flanking markers	7	116151764	116152012	1 - by flanking markers	7	116249395	116249643	1 - by flanking markers	7	106839225	106839474	1 - by flanking markers	RRID:RGD_1299879	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
1299880	F344.DA-(<I>D20Arb2-D20Arb8</I>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				20	2790511	2811567	1 - by flanking markers	20	5249981	5270235	1 - by flanking markers	20	3151815	3172069	1 - by flanking markers	20	2646395	2666654	1 - by flanking markers	RRID:RGD_1299880	Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses.
1299881	SS.LEW-(<I>D5Wox3-D5Rat108</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				5	99080786	134872385	1 - by flanking markers	5	101964092	137108002	1 - by flanking markers	5	97921932	133313852	1 - by flanking markers	5	94858972	128034027	1 - by flanking markers	RRID:RGD_1299881	SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain
1300432	HAA/FDSC	Hatano High Avoidance	Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=496 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Behavior																			RRID:RGD_1300432	In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation.
1300433	LAA/FDSC	Hatano Low Avoidance	Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=497 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Behavior																			RRID:RGD_1300433	In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation.
1300439	SD-Tg(UBC-EGFP)2BalRrrc		<a href=http://www.rrrc.us/Strain/?x=65>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=65>Rat Resource and Research Center</a>	transgenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)																				RRID:RRRC_00065	This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21.
1302359	HsdFcen:SD		Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina		outbred	Unknown																				RRID:RGD_1302359	These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.
1302360	W/HsdFcen		Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina		inbred	Unknown																				RRID:RGD_1302360	These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.
1302372	SDDIO/Rrrc		<a href=http://www.rrrc.us/Strain/?x=44>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=44>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00044	This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet.
1302373	SDDR/Rrrc		<a href=http://www.rrrc.us/Strain/?x=45>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=45>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00045	This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet.
1302377	SPRD-<i>Anks6<sup>PKD</sup></i>/Rrrc		<a href=http://www.rrrc.us/Strain/?x=46>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=46>Rat Resource and Research Center</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07)		Anks6<sup>PKD</sup>	11534996	5	63633540	63674953	7	5	67163440	67204853	7	5	62642974	62684387	7	5	61309183	61350596	7	RRID:RRRC_00046	From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002.
1302416	ACI.DA-(<i>D10Rat2-D10Rat19</i>)/Arb		Center for Genomics and Human Genetics, Manhasset, New York		congenic	Unknown																				RRID:RGD_1302416	A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd.
1302597	LEXF7C/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=232 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=232 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302597	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302598	FXLE26/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=264 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=264 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Live Animals; Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302598	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302599	WKY/Ta		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=419 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=419 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302599	This strain originated from Takeda Chemical Industries, Ltd., Japan
1302600	HTX/Kyo	hydrocephalus texas	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=3 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=3 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Neurobiology																			RRID:RGD_1302600	1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.
1302601	FXLE23/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=261 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=261 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302601	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302602	FXLE12/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=250 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=250 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302602	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302603	FXLE25/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=263 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=263 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302603	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302604	LEXF4/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=226 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=226 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302604	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302605	LEXF2A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=222 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=222 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Live Animals	Diabetes Obesity; Cancer																			RRID:RGD_1302605	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302606	SHRSP/Ta		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=414 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=414 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Cardio Hypertension																			RRID:RGD_1302606	This strain originated from Takeda Chemical Industries, Ltd., Japan
1302607	FXLE21/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=259 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=259 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302607	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302608	CXH6/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=506 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=506 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302608	Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan
1302610	KMI/Tky	miniature rat ishikawa	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=29 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=29 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Osteosis	Prkg2	3401																	RRID:RGD_1302610	Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College.
1302611	FXLE24/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=262 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=262 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302611	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302612	LEXF10C/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=238 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=238 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302612	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302613	BN/fMaiHok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=65 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=65 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo																				RRID:RGD_1302613	Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21
1302614	WKY/NMna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=460 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=460 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302614	Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain.
1302615	FXLE14/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=252 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=252 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302615	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302616	LEXF10B/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=237 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=237 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302616	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302617	LEXF6B/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=228 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=228 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302617	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302618	LEXF9/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=235 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=235 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Live Animals; Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302618	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302619	FXLE16/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=254 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=254 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Live Animals; Cryopreserved Embryo (as of 2023-10-16)	Diabetes Obesity; Cancer																			RRID:RGD_1302619	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302620	SHR/Kyo	spontaneous hypertension rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=9 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=9 > National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12)	Cardio Hypertension																			RRID:RGD_1302620	Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).
1302621	LEXF10A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=236 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=236 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302621	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302622	WF/Kop		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=510 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=510 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_1302622	Inbred originated from Kagoshima University, Japan.
1302623	TM/Kyo	tester moriyama rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=10 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=10 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Hematology	Rab38<sup>ru</sup>	1600311	1	144783919	144864573	7	1	158385888	158466621	7	1	152072764	152072764	8	1	142182614	142182614	8	RRID:RGD_1302623	Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 .
1302624	RICO/Ngs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=479 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=479 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension; Ophthalmology																			RRID:RGD_1302624	Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan.
1302625	F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				16	51452966	77968799	1 - by flanking markers	16	51050772	77759249	1 - by flanking markers	16	51339600	78172206	1 - by flanking markers	16	48143982	73187298	1 - by flanking markers	RRID:RGD_1302625	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302626	BN.UPL-(<I>D2Rat134-D2Rat2</I>)/Cas		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=473 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=473 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Ophthalmology			2	14747814	190963154	1 - by flanking markers	2	14095321	217785884	1 - by flanking markers	2	14237830	198298901	1 - by flanking markers	2	16491740	183719262	1 - by flanking markers	RRID:RGD_1302626	Strain originated from Hiroshima University, Japan
1302627	F344/NSlc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=379 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=379 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_1302627	Strain originated from Japan SLC, Inc, Shizuoka, Japan.
1302628	ACIS/Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=63 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=63 > National BioResource Project for the Rat in Japan</a>	coisogenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302628	Spontaneous mutation from ACI/Hok in 1981.
1302629	WKY.SHRSP-(<I>D1Rat49-D1Rat112</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=314 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=314 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302629	The desired fragment is transferred from SHRSP to WKY.
1302630	F344.OLETF-(<I>D10Wox7-D10Wox6</I>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=77 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=77 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			10	103550924	103551039	1 - by flanking markers	10	102101261	102101375	1 - by flanking markers	10	102427604	102427718	1 - by flanking markers	10	98952626	98952741	1 - by flanking markers	RRID:RGD_1302630	Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.
1302631	BN/SsNSlc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=371 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=371 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Sperm	Immunology																			RRID:RGD_1302631	Strain originated from Japan SLC, Inc, Shizuoka, Japan.
1302632	WKY.SHRSP-(<I>D1Smu11-D1Arb21</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=313 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=313 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302632	The desired fragment is transferred from SHRSP to WKY.
1302633	FXLE20/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=258 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=258 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302633	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302634	BB/WorTky	BioBreeding rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=30 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=30 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Diabetes Obesity; Immunology																			RRID:RGD_1302634	Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983.
1302635	F344.OLETF-(<i>D12Rat8-D12Rat16</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				12	23934730	31489223	1 - by flanking markers	12	27805580	36160041	1 - by flanking markers	12	25799119	34265075	1 - by flanking markers	12	22779459	30427275	1 - by flanking markers	RRID:RGD_1302635	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302636	WKY.SHRSP-(<I>D1Wox29-D1Arb21</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=318 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=318 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	124614679	187092492	1 - by flanking markers	1	131822204	206277202	1 - by flanking markers	1	130779148	199254774	1 - by flanking markers	1	123350408	182418476	1 - by flanking markers	RRID:RGD_1302636	This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background
1302637	LAA	Hatano Low Avoidance	Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan		inbred	Unknown																				RRID:RGD_1302637	Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan
1302638	LEXF11/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=239 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=239 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302638	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302639	KHR/Kyo	kaken hairless rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=4 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=4 > National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Dermatology	Oca2	2318412					1	115683593	115991040	7	1	114661970	114987433	7	1	107116278	107446093	7	RRID:RGD_1302639	Kaken hairless rat were detected by Kimura from Gunn
1302640	ACI/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=501 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=501 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo																				RRID:RGD_1302640	Strain originated from The University of Tokushima, Tokushima, Japan.
1302641	LEXF1A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=219 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=219 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302641	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302642	LEA/Hkm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=495 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=495 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo																				RRID:RGD_1302642	Strain originated at the University of Tokushima, Japan.
1302643	ACI/NKyo	august copenhagen irish	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=6 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=6 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Reproduction																			RRID:RGD_1302643	NIH (1988, F143) > Kyo (F43)
1302644	CXA5/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=505 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=505 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302644	Strain originated at the University of Tokushima, Japan.
1302645	DMY/Kyo	demyelination rat	The Laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991 via Institute Pasteur, Paris	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=8 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29)	Neurobiology	Mrs2<sup>dmyKyo</sup>	12793071	17	47124915	47142840	7	17	43932146	43951399	7	17	42064271	42083602	7	17	40063924	40087073	7	RRID:RGD_1302645	From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996).
1302646	LEXF2C/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=224 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=224 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302646	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302647	F344.OLETF-(<i>D5Rat166-D5Rat90</i>)/Tj		Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan		congenic	Unknown				5	137718909	139664499	1 - by flanking markers	5	140063670	141938308	1 - by flanking markers	5	136271682	138128882	1 - by flanking markers	5	130881210	132691399	1 - by flanking markers	RRID:RGD_1302647	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302648	LEC/Hok	Long Evans Cinnamon	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=71 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=71 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown (as of 2016-12-01)	Cancer; Immunology	Atp7b<sup>hts</sup>	11532742	16	74607988	74680080	7	16	74495179	74575822	7	16	74865516	74944935	7	16	69952286	70024404	7	RRID:RGD_1302648	At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991.
1302649	LEXF7B/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=231 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=231 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302649	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302650	F344.OLETF-(<i>D9Mgh8-D9Rat15</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				9	33374546	62634991	1 - by flanking markers	9	40808491	71887966	1 - by flanking markers	9	41139089	70686886	1 - by flanking markers	9	36840385	65383934	1 - by flanking markers	RRID:RGD_1302650	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302651	CXA1/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=504 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=504 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302651	Strain originated from the The University of Tokushima, Japan.
1302652	LEXF7A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=230 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=230 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302652	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302653	LEXF8A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=233 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=233 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302653	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302654	F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=81 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=81 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	103612739	123191874	1 - by flanking markers	7	106942155	125794357	1 - by flanking markers	7	106995385	126080454	1 - by flanking markers	7	98011396	116294546	1 - by flanking markers	RRID:RGD_1302654	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred.
1302655	TO/Hkm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=493 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=493 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo																				RRID:RGD_1302655	Strain originated from the Graduate School of Medicine, Hokkaido University, Japan.
1302656	LEA/Hok	Long Evans Agouti	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=70 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=70 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown (as of 2016-12-01)																				RRID:RGD_1302656	Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2).
1302657	DOP/Nem	dilute-opisthotonus (dop)	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=151 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=151 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology	Myo5a	3143																	RRID:RGD_1302657	Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established.
1302658	LEJ/Hkm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=494 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=494 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_1302658	Strain originated at the Graduate School of Medicine, Hokkaido University, Japan.
1302659	CXH5/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=508 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=508 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302659	Strain originated at the University of Tokushima, Japan.
1302660	RCS/Kyo	royal college of surgeons rat	Department of Ophthalmology & Visual Sciences, Kyoto University	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=27 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29)	Ophthalmology	Mertk<sup><i>rdy</i></sup>	40902839	3	116308387	116416414	7	3	128669534	128777078	7	3	121235230	121340932	7	3	115939351	116045141	7	RRID:RGD_1302660	From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998.
1302661	F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=87 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=87 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	41707592	1 - by flanking markers	14	2222207	61886417	1 - by flanking markers	14	2227825	61783215	1 - by flanking markers	14	1217606	39153750	1 - by flanking markers	RRID:RGD_1302661	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred.
1302662	CXH2/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=509 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=509 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302662	Strain originated at the University of Tokushima, Japan.
1302663	F344.OLETF-(<i>D11Rat4-D11Rat1</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				11	64573222	84443333	1 - by flanking markers	11	66731054	89693367	1 - by flanking markers	11	65352097	86593596	1 - by flanking markers	11	62790342	82450994	1 - by flanking markers	RRID:RGD_1302663	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302664	WNA/Nshm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=149> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=149> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302664	Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research
1302665	FXLE13/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=251 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=251 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302665	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302666	LEXF1C/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=221 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=221 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302666	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302667	F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				5	45499364	115361927	1 - by flanking markers	5	49028773	117961491	1 - by flanking markers	5	44404276	114014945	1 - by flanking markers	5	43726656	109897936	1 - by flanking markers	RRID:RGD_1302667	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302668	IS-<I>Tlk</I>/Kyo	tail anomaly lethal kyoto	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=25 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=25 > National BioResource Project for the Rat in Japan</a>	coisogenic	Cryopreserved Embryo; Cryopreserved Sperm	Osteosis																			RRID:RGD_1302668	Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto)
1302669	HAA	Hatano High Avoidance	Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan		inbred	Unknown																				RRID:RGD_1302669	Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan.
1302670	ACI/NSlc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=381 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=381 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_1302670	Strain is from Japan SLC, Inc., Shizuoka, Japan.
1302671	WM/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=503 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=503 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302671	Strain is from the University of Tokushima, Japan.
1302672	W/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=13 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=13 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302672	Hok>Hkm>Kyo
1302673	FXLE15/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=253 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=253 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302673	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302674	VF/Kyo	vacuole formation rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=21 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=21 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10)	Neurobiology																			RRID:RGD_1302674	The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat.
1302675	WKY.SHRSP-(<I>D1Smu13-D1Smu11</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=319 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=319 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302675	The desired fragment is transferred from SHRSP to WKY.
1302676	NER/Slc	noda epileptic rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=382 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=382 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Neurobiology																			RRID:RGD_1302676	Strain is from Japan SLC, Inc. Shizuoka, Japan.
1302677	NIG-III/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=502 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=502 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo																				RRID:RGD_1302677	Strain is from the University of Tokushima, Japan.
1302678	NAR/Slc	non albumin rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=375 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=375 > National BioResource Project for the Rat in Japan</a>	mutant	Live Animals (as of 2024-09-24)	Hematology																			RRID:RGD_1302678	Strain originated from Japan SLC, Inc, Shizuoka, Japan.
1302679	TRMR/Kyo	tremor resistant	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=12 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=12 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Unknown		Aspa	621693																	RRID:RGD_1302679	Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM.
1302680	SHR/Ta		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=418 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=418 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Cardio Hypertension																			RRID:RGD_1302680	Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan.
1302681	WKY.SHRSP-(<I>D1Smu11-D1Rat112</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=325 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=325 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302681	The desired fragment is transferred from SHRSP to WKY.
1302682	FXLE18/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=256 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=256 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302682	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302683	FXLE22/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=260 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=260 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Live Animals	Diabetes Obesity; Cancer																			RRID:RGD_1302683	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302684	F344/NHok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=68 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=68 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown																				RRID:RGD_1302684	Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals
1302685	F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=99 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=99 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	32584630	70077314	1 - by flanking markers	14	32389647	69559504	1 - by flanking markers	14	32593926	69517234	1 - by flanking markers	14	30320092	65026991	1 - by flanking markers	RRID:RGD_1302685	Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment.
1302686	F344/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=266 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=266 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302686	Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating.
1302687	WKAH/HkmSlc	Wistar King A, Hokkaido	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=376 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=376 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_1302687	Strain originated from Japan SLC, Inc., Shizuoka, Japan.
1302688	ACI/NMna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=461 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=461 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302688	This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan.
1302689	WKY.SHRSP-(<I>Ntrk3-D1Smu13</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=320 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=320 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302689	The desired fragment is transferred from SHRSP to WKY.
1302690	FXLE19/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=257 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=257 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302690	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302691	ALB/Hok	Albany	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=64 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=64 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Dentistry																			RRID:RGD_1302691	Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok)
1302692	WKY.SHRSP-(<I>D1Wox18-D1Rat44</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=323 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=323 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302692	The desired fragment is transferred from SHRSP to WKY.
1302693	KZ-<I>Lepr</I><sup>faTky</sup>		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=32 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=32 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Metabolism	Lepr	3001																	RRID:RGD_1302693	A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980.
1302694	WKA/Seac		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=112 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=112 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Immunology																			RRID:RGD_1302694	Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979
1302695	SER/Kyo	spontaneously epileptic rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=28 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=28 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology	Atrn|Aspa	69063|621693																	RRID:RGD_1302695	Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac
1302696	FH/HamSlc	fawn hooded rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=384 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=384 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Cardio Hypertension																			RRID:RGD_1302696	Strain originated at Japan SLC, Inc., Shizuoka , Japan.
1302697	KND/Tky	komeda non-diabetic rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=16 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=16 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_1302697	Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls.
1302698	SDR/Slc	Spontaneous dwarf rat	Japan SLC, Inc	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=373 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=66>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04)	Metabolism	Gh1<sup>sdr</sup>	12880380	10	95692240	95694117	7	10	94237414	94239391	7	10	94486878	94486878	8	10	91228776	91228776	8	RRID:RRRC_00066	The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Judging from this point mutation, one would predict an abnormal splicing and a 1-base deletion in the GH mRNA. Strain is from Japan SLC, Inc., Shizuoka, Japan.
1302699	LEXF8D/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=234 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=234 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302699	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302700	HOB/Snk	hobble rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=154 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=154 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Neurobiology	Unc5c|Unc5c<sup>hob</sup>	735109|12802353	2	239365109	239721231	7	2	265573406	265926229	7	2	247045813	247397483	7	2	230180353	230535219	7	RRID:RGD_1302700	HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13.
1302701	LEW/SsNSlc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=372 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=372 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2020-08-26)	Immunology																			RRID:RGD_1302701	Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan.
1302702	TRM/Kyo	tremor rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=11 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=11 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)	Neurobiology	Aspa|Hcn1<sup>A354V</sup>	621693|13464319																	RRID:RGD_1302702	In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010)
1302703	WKY.SHRSP-(<I>D1Wox29-D1Rat112</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=315 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=315 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302703	The desired fragment is transferred from SHRSP to WKY.
1302704	WKY.SHRSP-(<I>D1Wox29-D1Rat199</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=321 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=321 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302704	The desired fragment is transferred from SHRSP to WKY.
1302705	WKY.SHRSP-(<I>D1Wox29-D1Smu13</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=322 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=322 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302705	The desired fragment is transferred from SHRSP to WKY.
1302706	F344.OLETF-(<i>D5Rat32-D5Rat26</i>)/Tj			National BioResource Project for the Rat in Japan	congenic	Unknown				5	119332868	139659574	1 - by flanking markers	5	121495621	141933383	1 - by flanking markers	5	117554114	138123957	1 - by flanking markers	5	113558156	132686472	1 - by flanking markers	RRID:RGD_1302706	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302707	LEXF3/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=225 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=225 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302707	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302708	FXLE17/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=255 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=255 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Diabetes Obesity; Cancer																			RRID:RGD_1302708	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.
1302709	WKY/Hcm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=442 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=442 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension																			RRID:RGD_1302709	Strain is from the Hyogo College of Medicine, Japan.
1302710	LEXF2B/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=223 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=223 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302710	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302711	ExHC/Seac		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=115 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=115 > National BioResource Project for the Rat in Japan</a>	inbred	Unknown																				RRID:RGD_1302711	Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993
1302712	ZIMY/Kyo	Zitter Masao Yamada	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=24 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=24 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17)	Neurobiology	Atrn	69063	3	118539268	118701177	7	3	129934303	130067267	7	3	123434409	123567922	7	3	118110320	118244326	7	RRID:RGD_1302712	ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada)
1302713	F344.OLETF-(<i>D8Rat58-D8Mgh17</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90 > National BioResource Project for the Rat in Japan</a>	congenic	Unknown				8	19796514	48675424	1 - by flanking markers	8	21850030	48631820	1 - by flanking markers	8	50007641	50007776	1 - by flanking markers	8	46008836	46008974	1 - by flanking markers	RRID:RGD_1302713	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
1302714	KZC/Tky	Komeda Zucker Creeping rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=20 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=20 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology	Reln	3553																	RRID:RGD_1302714	Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983.
1302715	WKY.SHRSP-(<I>D1Wox18-D1Wox29</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=324 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=324 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302715	The desired fragment is transferred from SHRSP to WKY.
1302716	OM/NSlc	Osborne-Mendel rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=385 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=385 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals																				RRID:RGD_1302716	The Instutite of Medical Science, The University of Tokyo to Slc (1985)
1302717	ACI/NHok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=62 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=62 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_1302717	NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135
1302718	HWY/Slc	hairless wistar yagi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=374 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=374 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Dermatology																			RRID:RGD_1302718	Strain is from Japan SLC, Inc., Shizuoka, Japan.
1302719	DON/Kyo	Donryu rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1302719	Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2
1302720	CXH10/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=507 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=507 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo	Metabolism; Immunology																			RRID:RGD_1302720	Strain is from the University of Tokushima, Japan.
1302721	LEC/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=80 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=80 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo (as of 2024-09-24)	Cancer	Atp7b<sup>hts</sup>	11532742	16	74607988	74680080	7	16	74495179	74575822	7	16	74865516	74944935	7	16	69952286	70024404	7	RRID:RGD_1302721	Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989
1302722	PVG/Seac	Piebald Virol Glaxo	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=113 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=113 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Immunology																			RRID:RGD_1302722	Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan.
1302723	LEXF5/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=227 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=227 > National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer																			RRID:RGD_1302723	This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.
1302724	SHR/Hcm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=441 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=441 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo (as of 2024-09-24)	Cardio Hypertension																			RRID:RGD_1302724	Strain is from the Hyogo College of Medicine, Japan.
1302726	ZI/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=23 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=23 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Neurobiology	Atrn<sup><i>zi</i></sup>	40902832	3	118539268	118701177	7	3	129934303	130067267	7	3	123434409	123567922	7	3	118110320	118244326	7	RRID:RGD_1302726	Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo.
1302727	SHRSR/Ta		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=416 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=416 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Cardio Hypertension																			RRID:RGD_1302727	Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan.
1302728	MES/Slc	Matsumoto Eosinophilia Shinshu	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=383> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=383> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Hematology	Cyba<sup>m1Sdi</sup>	13209000	19	52713150	52721609	7	19	65959818	65967224	7	19	55252024	55252027	8	19	50489921	50489924	8	RRID:RGD_1302728	Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999)
1302729	LEA/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=79 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=79 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Cancer																			RRID:RGD_1302729	Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989
1302795	HTG	Prague hypertriglyceridemic	Institute of Physiology, Academy of Sciences Prague, Czech Republic		inbred	Unknown																				RRID:RGD_1302795	These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding.
1302921	F344-Tg(NPHS2-HBEGF)Wig		Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan		transgenic	Unknown																				RRID:RGD_1302921	hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs.
1303393	LEC/Ncu		Nagoya City University Medical School, Nagoya, Aichi, Japan		inbred	Unknown																				RRID:RGD_1303393	These rats were established from a closed colony of Long-Evans.
1304487	BBDR/Wor				inbred	Unknown																				RRID:RGD_1304487	Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies.
1331811	LEW.BN-(<i>D10Rat32-D10Rat133</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	53786347	65668639	1 - by flanking markers	10	53381898	64823355	1 - by flanking markers	10	53630865	53631032	1 - by flanking markers	10	51779662	51779830	1 - by flanking markers	RRID:RGD_1331811	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331812	LEW.BN-(<i>D10Rat83-D10Rat133</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	46860047	65668639	1 - by flanking markers	10	46728252	64823355	1 - by flanking markers	10	46955258	46955430	1 - by flanking markers	10	45393829	45394002	1 - by flanking markers	RRID:RGD_1331812	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331813	BN.GK-(<i>D8Rat29-D8Got130</i>)/Ox		Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				8	74769551	87069779	1 - by flanking markers	8	76345502	89012772	1 - by flanking markers	8	89482236	89482480	1 - by flanking markers	8	82872062	82872307	1 - by flanking markers	RRID:RGD_1331813	This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
1331814	BN.GK-(<i>D8Got302-D8Got130</i>)/Ox		Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				8	48185711	87069779	1 - by flanking markers	8	48160321	89012772	1 - by flanking markers	8	49533872	89482480	1 - by flanking markers	8	45539309	82872307	1 - by flanking markers	RRID:RGD_1331814	This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
1331815	LEW/Mol	LEW/Mol	Mollegaard Breeding Center Ltd., Denmark		inbred	Unknown		Ncf1	61307																	RRID:RGD_1331815	This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe)
1331816	DA.ACI-(<i>D10Rat2-D10Rat29</i>)/Kini		Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1117> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Neurobiology; Immunology			10	68842878	68843272	1 - by flanking markers	10	67642121	110568670	1 - by flanking markers	10	67988035	110992275	1 - by flanking markers	10	107057622	107057807	1 - by flanking markers	RRID:RGD_1331816	(DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA.
1331817	BN.LEW-(<i>D10Rat32-D10Mgh4</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	53786347	96799937	1 - by flanking markers	10	53381898	95372987	1 - by flanking markers	10	53630865	95638337	1 - by flanking markers	10	51779662	92369470	1 - by flanking markers	RRID:RGD_1331817	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.
1331818	LEW.BN-(<i>D10Rat43-D10Mco4</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	23428127	42042465	1 - by flanking markers	10	22266756	41793199	1 - by flanking markers	10	22402817	41976505	1 - by flanking markers	10	22918268	40741723	1 - by flanking markers	RRID:RGD_1331818	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331819	F344/Eer	F344/Eer	Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois		inbred	Unknown																				RRID:RGD_1331819	Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana
1331820	LEW.BN-(<i>D10Got9-D10Rat2</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	5641331	5641541	1 - by flanking markers	10	4578252	110568670	1 - by flanking markers	10	5760565	110992275	1 - by flanking markers	10	5684047	107057807	1 - by flanking markers	RRID:RGD_1331820	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331821	LEW.BN-(<i>D10Wox26-D10Arb4</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	30343658	46737218	1 - by flanking markers	10	30131785	46592053	1 - by flanking markers	10	30303447	46835685	1 - by flanking markers	10	29659462	45274336	1 - by flanking markers	RRID:RGD_1331821	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331822	DA.ACI-(<i>D10Rat2-D10Rat6</i>)		Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden		congenic	Unknown				10	106310811	106310957	1 - by flanking markers	10	104746165	110568670	1 - by flanking markers	10	105077900	110992275	1 - by flanking markers	10	101435864	107057807	1 - by flanking markers	RRID:RGD_1331822	DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.
1331823	LEW.BN-(<i>D10Rat43-D10Rat27</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	23428127	77092169	1 - by flanking markers	10	22266756	74127968	1 - by flanking markers	10	22402817	75983805	1 - by flanking markers	10	22918268	73453136	1 - by flanking markers	RRID:RGD_1331823	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331824	DA.ACI-(<i>D10Rat219-D10Rat29</i>)		Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden		congenic	Unknown				10	68842878	81986757	1 - by flanking markers	10	67642121	80884595	1 - by flanking markers	10	67988035	81042642	1 - by flanking markers	10	78306880	78307017	1 - by flanking markers	RRID:RGD_1331824	DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.
1331826	LEW.BN-(<i>D10Mgh7-D10Rat27</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	56170962	77092169	1 - by flanking markers	10	55720558	74127968	1 - by flanking markers	10	55978483	75983805	1 - by flanking markers	10	54098674	73453136	1 - by flanking markers	RRID:RGD_1331826	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331827	DA.ACI-(<i>D10Rat10-D10Rat142</i>)		Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden		congenic	Unknown				10	92448353	100301488	1 - by flanking markers	10	91113514	98868127	1 - by flanking markers	10	91345679	99171690	1 - by flanking markers	10	88207600	95803900	1 - by flanking markers	RRID:RGD_1331827	DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.
1331828	DA.ACI-(<i>D10Rat12-D10Rat144</i>)		Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden		congenic	Unknown				10	86290650	99198997	1 - by flanking markers	10	85276455	97759008	1 - by flanking markers	10	85487741	98044833	1 - by flanking markers	10	82538790	94725019	1 - by flanking markers	RRID:RGD_1331828	DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.
1331829	BN.LEW-(<i>D9Got8-D9Got200</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				9	3811425	3811711	1 - by flanking markers	9	2597055	9698468	1 - by flanking markers	9	2657610	10706733	1 - by flanking markers	9	1185844	4302019	1 - by flanking markers	RRID:RGD_1331829	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.
1331830	F344.BN-(<i>D5Rat1-D5Mit5</i>)/Dlw		Department of Biological Sciences, Oakland University, Rochester, MI		congenic	Unknown				5	35911094	109163425	1 - by flanking markers	5	39876314	112058005	1 - by flanking markers	5	35225432	108092802	1 - by flanking markers	5	34730116	104251008	1 - by flanking markers	RRID:RGD_1331830	This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA
1331831	LEW.BN-(<i>D10Rat173-D10Rat133</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	37505289	65668639	1 - by flanking markers	10	37209026	64823355	1 - by flanking markers	10	37435916	37436126	1 - by flanking markers	10	36244402	36244613	1 - by flanking markers	RRID:RGD_1331831	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.
1331832	BN.LEW-(<i>D10Rat72-D10Arb4</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	46737116	46737218	1 - by flanking markers	10	46591952	46592053	1 - by flanking markers	10	46835584	46835685	1 - by flanking markers	10	45274234	45274336	1 - by flanking markers	RRID:RGD_1331832	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.
1331833	DA.ACI-(<i>D10Rat15-D10Rat29</i>)		Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden		congenic	Unknown				10	68842878	96667338	1 - by flanking markers	10	67642121	95243104	1 - by flanking markers	10	67988035	95508221	1 - by flanking markers	10	92238327	92238497	1 - by flanking markers	RRID:RGD_1331833	DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.
1331834	BN.LEW-(<i>D10Rat100-D10Rat126</i>)/Rj		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	26434477	26434620	1 - by flanking markers	10	26363403	42526523	1 - by flanking markers	10	26517020	42716241	1 - by flanking markers	10	25790546	41482228	1 - by flanking markers	RRID:RGD_1331834	This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.
1331836	WKY/Eer	WKY/Eer	Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois		inbred	Unknown																				RRID:RGD_1331836	Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana
1354669	BN/OrlIcoCrlf		<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> France	<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> France	inbred	Unknown																				RRID:RGD_1354669	Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991.
1354670	F344/IcoCrlf		<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> France	<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> France	inbred	Unknown																				RRID:RGD_1354670	These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France.
1357172	WF.BBDR-(<i>D4Arb29-D4Rat44</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	63276741	121645621	1 - by flanking markers	4	63250011	183837621	1 - by flanking markers	4	63537179	63537431	1 - by flanking markers	4	64528739	64528994	1 - by flanking markers	RRID:RGD_1357172	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357173	SS.MNS-(<i>Vamp2-D10M11Mit84</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Vamp2	3949	10	55848264	55852132	1 - by flanking markers	10	55418231	55422465	1 - by flanking markers	10	55675171	55679405	1 - by flanking markers	10	53793581	53797815	1 - by flanking markers	RRID:RGD_1357173	This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.
1357174	BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/Rhw		Department of Medicine University of Washington, Seattle, Washington		congenic	Unknown				4	75732943	78039637	1 - by flanking markers	4	141978848	144249450	1 - by flanking markers	4	77307388	79575658	1 - by flanking markers	4	76647384	78882945	1 - by flanking markers	RRID:RGD_1357174	S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein.
1357175	F344.DR-(<i>D4Mit6-D4Mit24</i>)-Tg(Gimap5)Mcwi		Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin		transgenic	Unknown																				RRID:RGD_1357175	Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(<i>D4Mit6-D4Mit24</i>)
1357176	WF.BBDR-(<i>D4Arb29-D4Rat96</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	63276741	65434807	1 - by flanking markers	4	63250011	65397196	1 - by flanking markers	4	63537179	65577249	1 - by flanking markers	4	64528739	66609456	1 - by flanking markers	RRID:RGD_1357176	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357177	F344.DR(DP)-(<i>D4Mit6-D4Mit24</i>)/Rhw		Department of Medicine University of Washington, Seattle, Washington	<a href=http://www.rrrc.us/Strain/?x=82>Rat Resource & Research Center</a>	congenic	Cryopreserved Embryo				4	75732943	78039637	1 - by flanking markers	4	141978848	144249450	1 - by flanking markers	4	77307388	79575658	1 - by flanking markers	4	76647384	78882945	1 - by flanking markers	RRID:RRRC_00082	The lymphopenia locus from BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding.
1357178	CD	Cohen diabetic rat	Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		inbred	Unknown																				RRID:RGD_1357178	Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism.
1357179	SS.WKY-(<i>D2N35-Mme</i>),MNS-(<i>D10Mit11-D10M11Mit119</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown																				RRID:RGD_1357179	SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F<sub>1</sub> were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating
1357180	SS.LEW-(<I>D8Chm14-D8Rat16</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown		Grik4	2734	8	45510258	98878889	1 - by flanking markers	8	45279673	100781055	1 - by flanking markers	8	46804134	101305168	1 - by flanking markers	8	42903043	94388843	1 - by flanking markers	RRID:RGD_1357180	Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada
1357181	CDR/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel		inbred	Unknown																				RRID:RGD_1357181	Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.
1357182	Eker-Tg(Tsc2)28Hin		Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan		transgenic	Unknown		Tsc2	3908																	RRID:RGD_1357182	Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.
1357183	SS.MNS-(<i>D10Mco10-Aldoc</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown		Nos2	3185	10	6849272	65072453	1 - by flanking markers	10	5706467	65456957	1 - by flanking markers	10	6908932	66221621	1 - by flanking markers	10	6813971	63851208	1 - by flanking markers	RRID:RGD_1357183	This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.
1357184	Crl:ZUC-<I>Lepr</I><sup>fa</sup>	Zucker rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown		Lepr<sup>fa</sup>	13432153																	RRID:RGD_1357184	The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company.
1357185	RHA.Gunn-<i>Ugt1a1</i><sup>j</sup>/N		Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA		congenic	Unknown																				RRID:RGD_1357185	RHA/N rats were crossed with Gunn rats. F<sub>1</sub> hybrids were intercrossed for 12 cycles while selecting for jaundice loci.
1357186	Gunn-<i>Ugt1a1</i><sup>j</sup>/BluHsd	Gunn rat		Harlan	mutant	Unknown		Ugt1a1<sup>j</sup>	13432064	9	87091241	87098362	7	9	94982916	94990037	7	9	95300017	95300017	8	9	88805660	88805660	8	RRID:RGD_1357186	This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.
1357187	WF.BBDR-(<i>D4Rat16-D4Got39</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	56704868	56704967	1 - by flanking markers	4	56868238	56868336	1 - by flanking markers	4	57101077	57101175	1 - by flanking markers	4	58432133	58432232	1 - by flanking markers	RRID:RGD_1357187	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357189	SS.LEW-(<I>D8Rat56-D8Rat51</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				8	8294860	29559867	1 - by flanking markers	8	9505886	30947391	1 - by flanking markers	8	9531047	30918267	1 - by flanking markers	8	8462195	28243068	1 - by flanking markers	RRID:RGD_1357189	Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada
1357190	SS.MNS-(<I>Adh1-D2Mit5</I>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Adh1c	2044	2	235799396	235811584	1 - by flanking markers	2	262090818	262102977	1 - by flanking markers	2	243550655	243562243	1 - by flanking markers	2	226797303	226808892	1 - by flanking markers	RRID:RGD_1357190	This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background
1357191	CDS/Ygl	Cohen diabetic-sensitive rat	Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		inbred	Unknown																				RRID:RGD_1357191	Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.
1357192	WF.BBDR-(<i>D4Got39-D4Rat44</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	56704868	121645621	1 - by flanking markers	4	56868238	183837621	1 - by flanking markers	4	57101077	57101175	1 - by flanking markers	4	58432133	58432232	1 - by flanking markers	RRID:RGD_1357192	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357193	WF.BBDR-(<i>D4Got51-D4Rat44</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	70123187	121645621	1 - by flanking markers	4	136548956	183837621	1 - by flanking markers	4	71744558	71744763	1 - by flanking markers	4	71241724	71241930	1 - by flanking markers	RRID:RGD_1357193	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357194	WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	65434709	121645621	1 - by flanking markers	4	65397099	183837621	1 - by flanking markers	4	65577152	65577249	1 - by flanking markers	4	66609358	66609456	1 - by flanking markers	RRID:RGD_1357194	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357195	SS.MNS-(<i>Aldoc-D10Mco1</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Nos2	3185	10	67677924	67678060	1 - by flanking markers	10	63366082	63366218	1 - by flanking markers	10	64648175	64648311	1 - by flanking markers	10	61345276	61345413	1 - by flanking markers	RRID:RGD_1357195	This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.
1357196	WF.BBDR-(<i>D4Arb29-D4Rat265</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	63276741	82266081	1 - by flanking markers	4	63250011	148715224	1 - by flanking markers	4	63537179	84053053	1 - by flanking markers	4	64528739	83007655	1 - by flanking markers	RRID:RGD_1357196	This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.
1357345	DA/K	Dark Agouti/Karlsburg	Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany		inbred	Unknown																				RRID:RGD_1357345	Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany
1357346	BB.SHR-(<i>D4Mit6-Spr</i>)/K		Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany		congenic	Unknown		Npy|Spr	3197|3753	4	75732943	119369308	1 - by flanking markers	4	141978848	181496612	1 - by flanking markers	4	77307388	116916073	1 - by flanking markers	4	76647384	117676292	1 - by flanking markers	RRID:RGD_1357346	BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected.
1357417	SD-Tg(Npy)400Mcwi		Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1357417	14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene.
1357953	WAG/RijHfr		Envigo (Harlan France)		inbred	Unknown																				RRID:RGD_1357953	Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France)
1357954	F344/NHfr			Harlan France	inbred	Unknown																				RRID:RGD_1357954	Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France.
1357955	WF/NHfr	Wistar-Furth		Harlan France	inbred	Unknown																				RRID:RGD_1357955	Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France.
1357957	LEW/HanHfr		<a href=https://www.envigo.com/model/lew-han-hsd> ENVIGO France </a>	<a href=https://www.envigo.com/model/lew-han-hsd> ENVIGO France </a>	inbred	Unknown	The LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE																			RRID:RGD_1357957	Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015
1357958	BN/RijHfr			Harlan France	inbred	Unknown																				RRID:RGD_1357958	Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France.
1357959	FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi		Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin		congenic	Live Animals		Ctsc|Grm5|Nox4|Rab38|Tyr	2445|2746|620600|628752|1589755					1	157084760	158516775	1 - by flanking markers	1	150775310	152202960	1 - by flanking markers	1	140879679	142314355	1 - by flanking markers	RRID:RGD_1357959	The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH.
1357960	LE/CpbHfr		Envigo (Harlan France)		inbred	Unknown																				RRID:RGD_1357960	Substrain of LE which was bred at Harlan CPB now at Harlan France.
1357974	BB.SHR-(<i>D4Got41-Gimap5</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown		Gimap5	628871	4	60262965	76843214	1 - by flanking markers	4	60179409	143073003	1 - by flanking markers	4	60439127	78386683	1 - by flanking markers	4	61697658	77701025	1 - by flanking markers	RRID:RGD_1357974	Originated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.
1357975	SS.LEW-(<i>D1Mco4-D1Rat18</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1	29841428	43747532	1 - by flanking markers	1	33073397	50297622	1 - by flanking markers	1	31647701	49454378	1 - by flanking markers	1	29038037	49268520	1 - by flanking markers	RRID:RGD_1357975	This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.
1357976	BB.SHR-(<i>D4Got41-D4Rat171</i>)/K		Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				4	60262965	87996003	1 - by flanking markers	4	60179409	154162556	1 - by flanking markers	4	60439127	89342035	1 - by flanking markers	4	61697658	88217207	1 - by flanking markers	RRID:RGD_1357976	Originated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.
1357977	SS.LEW-(<i>D1Mco8-D1Rat213</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1	32329137	81548909	1 - by flanking markers	1;9	84537073;7947583	84537228;7947744	1 - by flanking markers;1 - by flanking markers	1	83282659	83282814	1 - by flanking markers	1	81777564	81777720	1 - by flanking markers	RRID:RGD_1357977	This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.
1357978	SS.MNS-(<i>D2Mit6-D2Rat303</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	77630629	131522430	1 - by flanking markers	2	98037122	155130826	1 - by flanking markers	2	78321410	135646395	1 - by flanking markers	2	76539322	127460910	1 - by flanking markers	RRID:RGD_1357978	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain
1357979	SS.MNS-(<i>Mme-D2Rat131</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown		Mme	3098	2	153031724	179302663	1 - by flanking markers	2	173193501	206015340	1 - by flanking markers	2	153799203	186612024	1 - by flanking markers	2	147686913	172711135	1 - by flanking markers	RRID:RGD_1357979	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain
1357980	BB.SHR-(<i>D4Got41-Tacr1</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=514 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Metabolism	Tacr1	3811	4	60262965	116780394	1 - by flanking markers	4	60179409	178095041	1 - by flanking markers	4	60439127	113416139	1 - by flanking markers	4	61697658	115089733	1 - by flanking markers	RRID:RGD_1357980	Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997.
1357981	SS.LEW-(<i>D3Mco21-D3Rat17</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	68499987	121619110	1 - by flanking markers	3	79183926	133513825	1 - by flanking markers	3	72672290	127023997	1 - by flanking markers	3	70348525	121056321	1 - by flanking markers	RRID:RGD_1357981	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd
1357982	SS.LEW-(<i>D3Rat52-D3Chm63</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	14051872	51161895	1 - by flanking markers	3	19410399	61857467	1 - by flanking markers	3	14090411	55245509	1 - by flanking markers	3	18311454	53781346	1 - by flanking markers	RRID:RGD_1357982	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd
1357983	SS.LEW-(<i>D1Mco75-D1Rat18</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1;17	43747374;2897342	43747532;2897591	1 - by flanking markers;1 - by flanking markers	1	36805624	50297622	1 - by flanking markers	1	35406399	49454378	1 - by flanking markers	1	32765502	49268520	1 - by flanking markers	RRID:RGD_1357983	This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.
1357984	SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	77630629	145701148	1 - by flanking markers	2	98037122	165313939	1 - by flanking markers	2	78321410	145903673	1 - by flanking markers	2	76539322	140636154	1 - by flanking markers	RRID:RGD_1357984	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain
1357985	LOU/Ins		INSERM, C.H.U. Bichat-Claude Bernard, Paris, France		inbred	Unknown																				RRID:RGD_1357985	originated from Universite Catholique de Louvain.
1357986	SS.LEW-(<i>D1Uia8-D1Rat211</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				17	1147796	1148037	1 - by flanking markers	1	35077728	35077968	1 - by flanking markers	1	33667777	33668017	1 - by flanking markers	1	31050840	31051081	1 - by flanking markers	RRID:RGD_1357986	This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.
1357987	SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1	43747374	43747532	1 - by flanking markers	1	50297465	50297622	1 - by flanking markers	1	49454221	49454378	1 - by flanking markers	1	49268362	49268520	1 - by flanking markers	RRID:RGD_1357987	A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.
1357988	SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	14051872	121619110	1 - by flanking markers	3	19410399	133513825	1 - by flanking markers	3	14090411	127023997	1 - by flanking markers	3	18311454	121056321	1 - by flanking markers	RRID:RGD_1357988	A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
1357994	SHR/NCrl		<a href=http://www.criver.com> Charles River Laboratories</a>	<a href=http://www.criver.com> Charles River Laboratories</a>	inbred	Live Animals (as of 2020-01-23)																				RRID:RGD_1357994	To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension.
1358112	WKY/NCrl		<a href=https://www.criver.com/products-services/find-model/wistar-kyoto-wky-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/wistar-kyoto-wky-rat?region=3611> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_1358112	Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11
1358114	SS-Chr 5<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Sperm																				RRID:RGD_1358114	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
1358150	SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	42656	350232	1 - by flanking markers	16	751266	1084414	1 - by flanking markers	16	756352	1090164	1 - by flanking markers	16	88524	380356	1 - by flanking markers	RRID:RGD_1358150	This congenic strain originated from a SS/Jr parental strain.
1358151	FHH-Chr 8<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358151	A FHH genomic background with a BN chromosome 8 introgressed.
1358152	SS-Chr 14<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358152	A SS genomic background with a BN chromosome 14 introgressed.
1358153	COP/CrCrl		<a href=http://www.criver.com> Charles River Laboratories</a>	<a href=http://www.criver.com> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_1358153	Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998.
1358154	SS-Chr 3<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Sperm																				RRID:RGD_1358154	A SS genomic background with a BN chromosome 3 introgressed.
1358155	SS.LEW-(<i>D10Rat119-D10Mgh1</i>)(<i>D16Rat21-D16Rat112</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown																				RRID:RGD_1358155	This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (<i>D10Rat119-D10Mgh1</i>)and (<i>D16Rat21-D16Rat112</i>) from the LEW strain
1358156	SS.MNS-(<i>D2Rat183-D2Chm113</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	144136724	145774334	1 - by flanking markers	2	163731761	165386311	1 - by flanking markers	2	144313532	145975996	1 - by flanking markers	2	139096736	140708949	1 - by flanking markers	RRID:RGD_1358156	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.
1358157	FHH-Chr 7<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358157	A FHH genomic background with a BN chromosome 7 introgressed.
1358158	FHH-Chr 16<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358158	A FHH genomic background with a BN chromosome 16 introgressed.
1358159	FHH-Chr 6<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358159	A FHH genomic background with a BN chromosome 6 introgressed.
1358160	SS.BN-(<i>D8Rat163-D8Rat81</i>)/Mcwi		PhysGen		congenic	Unknown				8	31508524	124926877	1 - by flanking markers	8	32911182	127854519	1 - by flanking markers	8	32888352	128653291	1 - by flanking markers	8	30188867	119698120	1 - by flanking markers	RRID:RGD_1358160	A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81.
1358161	SS.LEW-(<i>D16Rat38-D16Chm66</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	3080748	8612621	1 - by flanking markers	16	3405986	11276947	1 - by flanking markers	16	3439525	9316554	1 - by flanking markers	16	2995225	8336378	1 - by flanking markers	RRID:RGD_1358161	This congenic strain originated from a SS/Jr parental strain.
1358162	SS-Chr 12<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals																				RRID:RGD_1358162	A SS genomic background with a BN chromosome 12 introgressed.
1358163	SS-Chr 15<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1358163	A SS genomic background with a BN chromosome 15 introgressed.
1358164	FHH-Chr 17<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358164	A FHH genomic background with a BN chromosome 17 introgressed.
1358165	SS.MNS-(<i>D2Chm51-D2Rat341</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	151616735	155664303	1 - by flanking markers	2	171854997	177018102	1 - by flanking markers	2	152460836	157650873	1 - by flanking markers	2	146368688	150090572	1 - by flanking markers	RRID:RGD_1358165	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain.
1358166	SS.LEW-(<i>D16Mit3-D16Rat112</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	64718	47434384	1 - by flanking markers	16	773329	47069744	1 - by flanking markers	16	778415	47346612	1 - by flanking markers	16	110590	44236047	1 - by flanking markers	RRID:RGD_1358166	This congenic strain originated from a SS/Jr parental strain.
1358167	SS.MNS-(<i>D2Wox27-Adh1</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown		Adh1c	2044	2	202186267	235811584	1 - by flanking markers	2	228956554	262102977	1 - by flanking markers	2	209489455	243562243	1 - by flanking markers	2	194352314	226808892	1 - by flanking markers	RRID:RGD_1358167	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.
1358168	SS.LEW-(<i>D16Mit2-D16Chm23</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	42656	4304517	1 - by flanking markers	16	751266	5038806	1 - by flanking markers	16	756352	5098704	1 - by flanking markers	16	88524	4227730	1 - by flanking markers	RRID:RGD_1358168	This congenic strain originated from a SS/Jr parental strain.
1358169	SS.MNS-(<i>D2Chm25-D2Rat131</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	172459883	179302663	1 - by flanking markers	2	199188066	206015340	1 - by flanking markers	2	179779225	186612024	1 - by flanking markers	2	166144095	172711135	1 - by flanking markers	RRID:RGD_1358169	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Chm90-D2Wox37</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.
1358170	FHH-Chr 5<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358170	A FHH genomic background with a BN chromosome 5 introgressed.
1358171	SS-Chr 17<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358171	A SS genomic background with a BN chromosome 17 introgressed.
1358172	SS.MNS-(<i>D2Chm25-Fgg</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown		Fgg	2613	2	172459883	174734594	1 - by flanking markers	2	199188066	201409143	1 - by flanking markers	2	179779225	181994523	1 - by flanking markers	2	166144095	168362325	1 - by flanking markers	RRID:RGD_1358172	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.
1358173	FHH-Chr 11<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358173	A FHH genomic background with a BN chromosome 11 introgressed.
1358174	SS-Chr 19<sup>BN</sup>/Mcwi		PhysGen	<a href=http://www.rrrc.us/Strain/?x=601>Rat Resource and Research Center</a>	consomic	Cryopreserved Sperm (as of 2021-05-07)																				RRID:RRRC_00601	A SS genomic background with a BN chromosome 19 introgressed.
1358175	FHH-Chr 20<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358175	A FHH genomic background with a BN chromosome 20 introgressed.
1358176	FHH-Chr 18<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358176	A FHH genomic background with a BN chromosome 18 introgressed.
1358177	SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd		Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada		congenic	Unknown				2	172459883	197256313	1 - by flanking markers	2	199188066	224018437	1 - by flanking markers	2	179779225	204585731	1 - by flanking markers	2	166144095	189599348	1 - by flanking markers	RRID:RGD_1358177	Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.
1358178	SS-Chr 10<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358178	A SS genomic background with a BN chromosome 10 introgressed.
1358179	FHH-Chr 13<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1358179	A FHH genomic background with a BN chromosome 13 introgressed.
1358180	FHH-Chr 19<sup>BN</sup>/Mcwi		PhysGen	<a href=http://www.rrrc.us/Strain/?x=581>Rat Resource and Research Center</a>	consomic	Cryopreserved Sperm (as of 2021-05-07)																				RRID:RRRC_00581	A FHH genomic background with a BN chromosome 19 introgressed.
1358258	RCS/LavRrrc	royal college of surgeons rat	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=314>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=314>Rat Resource and Research Center</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)																				RRID:RRRC_00314	Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center.
1358259	RCS-<i>p</i><sup>+</sup>/LavRrrc		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=315>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=315>Rat Resource and Research Center</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)																				RRID:RRRC_00315	This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain.
1358277	RCS-<I>rdy</I><sup>+</sup>/LavRrrc		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=317&log=yes>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=317&log=yes>Rat Resource and Research Center</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16)																				RRID:RRRC_00317	Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated.
1358278	RCS-<i>rdy</I><sup>+</sup><I>p</I><sup>+</sup>/LavRrrc		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=316>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=316>Rat Resource and Research Center</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12)																				RRID:RRRC_00316	Developed by crossing a pink-eyed control(RCS-rdy<sup>+</sup>/Lav x black-eyed dystrophic(RCS-p<sup>+</sup>/Lav) The F12 progeny was backcrossed to RCS-rdy<sup>+</sup>/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain
1358298	SD-Tg(Rho*P23H)1LavRrrc		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=639>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=639>Rat Resource and Research Center</a>	transgenic	Live Animals (as of 2021-05-07)		Rho	11239																	RRID:RRRC_00639	This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).
1358299	SD-Tg(Rho*P23H)2Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	transgenic	Unknown																				RRID:RGD_1358299	This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).
1358300	SD-Tg(Rho*P23H)3Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=641>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=641>Rat Resource and Research Center</a>	transgenic	Unknown																				RRID:RRRC_00641	This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).
1358302	SD-Tg(Rho*S334X)3Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=643>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=643>Rat Resource and Research Center</a>	transgenic	Unknown																				RRID:RRRC_00643	This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.
1358303	SD-Tg(Rho*S334X)4Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http:///www.rrrc.us/Strain/?x=645>Rat Resource and Research Center</a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http:///www.rrrc.us/Strain/?x=645>Rat Resource and Research Center</a>	transgenic	Unknown																				RRID:RRRC_00645	This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.
1358304	SD-Tg(Rho*S334X)5Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	transgenic	Unknown																				RRID:RGD_1358304	This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.
1358305	SD-Tg(Rho*S334X)7Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	transgenic	Unknown																				RRID:RGD_1358305	This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.
1358306	SD-Tg(Rho*S334X)9Lav		<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>	transgenic	Unknown																				RRID:RGD_1358306	This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.
1358632	MR/Har	Maudsely reactive	Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. 	<a href=http://www.rrrc.us/Strain/?x=691>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo (as of 2019-02-20)																				RRID:RRRC_00691	This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.
1358633	MNRA/Har		Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania		inbred	Unknown																				RRID:RGD_1358633	Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.
1358918	W-<i>Plp1<sup>md</sup></i>/Nya	W-<i>Plp1</i><sup>md</sup>	Division of Laboratories and Research, New York State Department of Health, Albany, New York		mutant	Unknown		Plp1|Plp1<i><sup>md</sup></i>	3354|12802346	X	124488627	124503639	7	X	107379831	107394881	7	X	107505372	107505372	8	X	100195051	100195051	8	RRID:RGD_1358918	Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders.
1358919	F344/Seac		SEAC Yoshitomi Co., Fukuoka, Japan		inbred	Unknown																				RRID:RGD_1358919	Inbred strain originated from F344 rats
1358921	WF.DA-(<i>D19Mit1-D19Mit6</i>)/Kop		kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=521> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer	Nqo1	2503	19	26536747	41612881	1 - by flanking markers	19	35433730	54715514	1 - by flanking markers	19	24455726	43907843	1 - by flanking markers	19	24817978	39654489	1 - by flanking markers	RRID:RGD_1358921	Congenic strain originated from a parental DA/Slc strain.
1358922	BB.WOKW-(<i>D4Got41-Fabp1</i>)/K		Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany		congenic	Unknown		Fabp1	2590	4	60262965	104415981	1 - by flanking markers	4	60179409	163844105	1 - by flanking markers	4	60439127	99066957	1 - by flanking markers	4	61697658	103194791	1 - by flanking markers	RRID:RGD_1358922	Congenic strain originated from a BB/OK parental strain.
1358923	LE-<i>Mbp<sup>md</sup></i>		Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada		mutant	Unknown		Mbp|Mbp<sup>md</sup>	3054|12802351	18	78943608	79057329	7	18	78385304	78504226	7	18	79326738	79437310	7	18	75855878	75966404	7	RRID:RGD_1358923	A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.
1358989	WKY.SHR-(<I>D2Rat174-D2Rat28</I>)(<I>D2Rat161-D2Rat185</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown																				RRID:RGD_1358989	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl
1358990	DA.F344-(<i>D10Mit9-D10Rat24</i>)/Nsi		North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030		congenic	Unknown				10	31931622	79229233	1 - by flanking markers	10	31740635	78195122	1 - by flanking markers	10	31919397	78343192	1 - by flanking markers	10	31224026	75632053	1 - by flanking markers	RRID:RGD_1358990	Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd
1358991	F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj		Department of Pharmacology, University of Florida, Gainesville		congenic	Unknown				11	64573222	68235010	1 - by flanking markers	11	66731054	72739915	1 - by flanking markers	11	65352097	69649936	1 - by flanking markers	11	62790342	66422377	1 - by flanking markers	RRID:RGD_1358991	Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj
1358992	SHR.WKY-(<I>D2Rat40-D2Rat50</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	163154227	200390471	1 - by flanking markers	2	189197858	227035367	1 - by flanking markers	2	169852670	207612467	1 - by flanking markers	2	157142078	192625452	1 - by flanking markers	RRID:RGD_1358992	Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers
1358993	WKY.SHR-(<I>D2Rat161-D2Rat185</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	118264490	238140155	1 - by flanking markers	2	138120195	264423808	1 - by flanking markers	2	118446646	245893748	1 - by flanking markers	2	114837527	229059787	1 - by flanking markers	RRID:RGD_1358993	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl
1358994	SHR.WKY-(<I>D2Rat161-D2Rat241</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	118264490	217985582	1 - by flanking markers	2	138120195	242993417	1 - by flanking markers	2	118446646	118446793	1 - by flanking markers	2	114837527	114837675	1 - by flanking markers	RRID:RGD_1358994	This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) congenic strain to the parental strain SHR/NCrl
1358995	F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/Tj		Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan		congenic	Cryopreserved Embryo	Diabetes Obesity			1	255026793	267111153	1 - by flanking markers	1	276721459	289137268	1 - by flanking markers	1	269279863	281795785	1 - by flanking markers	1	248393012	259647894	1 - by flanking markers	RRID:RGD_1358995	Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.
1358996	SHR.WKY-(<I>D2Rat10-D2Mgh13</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	35874553	244809764	1 - by flanking markers	2	54092967	270992875	1 - by flanking markers	2	34967269	252466565	1 - by flanking markers	2	36023184	235501121	1 - by flanking markers	RRID:RGD_1358996	This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background
1358997	WKY.SHR-(<I>D2Rat241-D2Rat185</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	217985399	238140155	1 - by flanking markers	2	242993235	264423808	1 - by flanking markers	2	245893572	245893748	1 - by flanking markers	2	229059610	229059787	1 - by flanking markers	RRID:RGD_1358997	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl
1358998	BUF/NHsd		Harlan	Harlan	inbred	Unknown																				RRID:RGD_1358998	Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan.
1358999	WKY.SHR-(<I>D2Rat174-D2Rat28</i>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	60124623	107574826	1 - by flanking markers	2	83930202	126824737	1 - by flanking markers	2	60746052	107083569	1 - by flanking markers	2	59744817	104815148	1 - by flanking markers	RRID:RGD_1358999	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl
1359000	DA.F344-(<i>D10Arb27-D10Rat6</i>)/Nsi		North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030		congenic	Unknown				10	69160380	106310957	1 - by flanking markers	10	67971352	104746310	1 - by flanking markers	10	68305037	105078045	1 - by flanking markers	10	65927233	101436010	1 - by flanking markers	RRID:RGD_1359000	Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd
1359001	WKY.SHR-(<I>D2Rat42-D2Rat139</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	180768203	232533087	1 - by flanking markers	2	207416346	258769070	1 - by flanking markers	2	188013923	240243929	1 - by flanking markers	2	174110900	223490532	1 - by flanking markers	RRID:RGD_1359001	Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers
1359002	NTac:WKY			<a href=http://www.taconic.com/anmodels/wky.htm>Taconic</a>	outbred	Unknown																				RRID:RGD_1359002	The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony.
1359003	LEW/Jr		Medical College of Ohio, Toledo, Ohio, USA		inbred	Unknown																				RRID:RGD_1359003	This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA.
1359004	DA.F344-(<i>D10Mit9-D10Rat11</i>)/Nsi		North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030		congenic	Unknown				10	31931622	100633982	1 - by flanking markers	10	31740635	99184250	1 - by flanking markers	10	31919397	99492409	1 - by flanking markers	10	31224026	96121100	1 - by flanking markers	RRID:RGD_1359004	Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd
1359005	SHR.WKY-(<I>D2Rat15-D2Rat50</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	46251938	200390471	1 - by flanking markers	2	66171293	227035367	1 - by flanking markers	2	47783949	207612467	1 - by flanking markers	2	47137898	192625452	1 - by flanking markers	RRID:RGD_1359005	This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) to parental strain SHR/NCrl
1359006	WKY.SHR-(<I>D2Rat27-D2Rat243</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	96481750	221307793	1 - by flanking markers	2	116297660	248110514	1 - by flanking markers	2	96556622	228759752	1 - by flanking markers	2	94359407	212719943	1 - by flanking markers	RRID:RGD_1359006	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl
1359007	WKY.SHR-(<I>D2Rat174-D2Rat62</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	60124623	228664122	1 - by flanking markers	2	83930202	254867363	1 - by flanking markers	2	60746052	236318668	1 - by flanking markers	2	59744817	219753474	1 - by flanking markers	RRID:RGD_1359007	This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl
1359008	F344.HTX-(<i>D11Rat4-D11Arb4</i>)(<i>D17Rat23-D17Rat154</i>)/Hcj		Department of Pharmacology, University of Florida, Gainesville		congenic	Unknown																				RRID:RGD_1359008	Double congenic strain originated from a cross between single congenic strains F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj and F344.HTX-(<i>D17Rat23-D17Rat154</i>)/Hcj.
1359009	WKY.SHR-(<I>D2Rat174-D2Rat185</I>)		Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA		congenic	Unknown				2	60124623	238140155	1 - by flanking markers	2	83930202	264423808	1 - by flanking markers	2	60746052	245893748	1 - by flanking markers	2	59744817	229059787	1 - by flanking markers	RRID:RGD_1359009	Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers
1359010	WF.BBDR-ART2<SUP>a</SUP>/Wor	Wistar Furth	University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605		congenic	Unknown																				RRID:RGD_1359010	Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 <SUP>u/u</SUP> , ART2<SUP>a</SUP>.
1547865	FHH-Chr 3<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1547865	A FHH genomic background with a BN chromosome 3 introgressed.
1547866	F344/Jcl		<a href =https://www.clea-japan.com/en/products/outbred/item_a0470> CLEA Japan, Inc</a>	<a href =https://www.clea-japan.com/en/products/outbred/item_a0470> CLEA Japan, Inc</a>	inbred	Live Animals (as of 2021-04-22)																				RRID:RGD_1547866	Inbred strain originated from F344
1547867	FHH-Chr 4<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547867	A FHH genomic background with a BN chromosome 4 introgressed.
1547868	FHH-Chr 2<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547868	A FHH genomic background with a BN chromosome 2 introgressed.
1547869	ACI/Eur	August x Copenhagen Irish	Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands		inbred	Unknown																				RRID:RGD_1547869	Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH
1547870	FHH-Chr 14<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals																				RRID:RGD_1547870	A FHH genomic background with a BN chromosome 14 introgressed.
1547871	ACI.FHH-(<i>D1Rat324-D1Rat156</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown				1	229301063	253410500	1 - by flanking markers	1	251109240	279213254	1 - by flanking markers	1	243853559	243853760	1 - by flanking markers	1	223506828	223507030	1 - by flanking markers	RRID:RGD_1547871	Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains.
1547872	FHH-Chr X<sup>BN</sup>/Mcwi	FHH-Chr X<sup>BN</sup>/Mcwi	PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547872	A FHH genomic background with a BN chromosome X introgressed.
1547873	FHH-Chr 15<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547873	A FHH genomic background with a BN chromosome 15 introgressed.
1547874	FHH-Chr Y<sup>BN</sup>/Mcwi	FHH-Chr Y<sup>BN</sup>/Mcwi	PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547874	A FHH genomic background with a BN chromosome Y introgressed.
1547875	ACI.FHH-(<i>D17Rat117-D17Arb5</i>)(<i>D17Rat180-D17Rat51</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown				17	31007408	69257442	1 - by flanking markers	17	27537443	67580933	1 - by flanking markers	17	25609692	65831023	1 - by flanking markers	17	24982652	58691962	1 - by flanking markers	RRID:RGD_1547875	Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.
1547876	FHH-Chr 10<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1547876	A FHH genomic background with a BN chromosome 10 introgressed.
1549794	SS.LEW-(<i>D2Rat199-D2Mco17</i>)/Ayd		Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada		congenic	Unknown				2;4	41032071;157987925	76020140;157987994	1 - by flanking markers;1 - by flanking markers	2;4	60242455;221211532	95618891;221211601	1 - by flanking markers;1 - by flanking markers	2;4	41179255;154125111	75896315;154125180	1 - by flanking markers;1 - by flanking markers	X;2;4	46603085;41243963;154786975	46603120;74997963;154787045	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	RRID:RGD_1549794	Congenic strain was created from a SS/Jr parental strain
1549795	SS.LEW-(<i>D2Rat199-D2Rat143</i>)/Ayd		Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada		congenic	Unknown				2	41032071	106236206	1 - by flanking markers	2	60242455	125885146	1 - by flanking markers	2	41179255	106156987	1 - by flanking markers	2	41243963	103519040	1 - by flanking markers	RRID:RGD_1549795	Congenic strain was created from a SS/Jr parental strain
1549796	BN/2Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=67 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=67 > National BioResource Project for the Rat in Japan</a>	coisogenic	Live Animals; Cryopreserved Embryo																				RRID:RGD_1549796	Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16
1549797	BUF.ACI-(<i>D16Rat31-D16Arb1</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=171 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=171 > National BioResource Project for the Rat in Japan</a>	congenic	Unknown				16	8340080	8340453	1 - by flanking markers	16	11019972	11020174	1 - by flanking markers	16	9055590	9055792	1 - by flanking markers	16	8082906	8083107	1 - by flanking markers	RRID:RGD_1549797	This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method.
1549798	BB.PVG-<i>RT1</i><sup>u/a</sup>/Tky		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=31 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=31 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Immunology																			RRID:RGD_1549798	A congenic strain with the genetic background of the BB/WorTky strain (RT1.B<sup>u</sup>,D<sup>u</sup> ) onto which the MHC locus of PVG.R23 strain (RT1.B<a>,D<a>) has been transferred.
1549799	BB.SHR-<i>(D6Rat184-D6Rat3)</i>/K		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=517 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=517 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Metabolism			6	121381065	145279536	1 - by flanking markers	6	130448688	154782041	1 - by flanking markers	6	121224054	145868598	1 - by flanking markers	6	116506292	138922889	1 - by flanking markers	RRID:RGD_1549799	Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000.
1549800	BN/KunKtsSlc			This strain is no longer available from NBRP-Rat (June 2022).	inbred	Unknown (as of 2022-06-09)	Metabolism																			RRID:RGD_1549800	Kitasato University School of Medicine to Slc (2001)
1549801	BN/Seac		Seac Yoshitomi, LTD, Fukuoka, Japan.	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=421> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Sperm	Behavior; Ophthalmology																			RRID:RGD_1549801	Seac Yoshitomi, LTD, Fukuoka, Japan
1549802	BN/1Hok		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=66 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=66 > National BioResource Project for the Rat in Japan</a>	coisogenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1549802	Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15
1549803	ACI-<i>Lyst</i><sup>bg-Kyo</sup>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=7 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=7 > National BioResource Project for the Rat in Japan</a>	coisogenic	Cryopreserved Embryo; Cryopreserved Sperm	Hematology																			RRID:RGD_1549803	Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999.
1549804	BUF/NacJcl		Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan		inbred	Unknown																				RRID:RGD_1549804	CLEA Japan, Inc., Tokyo Japan
1549805	BUF.Cg-<i>Foxn1</i><sup>rnu</sup>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=459 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=459 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Urology																			RRID:RGD_1549805	BUF/Mna, NN1H-Rnu/Rnu
1549806	BUF.ACI-(<i>D3Rat56-D3Rat83</i>)/Ncc		Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=167> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			3	3577905	42635088	1 - by flanking markers	3	2612834	52104192	1 - by flanking markers	3	2631421	46996487	1 - by flanking markers	3	8227194	45391731	1 - by flanking markers	RRID:RGD_1549806	This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain
1549808	SS.LEW-(<i>Prlr-D2Rat143</i>)/Ayd		Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada		congenic	Unknown		Prlr	3407	2	59507966	106236206	1 - by flanking markers	2	84360850	125885146	1 - by flanking markers	2	60131410	106156987	1 - by flanking markers	2	59134147	103519040	1 - by flanking markers	RRID:RGD_1549808	Congenic strain was created from a SS/Jr parental strain
1549809	BN/KtsSlc			This strain is no longer available from NBRP-Rat (June 2022).	inbred	Unknown (as of 2022-06-09)	Immunology																			RRID:RGD_1549809	Kitasato University School of Medicine to Slc (2002)
1549810	AI/Msik	amelogenesis imperfecta rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=443 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=443 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Dentistry																			RRID:RGD_1549810	This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc.
1549811	ACI/NJcl		Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=546> National BioResource Project for the Rat in Japan</a>	inbred	Unknown																				RRID:RGD_1549811	ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan.
1549813	F344.ACI-<i>Lmx1a<sup>qc</sup></i>/Kyo		Institute of Laboratory Animals at Kyoto University, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=2&StrainsDir=Asc&StrainsPageSize=20> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12)		Apoa2|Selp|Lmx1a	2131|3656|1304784	13	79886614	87116372	1 - by flanking markers	13	87308435	94225670	1 - by flanking markers	13	82428914	89598805	1 - by flanking markers	13	76476229	83646358	1 - by flanking markers	RRID:RGD_1549813	Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, “queue courte” in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner.
1554301	WKHA/Bord		Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France		inbred	Unknown																				RRID:RGD_1554301	Strain was originated from WHHA/Edh at the University of Vermont College of Medicine
1554302	HOB-<I>Unc5c<sup>hob</sup></I>/Snk	hobble rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=545 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=545 > National BioResource Project for the Rat in Japan</a>	mutant	Unknown		Unc5c|Unc5c<sup>hob</sup>	735109|12802353	2	239365109	239721231	7	2	265573406	265926229	7	2	247045813	247397483	7	2	230180353	230535219	7	RRID:RGD_1554302	Homozygous hobble rats that were taken from the inbred hobble rat colony.
1554303	CVD/Opu	Cerebellar vermis defect rat	Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan		inbred	Unknown		Unc5c	735109	2	239365109	239721231	7	2	265573406	265926229	7	2	247045813	247397483	7	2	230180353	230535219	7	RRID:RGD_1554303	Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates.
1554304	GAERS/Mave	Genetic Absence Epilepsy Rats from Strasbourg	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=557 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=557 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_1554304	30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.
1554305	DA-Tg(CAG-lacZ)30Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=531 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=531 > National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RRRC_00295	lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.
1554306	GK/Slc	Goto Kakizaki Rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=377 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=377 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Diabetes Obesity																			RRID:RGD_1554306	Spontaneous mutant GK rat which were obtained from Japan SLC, Inc.
1554307	W-Tg(LAC3)Ys		YS New Technology Institute, Tochigi, Japan		transgenic	Unknown																				RRID:RGD_1554307	These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase.
1554308	Gunn-<i>Ugt1a1<sup>j</i></sup>/Slc	Gunn	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=370 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=370 > National BioResource Project for the Rat in Japan</a>	segregating_inbred	Live Animals	Neurobiology; Metabolism	Ugt1a1<sup>j</sup>	13432064																	RRID:RGD_1554308	Segregated inbred Gunn rat which were obtained from Japan SLC, Inc.
1554309	W-Tg(CAG-GFP)184Ys		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=525 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=259>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=525 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=259>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RRRC_00259	These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator.
1554310	DA-Tg(CAG-lacZ)19Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=530 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=294>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=530 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=294>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RRRC_00294	lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.
1556748	F344/Snk		Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan		inbred	Unknown																				RRID:RGD_1556748	Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan
1558660	SHRSP/Tkyo		Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan		inbred	Unknown																				RRID:RGD_1558660	Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo
1558661	WKY/Tkyo		Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan		inbred	Unknown																				RRID:RGD_1558661	Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo
1558662	SHR/Tkyo		Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan		inbred	Unknown																				RRID:RGD_1558662	Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo
1559030	LEC-Tg(ATP7B)Tohm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=457 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=457 > National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_1559030	A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA.
1559031	NE/Mave		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=558 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=558 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_1559031	The control strain of GAERS, free of any spontaneous spike and wave discharges.
1559032	SS.LEW-(<I>D17Rat65-D17Chm2</I>)/Ayd		Research Centre, Centre Hosp Univ Montreal, Quebec, Canada		congenic	Unknown				17	82247891	93930006	1 - by flanking markers	17	76483116	88435496	1 - by flanking markers	17	74823053	86731080	1 - by flanking markers	17	70973784	82479847	1 - by flanking markers	RRID:RGD_1559032	This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment
1559033	SS.LEW-(<I>D17Rat65-Prl</I>)/Ayd		Research Centre, Centre Hosp Univ Montreal, Quebec, Canada		congenic	Unknown		Prl	3403	17	44699101	93930006	1 - by flanking markers	17	41720751	88435496	1 - by flanking markers	17	39814236	86731080	1 - by flanking markers	17	37859999	82479847	1 - by flanking markers	RRID:RGD_1559033	This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain
1559034	SS.LEW-(<I>D17Chm14-D17Rat97</I>)/Ayd		Research Centre, Centre Hosp Univ Montreal, Quebec, Canada		congenic	Unknown				17	73041111	80182186	1 - by flanking markers	17	60264084	74265481	1 - by flanking markers	17	58467778	72580782	1 - by flanking markers	17	62109333	68784138	1 - by flanking markers	RRID:RGD_1559034	This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment
1559035	SS.LEW-(<I>D17Chm14-D17Rat181</I>)/Ayd		Research Centre, Centre Hosp Univ Montreal, Quebec, Canada		congenic	Unknown				17	38257211	80182186	1 - by flanking markers	17	35100574	74265481	1 - by flanking markers	17	33208959	72580782	1 - by flanking markers	17	31896010	68784138	1 - by flanking markers	RRID:RGD_1559035	This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain
1559036	LEW/Jms		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=54>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=54>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)																				RRID:RRRC_00054	Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.
1559037	SS.LEW-(<I>D17Chm9-D17Rat97</I>)/Ayd		Research Centre, Centre Hosp Univ Montreal, Quebec, Canada		congenic	Unknown				17	73041111	83074398	1 - by flanking markers	17	60264084	77361330	1 - by flanking markers	17	58467778	75705622	1 - by flanking markers	17	62109333	71774817	1 - by flanking markers	RRID:RGD_1559037	This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment
1559039	ODS/Shi	Osteogenic disorder Shionogi	Shionogi & Co., Ltd. Japan		inbred	Unknown																				RRID:RGD_1559039	Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.
1559040	MD/Tama	myelin deficient rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=248 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=248 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2024-09-24)	Neurobiology; Development																			RRID:RGD_1559040	X-linked mutant of the Wistar rat.
1559041	SHRSP/Ngsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=303 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=303 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology; Cardio Hypertension; Osteosis																			RRID:RGD_1559041	Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980.
1559042	SHR/Nig		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=286 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=286 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension; Pharmacology																			RRID:RGD_1559042	Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976.
1559043	MV/Opu	myelin vacuolation rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=187 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=187 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Neurobiology	Atrn<sup><i>mv</i></sup>	40902835	3	118539268	118701177	7	3	129934303	130067267	7	3	123434409	123567922	7	3	118110320	118244326	7	RRID:RGD_1559043	The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999.
1559044	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown		Edn3	2534	7;3	23312460;147799021	23312636;167653069	1 - by flanking markers;1 - by flanking markers	7;3	27325365;158391833	27325541;183008351	1 - by flanking markers;1 - by flanking markers	3;7	153327515;27206010	153327695;27206186	1 - by flanking markers;1 - by flanking markers	3;7	145871677;21089863	145871858;21090040	1 - by flanking markers;1 - by flanking markers	RRID:RGD_1559044	A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats
1559045	LEW/Crlc			Charles River Laboratories, La Salle, Quebec, Canada	inbred	Unknown																				RRID:RGD_1559045	LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada
1559046	SHR-Chr Y<sup>W</sup>/K		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=518 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=518 > National BioResource Project for the Rat in Japan</a>	consomic	Unknown																				RRID:RGD_1559046	Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996.
1559047	SHRSP/Ezo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=357 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=357 > National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology; Cardio Hypertension																			RRID:RGD_1559047	Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan
1559048	SHR.ODS-<i>Gulo<sup>od</sup></i>/Shi		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=114 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=114 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension; Osteosis	Gulo	620701																	RRID:RGD_1559048	A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995.
1566430	SimTac:LE			<a href=http://www.taconic.com/anmodels/longev.htm>Taconic</a>	outbred	Unknown																				RRID:RGD_1566430	Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock.
1566431	BN/MolTac			<a href=http://www.taconic.com/anmodels/BN.htm>Taconic</a>	inbred	Unknown																				RRID:RGD_1566431	The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003.
1566432	WKY/NMolTac	Wistar Kyoto		<a href=http://www.taconic.com/anmodels/wkyn1.htm>Taconic</a>	inbred	Unknown																				RRID:RGD_1566432	The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit.
1566433	HanTac:WH			<a href=http://www.taconic.com/anmodels/whgalas.htm>Taconic</a>	outbred	Unknown																				RRID:RGD_1566433	In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000.
1566434	NTac:SHR			<a href=http://www.taconic.com/anmodels/sponthyp.htm>Taconic</a>	outbred	Unknown																				RRID:RGD_1566434	Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony.
1566437	SS-Chr X<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1566437	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
1566438	DA/MolTac			<a href=http://www.taconic.com/anmodels/DA.htm>Taconic</a>	inbred	Unknown																				RRID:RGD_1566438	Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004.
1566439	F344/NTac			<a href=http://www.taconic.com/anmodels/F344.htm>Taconic</a>	inbred	Unknown																				RRID:RGD_1566439	Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH.
1566440	NTac:SD			<a href=https://www.taconic.com/rat-model/sprague-dawley>Taconic</a>	outbred	Unknown																				RRID:RGD_1566440	Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies.
1566443	LEW/MolTac	Lewis		<a href=http://www.taconic.com/anmodels/Lewis_rat.htm>Taconic</a>	inbred	Unknown																				RRID:RGD_1566443	Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived.
1566444	MolTac:SD			<a href=http://www.taconic.com/anmodels/SDMOL_rat.htm>Taconic</a>	outbred	Unknown																				RRID:RGD_1566444	The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993.
1566445	ACI.BN-(<I>D5Mgh17-D5Rat205</I>)/Shul		Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska		congenic	Extinct				5	14730738	14730949	1 - by flanking markers	5	19190627	19190837	1 - by flanking markers	5	14408903	14409113	1 - by flanking markers	5	14529225	14529436	1 - by flanking markers	RRID:RGD_1566445	This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background
1566447	GK/MolTac	Goto-Kakizaki	<a href=https://www.taconic.com/rat-model/goto-kakizaki</a>	<a href=https://www.taconic.com/rat-model/goto-kakizaki>Taconic</a>	inbred	Unknown																				RRID:RGD_1566447	The Goto-Kakizaki inbred model was developed by Tohoku University in 1975. Aarhus University Hospital in Denmark received stock in 1994. M&B A/S (now Taconic Europe) received stock from Aarhus in 1997. The rats were derived by embryo transfer in 2005 at Taconic US.
1566448	FHH-Chr 9<sup>BN</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_1566448	A FHH genomic background with a BN chromosome 9 introgressed.
1566453	SD-Tg(HIV-LacZ)AngRrrc		<a href=http://www.rrrc.us/Strain/?x=49>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=49>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00049	Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid.
1566454	BDIV/Zte	BDIV/Zte	Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany		inbred	Unknown																				RRID:RGD_1566454	derived from Berlin-Druckrey strain BDIV
1566455	HTX/HcjRrrc		<a href=http://www.rrrc.us/Strain/?x=50>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=50>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery																				RRID:RRRC_00050	Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30.
1566456	BDIX/Zte		Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany		inbred	Unknown																				RRID:RGD_1566456	derived from Berlin-Druckrey strain BDIX
1566457	SPRD	Sprague-Dawley			inbred	Unknown																				RRID:RGD_1566457	From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990).
1566458	F344-Tg(ROSA26-ALPP)EpsRrrc		<a href=http://www.rrrc.us/Strain/?x=48>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=48>Rat Resource and Research Center</a>	transgenic	Cryopreserved Sperm (as of 2019-07-01)		ALPP	1314395																	RRID:RRRC_00048	F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP).
1566459	F344-Tg(ROSA26-EGFP)Eps		Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin		transgenic	Unknown																				RRID:RGD_1566459	F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP).
1566460	SD-Tg(ICAM2-DAF)AngRrrc		<a href=http://www.rrrc.us/Strain/?x=51>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=51>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00051	Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter.
1578692	BN.LEW-(<i>D10Rat32-D10Rat116</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	53786347	54220239	1 - by flanking markers	10	53381898	53807373	1 - by flanking markers	10	53630865	54057745	1 - by flanking markers	10	51779662	52200160	1 - by flanking markers	RRID:RGD_1578692	Congenic strain was bred from BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml backcrossed to BN/Rj.
1578693	LEW.BN-(<i>D10Mco17-D10Rat221</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	45105978	45106380	1 - by flanking markers	10	44914976	44915377	1 - by flanking markers	10	45157430	45157831	1 - by flanking markers	10	43593509	43593911	1 - by flanking markers	RRID:RGD_1578693	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578694	AT	Alcohol-Tolerant	<a href=http://www.rrrc.us/Strain/?x=76>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=76>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00076	The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.
1578695	SHA/BruRrrc	Syracuse High Avoidance	<a href=http://www.rrrc.us/Strain/?x=68>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=68>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00068	Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats.
1578696	LAS1	Low Alcohol Sensitive strain 1	<a href=http://www.rrrc.us/Strain/?x=80>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=80>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00080	Selectively bred for 24 generations for low sensitivity to ethanol then inbred.
1578697	BN.LEW-(<i>D10Rat32-D10Rat31</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	53616237	53786515	1 - by flanking markers	10	53216481	53382065	1 - by flanking markers	10	53465198	53631032	1 - by flanking markers	10	51611529	51779830	1 - by flanking markers	RRID:RGD_1578697	Congenic strain was bred from BN.LEW-(<i>D10Rat32-D10Rat221</i>)/Ciml backcrossed to BN/Rj.
1578698	LAS2	Low Alcohol Sensitive strain 2	<a href=http://www.rrrc.us/Strain/?x=81>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=81>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00081	Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred
1578699	BG	anemic Belgrade		<a href=http://www.rrrc.us/Strain/?x=72>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery																				RRID:RRRC_00072	These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY.
1578700	HAS1	High Alcohol Sensitive strain 1	<a href=http://www.rrrc.us/Strain/?x=77>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=77>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00077	Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred
1578701	HAS2	High Alcohol Sensitive strain 2	<a href=http://www.rrrc.us/Strain/?x=79>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=79>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00079	Selectively bred for high ethanol sensitivity for 24 generations, then inbred.
1578702	LEW.BN-(<i>D10Rat32-D10Rat133</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	53786347	65668639	1 - by flanking markers	10	53381898	64823355	1 - by flanking markers	10	53630865	53631032	1 - by flanking markers	10	51779662	51779830	1 - by flanking markers	RRID:RGD_1578702	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578703	SLA/BruRrrc	Syracuse Low Avoidance	<a href=http://www.rrrc.us/Strain/?x=69>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=69>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00069	Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats.
1578704	WLP	Warsaw Low Prefering	Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland		inbred	Unknown																				RRID:RGD_1578704	These were bred from albino stock of Wistar rats as lines that had low ethanol preference.
1578705	LEW.BN-(<i>D10Arb4-D10Rat133</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	46737116	65668639	1 - by flanking markers	10	46591952	64823355	1 - by flanking markers	10	46835584	46835685	1 - by flanking markers	10	45274234	45274336	1 - by flanking markers	RRID:RGD_1578705	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578706	LEW.BN-(<i>D10Mco17-D10Mco14</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	45105978	45106380	1 - by flanking markers	10	44914976	44915377	1 - by flanking markers	10	45157430	45157831	1 - by flanking markers	10	43593509	43593911	1 - by flanking markers	RRID:RGD_1578706	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578708	LEW.BN-(<i>D10Mgh7-D10Rat221</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	56170962	56171177	1 - by flanking markers	10	55720558	55720772	1 - by flanking markers	10	55978483	55978697	1 - by flanking markers	10	54098674	54098889	1 - by flanking markers	RRID:RGD_1578708	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578709	IA	incisor absent	<a href=http://www.rrrc.us/Strain/?x=64>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=64>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00064	These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption.
1578710	LEW.1AR1-<I>iddm</I>/Ztm		Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany		coisogenic	Unknown		Dock8<sup>m1Ztm</sup>	13830868																	RRID:RGD_1578710	arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup>) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since
1578711	LEW.BN-(<i>D10Mco17-D10Rat133</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	45105978	65668639	1 - by flanking markers	10	44914976	64823355	1 - by flanking markers	10	45157430	45157831	1 - by flanking markers	10	43593509	43593911	1 - by flanking markers	RRID:RGD_1578711	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578712	BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	45105978	45106380	1 - by flanking markers	10	44914976	44915377	1 - by flanking markers	10	45157430	45157831	1 - by flanking markers	10	43593509	43593911	1 - by flanking markers	RRID:RGD_1578712	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578713	BN/Ztm		Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany		inbred	Unknown																				RRID:RGD_1578713	substrain of BN
1578714	BN.LEW-(<i>D10Mco17-D10Rat80</i>)/Ciml		Institut National de la Sante et de la Recherche Medicale, Toulouse, France		congenic	Unknown				10	45105978	61798393	1 - by flanking markers	10	44914976	61030524	1 - by flanking markers	10	45157430	61300905	1 - by flanking markers	10	43593509	59378278	1 - by flanking markers	RRID:RGD_1578714	Congenic strain created from parental LEW/Rj and BN/Rj strains.
1578715	ANT	Alcohol-Nontolerant	<a href=http://www.rrrc.us/Strain/?x=78>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=78>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm		Gabra6	61861																	RRID:RRRC_00078	The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.
1578716	LEW.1AR1/Ztm		Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany		congenic	Unknown																				RRID:RGD_1578716	Lewis strain containing MHC haplotype <i>RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup></i>
1578717	WHP	Warsaw High Prefering	Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland		inbred	Unknown																				RRID:RGD_1578717	These were bred from albino stock of Wistar rats as lines that had ethanol preference.
1579677	FHH-<i>Madd<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Madd<i><sup>m1Mcwi</sup></i>	1578796	3	75498321	75541073	7	3	86669054	86711776	7	3	79960301	80003023	7	3	77114330	77157865	7	RRID:RGD_1579677	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated.
1579678	ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Live Animals; Cryopreserved Sperm				3	46419462	163443738	1 - by flanking markers	3	57173123	176609927	1 - by flanking markers	3	50533100	170534769	1 - by flanking markers	3	49162911	161299569	1 - by flanking markers	RRID:RGD_1579678	Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.
1579680	Wild/Tku	Wild	Caught in Tokyo		wild	Unknown																				RRID:RGD_1579680	These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed.
1579681	BN-<i>Birc3<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2016-10-24)		Birc3<i><sup>m1Mcwi</sup></i>	1578788	8	4682202	4696856	7	8	6047454	6075236	7	8	6048590	6076828	7	8	5000844	5028470	7	RRID:RGD_1579681	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated.
1579682	FHH-<i>Tlr4<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=411>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Tlr4<i><sup>m1Mcwi</sup></i>	1578785	5	83564100	83577735	7	5	86690670	86704302	7	5	82587424	82601056	7	5	80145867	80159501	7	RRID:RRRC_00411	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated.
1579683	FHH-<i>Ghsr<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=405>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ghsr<i><sup>m1Mcwi</sup></i>	1578794	2	113269623	113272999	7	2	132784207	132789319	7	2	113065953	113071265	7	2	110268489	110271865	7	RRID:RRRC_00405	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop.
1579684	FHH-<i>Slc8a2<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=404>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Slc8a2<i><sup>m1Mcwi</sup></i>	1578786	1	76473938	76498624	7	1	79296259	79320746	7	1	78029555	78054042	7	1	76816583	76852928	7	RRID:RRRC_00404	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA.
1579685	FHH-<i>Tgfbr2<sup>m2Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=400>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Tgfbr2<i><sup>m2Mcwi</sup></i>	1578782	8	120593595	120680453	7	8	123585765	123671209	7	8	124310288	124399345	7	8	115794537	115883615	7	RRID:RRRC_00400	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG.
1579686	GH/OmrMcwi		PhysGen		inbred	Live Animals; Cryopreserved Embryo																				RRID:RGD_1579686	This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then.
1579687	FHH-<i>Proc<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=410>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Proc<i><sup>m1Mcwi</sup></i>	1578790	18	24563368	24573715	7	18	24633206	24643623	7	18	24918402	24928822	7	18	23764367	23774816	7	RRID:RRRC_00410	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated.
1579688	BN-<i>Tgfbr2<sup>m1Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Tgfbr2<i><sup>m1Mcwi</sup></i>	1578800	8	120593595	120680453	7	8	123585765	123671209	7	8	124310288	124399345	7	8	115794537	115883615	7	RRID:RGD_1579688	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG.
1579689	FHH-<i>F10<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=401>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		F10<i><sup>m1Mcwi</sup></i>	1578783	16	81327237	81346544	7	16	81288536	81307842	7	16	81803169	81822476	7	16	76468834	76488141	7	RRID:RRRC_00401	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC.
1579690	FHH-<i>Slc27a5<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Slc27a5<i><sup>m1Mcwi</sup></i>	1578799	1	72924630	72935223	7	1	66387832	66398425	7	1	65576599	65587192	7	1	73616556	73627149	7	RRID:RGD_1579690	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated.
1579691	SS.SHR-(<i>D11Mgh3-D11Rat31</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				11	8176272	68234949	1 - by flanking markers	11	10373455	72739854	1 - by flanking markers	11	6673351	69649875	1 - by flanking markers	11	8200022	66422316	1 - by flanking markers	RRID:RGD_1579691	Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.
1579692	FHH-<i>Lcat<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=402>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lcat<i><sup>m1Mcwi</sup></i>	1578793	19	35781507	35784966	7	19	48780364	48783830	7	19	37913333	37916799	7	19	33834748	33838214	7	RRID:RRRC_00402	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC.
1579693	T2DN/Mcwi		Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin		inbred	Unknown																				RRID:RGD_1579693	Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained.
1579694	FHH-<i>Egln3<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=409>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Egln3<i><sup>m1Mcwi</sup></i>	1578781	6	74451038	74476506	7	6	84592894	84618360	7	6	75050329	75075795	7	6	71650297	71675766	7	RRID:RRRC_00409	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated.
1579695	ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown				1	225625031	267111153	1 - by flanking markers	1	247303036	289137268	1 - by flanking markers	1	240017117	281795785	1 - by flanking markers	1	219932573	259647894	1 - by flanking markers	RRID:RGD_1579695	Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.
1579696	SS.SHR-(<i>D6Wox13-D6Rat84</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				6	136451997	136452267	1 - by flanking markers	6	144273721	144273990	1 - by flanking markers	6	136142742	136143011	1 - by flanking markers	6	130729205	130729475	1 - by flanking markers	RRID:RGD_1579696	Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.
1579697	SS.SHR-(<i>D13Rat63-D13Mit1</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				13	25430110	80482429	1 - by flanking markers	13	14281836	87877411	1 - by flanking markers	13	9016742	82995671	1 - by flanking markers	13	5994668	77046890	1 - by flanking markers	RRID:RGD_1579697	Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.
1579698	FHH-<i>Adra1a<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=408>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Adra1a<i><sup>m1Mcwi</sup></i>	1578792	15	46173429	46263198	7	15	48197628	48297316	7	15	43296997	43398314	7	15	40830125	40935902	7	RRID:RRRC_00408	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a.
1579699	WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/Cfd	WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/Cfd	Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA		congenic	Unknown				5	159265355	159265706	1 - by flanking markers	5	162571275	162571427	1 - by flanking markers	5	158854038	158854190	1 - by flanking markers	5	152630083	152630236	1 - by flanking markers	RRID:RGD_1579699	This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background
1579700	ACI.FHH-(<i>D1Rat475-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown																				RRID:RGD_1579700	Double congenic strain from backcross of ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur and ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur.
1579701	BN-<i>Nos1<sup>m1</i>Mcwi</sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Nos1<i><sup>m1Mcwi</sup></i>	1578795	12	39812500	39869484	7	12	46049288	46209569	7	12	44214949	44405530	7	12	38615111	38795492	7	RRID:RGD_1579701	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated.
1579702	SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	21667066	21667256	1 - by flanking markers	9	27914255	97338238	1 - by flanking markers	9	29075079	97647719	1 - by flanking markers	9	25268044	91090963	1 - by flanking markers	RRID:RGD_1579702	Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.
1579703	SS.SHR-(<i>D2Rat61-D2Mco18</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				2	79796833	227150249	1 - by flanking markers	2	88594475	100298539	1 - by flanking markers	2	68865414	80632096	1 - by flanking markers	18;2	79924734;78665619	79925127;78665763	1 - by flanking markers;1 - by flanking markers	RRID:RGD_1579703	Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.
1579704	FHH-<i>Agtr1b<sup>m1Mcwi</i></sup>		PhysGen, Rat Resource & Research Center		mutant	Extinct (as of 2016-11-29)		Agtr1b<i><sup>m1Mcwi</sup></i>	1578784	2	105503269	105602591	7	2	124879262	124954378	7	2	105149020	105224335	7	2	102844969	102920232	7	RRID:RGD_1579704	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b.
1579705	FHH-<i>Nr0b2<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=403>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Nr0b2<i><sup>m1Mcwi</sup></i>	1578798	5	151524685	151528000	7	5	155465275	155468590	7	5	151776004	151779319	7	5	145779294	145782609	7	RRID:RRRC_00403	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC.
1579706	FHH-<i>Nr4a1<sup>m1Mcwi</i></sup>		PhysGen		mutant	Cryopreserved Sperm (as of 2017-01-26)		Nr4a1<i><sup>m1Mcwi</sup></i>	1578791	7	140012807	140020590	7	7	140700242	140721073	7	7	142899358	142920216	7	7	132368399	132389300	7	RRID:RGD_1579706	Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA.
1579707	FHH-<i>Adipoq<sup>m2Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=407>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-13)		Adipoq<i><sup>m2Mcwi</sup></i>	1578797	11	79908291	79911065	7	11	84363940	84382663	7	11	81330845	81344488	7	11	77721912	77735644	7	RRID:RRRC_00407	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq.
1579708	FHH-<i>Des<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Des<i><sup>m1Mcwi</sup></i>	1578801	9	74637783	74645499	7	9	82325835	82333549	7	9	82556574	82564288	7	9	76850979	76858695	7	RRID:RGD_1579708	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated.
1579709	Wild/Mcwi	Wild	Caught in Milwaukee Wisconsin		wild	Unknown																				RRID:RGD_1579709	These rats were caught wild in Milwaukee, used for experiments and then sacrificed.
1579710	GK/Far	Goto-Kakizaki	James A. Haley Veterans Hospital, Tampa Florida		inbred	Unknown																				RRID:RGD_1579710	Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan.
1579711	FHH-<i>Adipoq<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=406>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-13)		Adipoq<i><sup>m1Mcwi</sup></i>	1578787	11	79908291	79911065	7	11	84363940	84382663	7	11	81330845	81344488	7	11	77721912	77735644	7	RRID:RRRC_00406	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq.
1579712	FHH-<i>Klf6<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Klf6<i><sup>m1Mcwi</sup></i>	1578789	17	75578498	75585072	7	17	69616967	69674031	7	17	67887939	67945052	7	17	64539456	64548451	7	RRID:RGD_1579712	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated.
1579894	SS.LEW-(<i>D10Rat204-D10Rat9</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	94837236	99588446	1 - by flanking markers	10	93421499	93421719	1 - by flanking markers	10	93662786	93663006	1 - by flanking markers	10	90404397	90404618	1 - by flanking markers	RRID:RGD_1579894	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.
1579895	FHH-<i>Bdkrb2<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2016-10-24)		Bdkrb2<i><sup>m1Mcwi</sup></i>	1579889	6	129744781	129748851	7	6	138615812	138622272	7	6	129399468	129429676	7	6	124472317	124502497	7	RRID:RGD_1579895	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated.
1579896	SS.LEW-(<i>D2Rat18-D2Chm277</i>)/Ayd		Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada		congenic	Unknown				2	40912197	56722286	1 - by flanking markers	2	60126669	76472773	1 - by flanking markers	2	41063439	56736627	1 - by flanking markers	2	41125789	56532139	1 - by flanking markers	RRID:RGD_1579896	Congenic strain was created from a SS/Jr parental strain
1579897	SS.SR-(<i>D9Rat69-D9Mco14</i>)/Mco		Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	66679876	74437140	1 - by flanking markers	9	74640722	82125547	1 - by flanking markers	9	74858383	82356286	1 - by flanking markers	9	69371595	76650886	1 - by flanking markers	RRID:RGD_1579897	A congenic strain derived from the progenitor strains SS and SR.
1579898	SS.LEW-(<i>D10Chm128-D10Chm121</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	70486334	71365656	1 - by flanking markers	10	69272915	71014829	1 - by flanking markers	10	69638898	70499629	1 - by flanking markers	10	67232398	68082614	1 - by flanking markers	RRID:RGD_1579898	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.
1579899	SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwi	SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwi	Department of Physiology, Medical College of Wisconsin, Milwaukee		congenic	Unknown				5	32701659	139996194	1 - by flanking markers	5	36590997	142265366	1 - by flanking markers	5	31926122	138454239	1 - by flanking markers	5	31663789	133011550	1 - by flanking markers	RRID:RGD_1579899	This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.
1579900	SS.SR-(<i>D9Rat89-Resp18</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	72257996	74558151	1 - by flanking markers	9	80172493	82246695	1 - by flanking markers	9	80400409	82477136	1 - by flanking markers	9	74701668	76771824	1 - by flanking markers	RRID:RGD_1579900	Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain
1579901	SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	74705355	76000447	1 - by flanking markers	10	75100237	76438561	1 - by flanking markers	10	75001953	76556637	1 - by flanking markers	10	72508825	72509024	1 - by flanking markers	RRID:RGD_1579901	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.
1579902	SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwi	SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwi	Department of Physiology, Medical College of Wisconsin, Milwaukee		congenic	Unknown				5	32701659	134872385	1 - by flanking markers	5	36590997	137108002	1 - by flanking markers	5	31926122	133313852	1 - by flanking markers	5	31663789	128034027	1 - by flanking markers	RRID:RGD_1579902	This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.
1579903	SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	97152234	100633982	1 - by flanking markers	10	95701164	99184250	1 - by flanking markers	10	95967019	99492409	1 - by flanking markers	10	92698959	96121100	1 - by flanking markers	RRID:RGD_1579903	A congenic substrain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.
1579904	SS.SR-(<i>D9Mgh11-D9Mco33</i>)/Mco		Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				10	86983905	86984155	1 - by flanking markers	10	85965754	85966003	1 - by flanking markers	10	86168841	86169090	1 - by flanking markers	10	83212828	83213078	1 - by flanking markers	RRID:RGD_1579904	A congenic strain derived from the progenitor strains SS and SR.
1579905	SS.SR-(<i>D9Rat89-D9Mco27</i>)/Mco		Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9;10	72257996;76477677	72258219;76477875	1 - by flanking markers;1 - by flanking markers	9;10	80172493;74600366	80172715;74600564	1 - by flanking markers;1 - by flanking markers	9;10	80400409;75505821	80400631;75506019	1 - by flanking markers;1 - by flanking markers	9;10	74701668;72976092	74701891;72976291	1 - by flanking markers;1 - by flanking markers	RRID:RGD_1579905	Congenic strain derived from parental strains SS and SR.
1579906	FHH-<i>Adipoq<sup>m3Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=414>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-13)		Adipoq<i><sup>m3Mcwi</sup></i>	1579887	11	79908291	79911065	7	11	84363940	84382663	7	11	81330845	81344488	7	11	77721912	77735644	7	RRID:RRRC_00414	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq.
1579907	SS.LEW-(<i>D10Chm128-D10Chm169</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	70486334	70654393	1 - by flanking markers	10	69272915	69442411	1 - by flanking markers	10	69638898	69809020	1 - by flanking markers	10	67232398	67400546	1 - by flanking markers	RRID:RGD_1579907	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.
1579908	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco		Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74551809	74558151	1 - by flanking markers	9	80867159	82246695	1 - by flanking markers	9	81100315	82477136	1 - by flanking markers	9	75403227	76771824	1 - by flanking markers	RRID:RGD_1579908	A congenic strain derived from the progenitor strains SS and SR.
1579909	FHH-<i>Fgl2<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Fgl2<i><sup>m1Mcwi</sup></i>	1579885	4	9176333	9181976	7	4	10315666	10321309	7	4	10323598	10329241	7	4	13710566	13716207	7	RRID:RGD_1579909	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA.
1579910	FHH-<i>Ccr2<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=399>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ccr2<i><sup>m1Mcwi</sup></i>	1579888	8	128892784	128893905	7									8	123734465	123742483	7	RRID:RRRC_00399	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT.
1579911	SS.LEW-(<i>D5Rat130-D5Rat72</i>)/Mcwi	SS.LEW-(<i>D5Rat130-D5Rat72</i>)/Mcwi	Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee		congenic	Unknown				5	32701659	120983466	1 - by flanking markers	5	36590997	123028200	1 - by flanking markers	5	31926122	119125145	1 - by flanking markers	5	31663789	114973531	1 - by flanking markers	RRID:RGD_1579911	This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background.
1579912	FHH-<i>F10<sup>m2Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=412>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		F10<i><sup>m2Mcwi</sup></i>	1579886	16	81327237	81346544	7	16	81288536	81307842	7	16	81803169	81822476	7	16	76468834	76488141	7	RRID:RRRC_00412	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA
1579913	SS.LEW-(<i>D10Chm224-D10Chm222</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	74705355	76477875	1 - by flanking markers	10	74600366	76309841	1 - by flanking markers	10	75505821	75506019	1 - by flanking markers	10	72976092	72976291	1 - by flanking markers	RRID:RGD_1579913	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.
1579914	SS.LEW-(<i>D10Mco30-D10Got92</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	77547289	77956387	1 - by flanking markers	10	73693979	76919627	1 - by flanking markers	10	76420583	77055888	1 - by flanking markers	10	73887148	74372232	1 - by flanking markers	RRID:RGD_1579914	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.
1580542	PCK-<i>Pkhd1<sup>pck</i></sup>/CrljCrl		<a href=http://www.criver.com/products-services/find-model/pck-rat?region=3611> Charles River Laboratories</a>	<a href=http://www.criver.com/products-services/find-model/pck-rat?region=3611> Charles River Laboratories</a>	coisogenic	Unknown		Pkhd1<sup>pck</sup>	11535943																	RRID:RGD_1580542	This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD).
1581616	DA.ACI-(<i>D15Rat23-D15Rat71</i>)/Kini	DA.ACI-(<i>D15Rat23-D15Rat71</i>)/Kini	Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden		congenic	Unknown				15	83040937	85456512	1 - by flanking markers	15	87155990	89768452	1 - by flanking markers	15	83647062	86002030	1 - by flanking markers	15	76003569	78330139	1 - by flanking markers	RRID:RGD_1581616	This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain
1581617	SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar		University of Texas Southwestern Medical Center, Dallas Texas		transgenic	Unknown																				RRID:RGD_1581617	This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)
1581618	SHRSP/Bbb		Max - Delbruck - Center for Molecular Medicine, Germany		inbred	Unknown																				RRID:RGD_1581618	This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany.
1581619	BN.PD-(<i>D8Rat39-D8Rat35</i>),SHR-(<i>D2Mit4-D2Rat28</i>),SHR-(<i>D2Rat103-D2Rat107</i>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown																				RRID:RGD_1581619	This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-<i>Lx</i>.
1581620	SS.SR-(<i>D9Mco61-D9Mco27</i>)/Mco		Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio		congenic	Unknown																				RRID:RGD_1581620	A congenic strain derived from the progenitor strains SS and SR.
1581621	DA.ACI-(<i>D15Rat6-D15Rat48</i>)/Kini	DA.ACI-(<i>D15Rat6-D15Rat48</i>)/Kini	Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden		congenic	Unknown				15	32638412	61161186	1 - by flanking markers	15	37103190	65959514	1 - by flanking markers	15	33219101	62301382	1 - by flanking markers	15	28030665	55302115	1 - by flanking markers	RRID:RGD_1581621	This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain
1581622	SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc		University of Texas Southwestern Medical Center, Dallas, Texas	<a href=http://www.rrrc.us/Strain/?x=318>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo (as of 2017-08-17)																				RRID:RRRC_00318	This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)
1581623	LA/Humd	low autotomy	Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel		segregating_inbred	Unknown																				RRID:RGD_1581623	Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.
1581624	FHH-<i>Lipe<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Lipe<i><sup>m1Mcwi</sup></i>	1581495	1	80663791	80682480	7	1	83511504	83530200	7	1	82248031	82266727	7	1	80965612	80984313	7	RRID:RGD_1581624	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA.
1581625	BN-<i>Hand1<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Hand1<i><sup>m1Mcwi</sup></i>	1581493	10	43423366	43425933	7	10	43050068	43052635	7	10	43250729	43253296	7	10	42006646	42009213	7	RRID:RGD_1581625	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC.
1581626	FHL/EurMcwi	Fawn Hooded Low blood pressure	PGA		inbred	Unknown																				RRID:RGD_1581626	The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage.
1581627	WF.WKY-(<i>D5Uwm66-D5Uwm67</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	73080117	79919776	1 - by flanking markers	5	76105513	82897734	1 - by flanking markers	5	71940894	78777811	1 - by flanking markers	5	69927283	76370048	1 - by flanking markers	RRID:RGD_1581627	A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).
1581628	DA.ACI-(<i>D15Rat6-D15Rat13</i>)/Kini	DA.ACI-(<i>D15Rat 6-D15Rat13</i>)/Kini	Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden		congenic	Unknown				15	32638412	43772355	1 - by flanking markers	15	37103190	51565184	1 - by flanking markers	15	33219101	47814460	1 - by flanking markers	15	28030665	38692741	1 - by flanking markers	RRID:RGD_1581628	This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain
1581629	WF.WKY-(<i>D5Wox8-D5Uwm62</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	4291144	61238981	1 - by flanking markers	5	4498411	64739489	1 - by flanking markers	5	4525738	60225339	1 - by flanking markers	5	5112159	58973694	1 - by flanking markers	RRID:RGD_1581629	A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).
1581630	WF.WKY-(<i>D5Uwm63-D5Uwm64</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	57848236	62299211	1 - by flanking markers	5	61271852	65886550	1 - by flanking markers	5	56733010	61370302	1 - by flanking markers	5	55564549	60051321	1 - by flanking markers	RRID:RGD_1581630	A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).
1581631	WF.WKY-(<i>D5Uwm61-D5Uwm37</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	84434303	130527490	1 - by flanking markers	5	87362775	132652105	1 - by flanking markers	5	83268986	128812854	1 - by flanking markers	5	80813116	123935338	1 - by flanking markers	RRID:RGD_1581631	A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).
1581632	WF.WKY-(<i>D5Uwm65-D5Uwm60</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	65553185	76159022	1 - by flanking markers	5	72838045	79426001	1 - by flanking markers	5	68395096	75274687	1 - by flanking markers	5	63190890	72943679	1 - by flanking markers	RRID:RGD_1581632	A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37).
1581633	DA.ACI-(<i>D15Rat6-D15Rat71</i>)/Kini	DA.ACI-(<i>D15Rat6-D15Rat71</i>)/Kini	Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden		congenic	Unknown				15	32638412	85456512	1 - by flanking markers	15	37103190	89768452	1 - by flanking markers	15	33219101	86002030	1 - by flanking markers	15	28030665	78330139	1 - by flanking markers	RRID:RGD_1581633	This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain
1581634	BN-<i>Adora2a<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2016-10-24)		Adora2a<i><sup>m1Mcwi</sup></i>	1581476	20	13815719	13834131	7	20	16449385	16466147	7	20	14265251	14282873	7	20	13315848	13333386	7	RRID:RGD_1581634	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a.
1581635	WKY/Bbb		Max - Delbruck - Center for Molecular Medicine, Germany		inbred	Unknown																				RRID:RGD_1581635	This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany.
1581636	BN-<i>Cebpe<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Cebpe<i><sup>m1Mcwi</sup></i>	1581494	15	32787946	32789344	7	15	37241081	37242479	7	15	33356119	33357517	7	15	28169711	28171471	7	RRID:RGD_1581636	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG.
1581637	FHH-<i>Has1<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Has1<i><sup>m1Mcwi</sup></i>	1581477	1	56503365	56516133	7	1	60640270	60652067	7	1	59720612	59732409	7	1	58693411	58705653	7	RRID:RGD_1581637	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG.
1581638	DA.ACI-(<i>D15Rat126-D15Rat71</i>)/Kini	DA.ACI-(<i>D15Rat126-D15Rat71</i>)/Kini	Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden		congenic	Unknown				15	85456315	85456512	1 - by flanking markers	15	86610850	89768452	1 - by flanking markers	15	83094829	86002030	1 - by flanking markers	15	75448637	78330139	1 - by flanking markers	RRID:RGD_1581638	This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain
1581639	HAn/Humd	high autotomy new	Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel		segregating_inbred	Unknown																				RRID:RGD_1581639	Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.
1581640	HA/Humd	high autotomy	Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel		segregating_inbred	Unknown																				RRID:RGD_1581640	High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.
1581641	WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm		University of Wisconsin School of Medicine, Madison, Wisconsin		congenic	Unknown				5	77277626	94516069	1 - by flanking markers	5	80544432	97315322	1 - by flanking markers	5	76401130	93273395	1 - by flanking markers	5	74047272	90450412	1 - by flanking markers	RRID:RGD_1581641	A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).
1581642	FHH-<i>Ccr4<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Ccr4<i><sup>m1Mcwi</sup></i>	1581492	8	118883148	118884230	7	8	121843005	121848545	7	8	122530152	122535959	7	8	114176291	114182033	7	RRID:RGD_1581642	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA.
1581643	LAn/Humd	low autotomy new	Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel		segregating_inbred	Unknown																				RRID:RGD_1581643	Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.
1581644	FHH-<i>Htr1a<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=413>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Htr1a<i><sup>m1Mcwi</sup></i>	1581496	2	36434518	36435786	7	2	55362662	55363930	7	2	36246628	36247896	7	2	36693462	36698026	7	RRID:RRRC_00413	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT.
1581645	LL/Mav		Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France		inbred	Unknown																				RRID:RGD_1581645	In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain.
1582184	SR/JrHsd	Dahl Salt-Resistant		<a href =http://www.envigo.com/products-services/research-models-services/models/research-models/rats/inbred/dahl-salt-sensitive-resistant-(rapp)-inbred-rat/sr-jrhsd/>inotiv</a>	inbred	Unknown																				RRID:RGD_1582184	Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.
1582185	SS.SR-(<i>D3Mco36-D3Got166</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	166484910	171009778	1 - by flanking markers	3	178896560	181074971	1 - by flanking markers	3	172850273	177366660	1 - by flanking markers	3	163556062	168974694	1 - by flanking markers	RRID:RGD_1582185	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582186	FHH.FHH.1<sup>BN</sup>-(<i>D1Rat183-D1Rat76</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				1	131123181	230411453	1 - by flanking markers	1	138077032	252243871	1 - by flanking markers	1	137083889	244992610	1 - by flanking markers	1	129384185	224569684	1 - by flanking markers	RRID:RGD_1582186	FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.
1582187	SS.SR-(<i>D3Mco24-D3Got130</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	149822571	166525892	1 - by flanking markers	3	160026579	178936339	1 - by flanking markers	3	155586270	172890235	1 - by flanking markers	3	147739514	163596045	1 - by flanking markers	RRID:RGD_1582187	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582188	SS.SR-(<i>D3Mco36-D3Mco46</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA	<a href=http://www.rrrc.us/Strain/?x=660>Rat Resource and Research Center</a>,	congenic	Cryopreserved Sperm (as of 2019-02-18)				3	168983202	171009778	1 - by flanking markers	3	181074759	181830490	1 - by flanking markers	3	175283587	177366660	1 - by flanking markers	3	167003822	168974694	1 - by flanking markers	RRID:RRRC_00660	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582189	SS.SR-(<i>D3Mco39-D3Got130</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	149822571	149823173	1 - by flanking markers	3	160026579	180014700	1 - by flanking markers	3	155586270	176305870	1 - by flanking markers	3	147739514	167914627	1 - by flanking markers	RRID:RGD_1582189	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582190	SS/JrHsd	Dahl Salt-Sensitive	<a href =http://www.envigo.com/products-services/research-models-services/models/research-models/rats/inbred/dahl-salt-sensitive-resistant-(rapp)-inbred-rat/ss-jrhsd/>Envigo</a>	<a href =http://www.envigo.com/products-services/research-models-services/models/research-models/rats/inbred/dahl-salt-sensitive-resistant-(rapp)-inbred-rat/ss-jrhsd/>Envigo</a>	inbred	Unknown																				RRID:RGD_1582190	Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.
1582191	FHH.FHH.1<sup>BN</sup>-(<i>D1Rat287-D1Rat84</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				1	190114247	259322833	1 - by flanking markers	1	208389496	281400240	1 - by flanking markers	1	201358068	273987019	1 - by flanking markers	1	185356336	252280168	1 - by flanking markers	RRID:RGD_1582191	FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.
1582192	SS.SR-(<i>D3Mco36-D3Got159</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	162807724	171009778	1 - by flanking markers	3	181074759	181074971	1 - by flanking markers	3	177366448	177366660	1 - by flanking markers	3	168974481	168974694	1 - by flanking markers	RRID:RGD_1582192	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582193	FHH.FHH.1<sup>BN</sup>-(<i>D1Mgh13-D1Rat89</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				1	252340389	265343617	1 - by flanking markers	1	274224224	287349830	1 - by flanking markers	1	266793821	279986079	1 - by flanking markers	1	245907761	257976495	1 - by flanking markers	RRID:RGD_1582193	FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.
1582194	SS.SR-(<i>D3Mco78-D3Got130</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	149822571	164079729	1 - by flanking markers	3	160026579	177341735	1 - by flanking markers	3	155586270	171277347	1 - by flanking markers	3	147739514	161994638	1 - by flanking markers	RRID:RGD_1582194	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
1582195	FHH.FHH.1<sup>BN</sup>-(<i>D1Rat173F6B-D1Rat84</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				1	259322503	259322833	1 - by flanking markers	1	281400069	281400240	1 - by flanking markers	1	273986848	273987019	1 - by flanking markers	1	252279996	252280168	1 - by flanking markers	RRID:RGD_1582195	FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.
1582196	FHH.FHH.1<sup>BN</sup>-(<i>D1Rat234-D1Rat265</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				1	41225047	90449243	1 - by flanking markers	1	95453405	95453561	1 - by flanking markers	1	94364073	94364229	1 - by flanking markers	1	90664883	90665040	1 - by flanking markers	RRID:RGD_1582196	FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.
1598797	WF.WKY-(<i>D10Got124-D10Rat187</i>)/Uwm		Department of Oncology, University of Wisconsin, Madison Wisconsin		congenic	Unknown				10	89575059	110385665	1 - by flanking markers	10	88338460	109941891	1 - by flanking markers	10	88544136	110355174	1 - by flanking markers	10	85565469	106428971	1 - by flanking markers	RRID:RGD_1598797	WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL.
1598798	BBDP/WorN		NIH Autoimmune Rat Model Repository and Dev Ctr		inbred	Extinct (as of 2021-02-22)																				RRID:RRRC_00092	Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.
1598799	ACI.FHH-(<i>D1Rat384-D1Rat452</i>)(<i>D17Rat61-D1Arb5</i>)(<i>D17Rat51</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown																				RRID:RGD_1598799	Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain.
1598800	ACI.FHH-(<i>D1Rat384-D1Rat156</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown				1	229184432	253410500	1 - by flanking markers	1	250993318	279213254	1 - by flanking markers	1	243737319	243737466	1 - by flanking markers	1	223390805	223390953	1 - by flanking markers	RRID:RGD_1598800	Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain.
1598801	ACI.FHH-(<i>D1Mit18-D1Mit8</i>)(<i>D14Mit11-D14Hmgc14b</i>)(<i>D14Rat65-D14Rat90</i>)/Eur		Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands		congenic	Unknown																				RRID:RGD_1598801	Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.
1598802	BBDR/WorN		NIH Autoimmune Rat Model Repository and Dev Ctr		inbred	Extinct (as of 2021-02-22)																				RRID:RRRC_00094	Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation
1598803	BBNB/WorN		NIH Autoimmune Rat Model Repository and Dev Ctr.	<a href=http://www.rrrc.us/Strain/?x=93>Rat Resource and Research Center</a>	inbred	Unknown (as of 2020-02-24)																				RRID:RRRC_00093	Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.
1598804	WKY.GHS-(<i>D1Rat32-D1Mit32</i>)		Department of Medicine and Physiology, University of Rochester, Rochester New York		congenic	Unknown				1	112148733	250430505	1 - by flanking markers	1	202649657	272443364	1 - by flanking markers	1	195598053	265002735	1 - by flanking markers	1	244113147	244113296	1 - by flanking markers	RRID:RGD_1598804	GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL
1599674	BBDP.WF-(<i>D8Rat59-D8Sunn1467</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	112242639	128970675	1 - by flanking markers	8	115112735	132425312	1 - by flanking markers	8	133272922	133273132	1 - by flanking markers	8	123815688	123815899	1 - by flanking markers	RRID:RGD_1599674	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1599675	BBDP.WF-(<i>D13Rat124-D13Mgh5</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown		Ptprc	3451	13	46721037	63301552	1 - by flanking markers	13	55662705	71178960	1 - by flanking markers	13	50609228	66204630	1 - by flanking markers	13	45228358	61058078	1 - by flanking markers	RRID:RGD_1599675	The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line.
1599755	F344.BN-(<i>D16Mit5-D16Rat75</i>)		Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy		congenic	Unknown				16	24131965	24132402	1 - by flanking markers	16	24112631	24112769	1 - by flanking markers	16	24228228	24228366	1 - by flanking markers	16	22477482	22477621	1 - by flanking markers	RRID:RGD_1599755	BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment
1599756	BN-<i>Has2<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Has2<i><sup>m1Mcwi</sup></i>	1599566	7	93230135	93256139	7	7	97055458	97081461	7	7	96438046	96464049	7	7	88113326	88139337	7	RRID:RGD_1599756	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA.
1599757	BN-<i>Adora2a<sup>m2Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2016-10-24)		Adora2a<i><sup>m2Mcwi</sup></i>	1599561	20	13815719	13834131	7	20	16449385	16466147	7	20	14265251	14282873	7	20	13315848	13333386	7	RRID:RGD_1599757	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a.
1599758	SS-<i>Sod3<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=415>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2021-11-03)		Sod3<i><sup>m1Mcwi</sup></i>	1599567	14	63381447	63387180	7	14	61071304	61083776	7	14	60958583	60971143	7	14	58610104	58615845	7	RRID:RRRC_00415	Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT.
1599759	GRY/Idr	groggy rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=498&StrainsDir=Asc&s_Strainname=GRY> National BioResource Project for the Rat in Japan</a>, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=498&StrainsDir=Asc&s_Strainname=GRY> National BioResource Project for the Rat in Japan</a>, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan	inbred	Cryopreserved Embryo (as of 2024-09-24)	Neurobiology	Cacna1a<sup>gry</sup>	12880382	19	25188170	25424495	7	19	36502533	36727039	7	19	25627751	25627751	8	19	23644553	23644553	8	RRID:RGD_1599759	Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003.
1599760	SPRD.WKY-(<i>D18Wox8-D18Rat44</i>)/Ibmm		Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium		congenic	Unknown				18	19892650	86863412	1 - by flanking markers	18	20030289	86114102	1 - by flanking markers	18	20285758	87080053	1 - by flanking markers	18	19278901	83218561	1 - by flanking markers	RRID:RGD_1599760	SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.
1599761	BN-<i>Lcat<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Lcat<i><sup>m2Mcwi</sup></i>	1599570	19	35781507	35784966	7	19	48780364	48783830	7	19	37913333	37916799	7	19	33834748	33838214	7	RRID:RGD_1599761	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG.
1599762	SS-<i>Bdkrb2<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Bdkrb2<i><sup>m2Mcwi</sup></i>	1599568	6	129744781	129748851	7	6	138615812	138622272	7	6	129399468	129429676	7	6	124472317	124502497	7	RRID:RGD_1599762	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA.
1599763	SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm		Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium		congenic	Unknown				5	24978084	24978263	1 - by flanking markers	5	29109097	29109277	1 - by flanking markers									RRID:RGD_1599763	SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.
1599764	COP.DA-(<I>D16Rat12-D16Rat90</I>)/Mco		University of Toledo College of Medicine, Toledo, Ohio		congenic	Unknown				16	350121	85734479	1 - by flanking markers	16	1084304	85597057	1 - by flanking markers	16	1090054	86162972	1 - by flanking markers	16	380245	80345693	1 - by flanking markers	RRID:RGD_1599764	Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.
1599765	SS-<i>Klf4<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Klf4<i><sup>m2Mcwi</sup></i>	1599559	5	73446928	73451286	7	5	76447643	76452001	7	5	72283311	72287669	7	5	70278843	70283751	7	RRID:RGD_1599765	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC.
1599766	SS-<i>Hps6<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Hps6<i><sup>m1Mcwi</sup></i>	1599564	1	251226344	251228953	7	1	273191755	273194364	7	1	265761818	265764427	7	1	244853256	244855865	7	RRID:RGD_1599766	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG.
1599767	SS-<i>Htr1a<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Htr1a<i><sup>m2Mcwi</sup></i>	1599562	2	36434518	36435786	7	2	55362662	55363930	7	2	36246628	36247896	7	2	36693462	36698026	7	RRID:RGD_1599767	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC.
1599768	SS-<i>Klf4<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Klf4<i><sup>m1Mcwi</sup></i>	1599569	5	73446928	73451286	7	5	76447643	76452001	7	5	72283311	72287669	7	5	70278843	70283751	7	RRID:RGD_1599768	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC.
1599769	COP.DA-(<I>D3Rat233-D3Mgh14</I>)/Mco		University of Toledo College of Medicine, Toledo, Ohio		congenic	Unknown				3	118863100	118863223	1 - by flanking markers	3	130198712	130198834	1 - by flanking markers	3	123700322	123700444	1 - by flanking markers	3	118376416	118376539	1 - by flanking markers	RRID:RGD_1599769	Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.
1600337	F344.GK-(<i>D1Mgh14-D1Rat90</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	263698966	267111153	1 - by flanking markers	1	285604773	289137268	1 - by flanking markers	1	278228767	281795785	1 - by flanking markers	1	256448513	259647894	1 - by flanking markers	RRID:RGD_1600337	This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.
1600338	SHR.F344-(<i>D12Mgh5-D12Mgh6</i>)/Snk		Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan		congenic	Unknown				12	29130180	42387195	1 - by flanking markers	12	33647399	33647522	1 - by flanking markers	12	31723565	31723688	1 - by flanking markers	12	28064433	28064557	1 - by flanking markers	RRID:RGD_1600338	Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique
1600339	BN.GK-(<i>D1Wox18-D1Got254</i>)/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				1	94626541	264367394	1 - by flanking markers	1	101198387	286341689	1 - by flanking markers	1	100133276	278978026	1 - by flanking markers	1	94644435	257091168	1 - by flanking markers	RRID:RGD_1600339	This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
1600340	DA/BklArbNsi		Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY	<a href=http://www.rrrc.us/Strain/?x=693>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)																				RRID:RRRC_00693	Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI.
1600341	LEW-Tg(Ren2)27/Jmul		Wake Forest University School of Medicine, Winston-Salem, North Carolina		transgenic	Unknown																				RRID:RGD_1600341	This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats
1600342	F344.GK-(<i>D1Got250-D1Rat90</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	259168938	267111153	1 - by flanking markers	1	281200731	289137268	1 - by flanking markers	1	273787505	281795785	1 - by flanking markers	1	252080660	259647894	1 - by flanking markers	RRID:RGD_1600342	This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.
1600343	SHRSP.WKY-(<I>D1Wox29-D1Arb21</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=480> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=480> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	124614679	187092492	1 - by flanking markers	1	131822204	206277202	1 - by flanking markers	1	130779148	199254774	1 - by flanking markers	1	123350408	182418476	1 - by flanking markers	RRID:RGD_1600343	This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy
1600344	F344.GK-(<i>D1Rat175-D1Rat90</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	267110921	267111153	1 - by flanking markers	1	289137107	289137268	1 - by flanking markers	1	281795624	281795785	1 - by flanking markers	1	259647732	259647894	1 - by flanking markers	RRID:RGD_1600344	This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.
1600345	F344.GK-(<i>D1Rat83-D1Rat376</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	252133623	252133935	1 - by flanking markers	1	274017004	274017147	1 - by flanking markers	1	266587077	266587220	1 - by flanking markers	1	245700955	245701099	1 - by flanking markers	RRID:RGD_1600345	This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.
1600346	F344.GK-(<i>D1Swe4-D1Rat85</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	255386328	258599658	1 - by flanking markers	1	277075545	280845045	1 - by flanking markers	1	269633949	273433763	1 - by flanking markers	1	248746112	251790570	1 - by flanking markers	RRID:RGD_1600346	This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.
1600490	SS-Chr 1<sup>BN</sup>/Mcwi		PhysGen		consomic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_1600490	A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed
1625284	Wild1/Hubr		Hubrecht Laboratory, Utrecht, The Netherlands		wild	Unknown																				RRID:RGD_1625284	This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation
1626207	BN-<i>Adora2a<sup>m3Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2016-10-24)		Adora2a<i><sup>m3Mcwi</sup></i>	1642070	20	13815719	13834131	7	20	16449385	16466147	7	20	14265251	14282873	7	20	13315848	13333386	7	RRID:RGD_1626207	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a.
1626210	BN-<i>Lipe<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Lipe<i><sup>m2Mcwi</sup></i>	1642169	1	80663791	80682480	7	1	83511504	83530200	7	1	82248031	82266727	7	1	80965612	80984313	7	RRID:RGD_1626210	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG.
1626211	SS-<i>Cpf2<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown																				RRID:RGD_1626211	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.
1626213	BN-<i>Oxtr<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Oxtr<i><sup>m1Mcwi</sup></i>	1642173	4	148314089	148326797	7	4	207701360	207717840	7	4	144399326	144417598	7	4	145598549	145614674	7	RRID:RGD_1626213	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC.
1626214	BN-<i>Slc27a5<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Slc27a5<i><sup>m2Mcwi</sup></i>	1642170	1	72924630	72935223	7	1	66387832	66398425	7	1	65576599	65587192	7	1	73616556	73627149	7	RRID:RGD_1626214	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA.
1641831	MWF-Chr 6<sup>SHR</sup>/Rkb		Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany		consomic	Unknown																				RRID:RGD_1641831	MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing
1641849	SS.LEW-(<i>D10Mit1-D10Mgh1</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	95368898	95369088	1 - by flanking markers	10	93929621	93929812	1 - by flanking markers									RRID:RGD_1641849	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641850	SHR.WKY-(<i>D1Got158-D1Got161</i>)/Njs		Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK		congenic	Unknown		Spon1	619918	1	169571535	169571693	1 - by flanking markers	1	183593063	183593220	1 - by flanking markers	1	176611942	176612099	1 - by flanking markers	1	165908744	165908902	1 - by flanking markers	RRID:RGD_1641850	This is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region
1641851	SHR.PD-(<I>D8Rat42-D8Arb23</I>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown		Zbtb16|Zbtb16<sup>Lx</sup>	727921|12910834	8	51376771	52822796	1 - by flanking markers	8	51046971	52459221	1 - by flanking markers	8	52446316	53840120	1 - by flanking markers	8	48432652	49868959	1 - by flanking markers	RRID:RGD_1641851	A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-<i>Lx</i> strain
1641852	WF.BBDR-(<i>D4Got48-D4Got43</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown				4	65628995	68036772	1 - by flanking markers	4	65594194	133430955	1 - by flanking markers	4	65776688	68645203	1 - by flanking markers	4	66800270	69276226	1 - by flanking markers	RRID:RGD_1641852	This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.
1641853	SS.LEW-(<i>D10Mco38-D10Mgh1</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	65068360	65122086	1 - by flanking markers	10	65339106	66856515	1 - by flanking markers									RRID:RGD_1641853	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641854	HAS.LAS-(<i>D5Rat70-D5Rat37</i>)/Rar		Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado		congenic	Unknown				5	36386126	148460381	1 - by flanking markers	5	40446731	151220567	1 - by flanking markers	5	35788756	147487820	1 - by flanking markers	5	35189153	141643988	1 - by flanking markers	RRID:RGD_1641854	HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,
1641855	BBDP.WF-(<i>D8Rat73-D8Rat20</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	92863340	94870319	1 - by flanking markers	8	94761016	96840283	1 - by flanking markers	8	95257972	97339444	1 - by flanking markers	8	88552647	90508589	1 - by flanking markers	RRID:RGD_1641855	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1641856	P.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm		Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		congenic	Unknown				4	62832008	127941994	1 - by flanking markers	4	190188458	190188644	1 - by flanking markers	4	62947687	125671711	1 - by flanking markers	4	126192368	126192555	1 - by flanking markers	RRID:RGD_1641856	iP and iNP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection
1641857	BBDP.WF-(<i>D8Rat16-D8Sunn1467</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	98878516	128970675	1 - by flanking markers	8	100780886	132425312	1 - by flanking markers	8	101304999	133273132	1 - by flanking markers	8	94388671	123815899	1 - by flanking markers	RRID:RGD_1641857	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1641858	SHR.WKY-(<i>D1Rat420-D1Rat278</i>)/Njs		Department of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UK		congenic	Unknown				1	167931247	168930831	1 - by flanking markers	1	181904343	182965674	1 - by flanking markers	1	174905726	175980872	1 - by flanking markers	1	164310419	165279420	1 - by flanking markers	RRID:RGD_1641858	This is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region
1641859	SS.MNS-(<i>D10Bra1-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	101848470	101848683	1 - by flanking markers													RRID:RGD_1641859	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641860	SS.MNS-(<i>D10Mco62-D10Mit1</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72063231	95369088	1 - by flanking markers	10	70763267	93929812	1 - by flanking markers									RRID:RGD_1641860	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641861	HAS.LAS-(<i>D2Rat53-D2Rat138</i>)/Rar		Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado	<a href=http://www.rrrc.us/Strain/?x=729>Rat Resource and Research Center</a>	congenic	Cryopreserved Sperm (as of 2019-02-26)				2	204077549	230157845	1 - by flanking markers	2	230770662	256283467	1 - by flanking markers	2	211301116	237742948	1 - by flanking markers	2	196146703	221167075	1 - by flanking markers	RRID:RRRC_00729	HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,
1641862	F344-<i>Apc<sup>Pirc</i></sup>/Uwm		University of Wisconsin-Madison, Madison, Wisconsin	<a href=http://www.rrrc.us/Strain/?x=782>Rat Resource and Research Center</a>	mutant	Live Animals; Cryopreserved Sperm (as of 2018-07-16)		Apc<sup>Pirc</sup>	1554322	18	26732147	26790383	7	18	26725560	26820837	7	18	27011710	27106323	7	18	25828558	25925511	7	RRID:RRRC_00782	Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam)
1641863	SHR.PD-(<I>D8Mgh9-D8Rat149</I>)/Cub		Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic		congenic	Unknown		Zbtb16|Zbtb16<sup>Lx</sup>	727921|12910834	8	58692901	58693265	1 - by flanking markers	8	58297648	58297798	1 - by flanking markers	8	59716199	59716349	1 - by flanking markers	8	55523877	55524028	1 - by flanking markers	RRID:RGD_1641863	A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv.
1641864	WF/CrCrli		<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italy	<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italy	inbred	Unknown																				RRID:RGD_1641864	J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute.
1641865	SD-<i>Brca2<sup>m1Uwm</i></sup>		University of Wisconsin-Madison, Madison, Wisconsin	<a href=http://www.rrrc.us/Strain/?x=286>Rat Resource and Research Center</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)		Brca2<i><sup>m1Uwm</sup></i>	728326	12	4282952	4323693	7	12	490733	535090	7	12	518257	518257	8	12	74070	74070	8	RRID:RRRC_00286	9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon).
1641866	SS.LEW-(<i>D10Mit10-D10Rat24</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	27184741	79229233	1 - by flanking markers	10	27082535	78195122	1 - by flanking markers	10	27237530	78343192	1 - by flanking markers	10	26521957	75632053	1 - by flanking markers	RRID:RGD_1641866	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641867	Iusm:P	alcohol-preferring	Indiana Alcohol Research Center at the Indiana University School of Medicine		outbred	Unknown		Snca	3729																	RRID:RGD_1641867	These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop this preference line (P) and non-preference line (Iusm:NP, RGD:1641873).
1641868	WF.BBDR-(<i>D4Rat93-D4Rat228</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown		Tcrb	3834	4	67390393	67390598	1 - by flanking markers	4	67470286	67470490	1 - by flanking markers	4	67663300	67663504	1 - by flanking markers	4	68653456	68653663	1 - by flanking markers	RRID:RGD_1641868	This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.
1641869	SS.MNS-(<i>D10Mco31-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	84284413	101848683	1 - by flanking markers	10	83219971	83220224	1 - by flanking markers	10	83411403	83411656	1 - by flanking markers	10	80536974	80537228	1 - by flanking markers	RRID:RGD_1641869	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641870	BBDP.WF-(<i>D8Rat73-D8Rat121</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	92863340	118705380	1 - by flanking markers	8	94761016	121648073	1 - by flanking markers	8	95257972	95258175	1 - by flanking markers	8	88552647	88552853	1 - by flanking markers	RRID:RGD_1641870	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1641871	SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72063231	84284667	1 - by flanking markers	10	70763267	83220224	1 - by flanking markers	10	83411403	83411656	1 - by flanking markers	10	80536974	80537228	1 - by flanking markers	RRID:RGD_1641871	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641872	SS.LEW-(<i>D10Mco38-D10Mco41</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	65068360	85793448	1 - by flanking markers	10	65339106	84798381	1 - by flanking markers	10	85007626	85007896	1 - by flanking markers	10	82057244	82057515	1 - by flanking markers	RRID:RGD_1641872	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1641873	Iusm:NP	alcohol-nonpreferring	Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		outbred	Unknown		Snca	3729																	RRID:RGD_1641873	These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop a preference line (Iusm:P, RGD:1641867) and this non-preference line (Iusm:NP).
1641874	BBDP.WF-(<i>D8Rat73-D8Rat90</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	92863340	114974688	1 - by flanking markers	8	94761016	118204000	1 - by flanking markers	8	95257972	118862813	1 - by flanking markers	8	88552647	110572221	1 - by flanking markers	RRID:RGD_1641874	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1641875	SHR-Chr Y<sup>BN</sup>/Cub		Czech Academy of Sciences, Prague, Czech Republic		consomic	Unknown																				RRID:RGD_1641875	BN-<i>Lx</i>/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations
1641876	BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)/Sunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada		congenic	Unknown				8	92863340	128970675	1 - by flanking markers	8	94761016	132425312	1 - by flanking markers	8	95257972	133273132	1 - by flanking markers	8	88552647	123815899	1 - by flanking markers	RRID:RGD_1641876	WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP
1641877	NP.P-(<i>D4Rat119-D4Rat55</i>)/Iusm		Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana		congenic	Unknown		Akr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap1	2092|3197|3729|68368|735049|1307836|1308501|1310949|1311418	4	62832008	127941994	1 - by flanking markers	4	190188458	190188644	1 - by flanking markers	4	62947687	125671711	1 - by flanking markers	4	126192368	126192555	1 - by flanking markers	RRID:RGD_1641877	Male iP and female iNP rats were crossed to get F1 animals which were further backcrossed to iNP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection
1641878	WF.BBDR-(<i>Clcn1-D4Rat228</i>)/Wor		University of Massachusetts Medical School, Worcerster, MA		congenic	Unknown		Clcn1	2360	4	70052319	70081449	1 - by flanking markers	4	136479719	136509472	1 - by flanking markers	4	71674218	71704318	1 - by flanking markers	4	71171949	71201483	1 - by flanking markers	RRID:RGD_1641878	This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.
1641879	SS-Chr 19<sup>SHR</sup>/Rkb		Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany		consomic	Unknown																				RRID:RGD_1641879	SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing
1641880	SD-<i>Brca1<sup>m1Uwm</i></sup>		University of Wisconsin-Madison, Madison, Wisconsin	<a href=http://www.rrrc.us/Strain/?x=285>Rat Resource and Research Center</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)		Brca1|Brca1<i><sup>m1Uwm</sup></i>	2218|728298	10	90513630	90572676	7	10	89192653	89252760	7	10	89394821	89455093	7	10	86417441	86477762	7	RRID:RRRC_00285	9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon.
1642017	BBDR/WorBrm		<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	inbred	Unknown																				RRID:RGD_1642017	Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc.
1642018	BBDP/WorBrm		<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	inbred	Unknown																				RRID:RGD_1642018	This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.
1642036	SHR/OlaIpcv-mt<sup>BN/Crl</sup>		Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic		conplastic	Unknown																				RRID:RGD_1642036	Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background
1642269	SS-<i>Birc3<sup>m2Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Birc3<i><sup>m2Mcwi</sup></i>	1642178	8	4682202	4696856	7	8	6047454	6075236	7	8	6048590	6076828	7	8	5000844	5028470	7	RRID:RGD_1642269	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG.
1642270	BN-Lcat<i><sup>m3Mcwi</i></sup>		PGA	<a href=http://www.rrrc.us/Strain/?x=397>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm; Cryorecovery		Lcat<i><sup>m3Mcwi</sup></i>	1642175	19	35781507	35784966	7	19	48780364	48783830	7	19	37913333	37916799	7	19	33834748	33838214	7	RRID:RRRC_00397	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC.
1642271	SS-<i>Klf4<sup>m3Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=417>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Klf4<i><sup>m3Mcwi</sup></i>	1642179	5	73446928	73451286	7	5	76447643	76452001	7	5	72283311	72287669	7	5	70278843	70283751	7	RRID:RRRC_00417	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT.
1642272	SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	70757255	72827158	1 - by flanking markers	10	69542746	71779712	1 - by flanking markers	10	69910832	71870652	1 - by flanking markers	10	67502108	69424978	1 - by flanking markers	RRID:RGD_1642272	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642273	SS-<i>Thbd<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Thbd<i><sup>m1Mcwi</sup></i>	1642182	3	137158955	137162607	7	3	149159895	149163547	7	3	142748673	142752325	7	3	135863366	135867018	7	RRID:RGD_1642273	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA.
1642274	SS-<i>Has1<sup>m2Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Has1<i><sup>m2Mcwi</sup></i>	1642171	1	56503365	56516133	7	1	60640270	60652067	7	1	59720612	59732409	7	1	58693411	58705653	7	RRID:RGD_1642274	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC.
1642275	SS.LEW-(<i>D10Rat29-D10Mco88</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	68842878	71513333	1 - by flanking markers	10	67642121	71109330	1 - by flanking markers	10	67988035	70647306	1 - by flanking markers	10	68230134	68230352	1 - by flanking markers	RRID:RGD_1642275	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642276	SS-<i>Kcna5<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=418>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Kcna5<i><sup>m1Mcwi</sup></i>	1642177	4	162896283	162898091	7	4	226075051	226076859	7	4	159077195	159079003	7	4	159354689	159358173	7	RRID:RRRC_00418	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA.
1642277	SS-<i>Cpt2<sup>m1Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=416>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Cpt2<i><sup>m1Mcwi</sup></i>	1642174	5	129007685	129025501	7	5	131353542	131370821	7	5	127505646	127523016	7	5	122664677	122682126	7	RRID:RRRC_00416	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC.
1642278	SS-<i>Ghsr<sup>m2Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Ghsr<i><sup>m2Mcwi</sup></i>	1642180	2	113269623	113272999	7	2	132784207	132789319	7	2	113065953	113071265	7	2	110268489	110271865	7	RRID:RGD_1642278	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC.
1642279	SS.LEW-(<i>D10Arb9-D10Rat161</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	64308668	97589703	1 - by flanking markers	10	66048908	96133217	1 - by flanking markers	10	65590122	65590250	1 - by flanking markers	10	63221094	63221223	1 - by flanking markers	RRID:RGD_1642279	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642281	SS-<i>Podxl<sup>m1Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Podxl<i><sup>m1Mcwi</sup></i>	1642176	4	58611904	58658598	7	4	58581513	58645671	7	4	58829049	58893353	7	4	60135124	60181829	7	RRID:RGD_1642281	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA.
1642282	SS-<i>Cacna1g<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Cacna1g<i><sup>m1Mcwi</sup></i>	1642168	10	83043636	83112886	7	10	81950594	82017885	7	10	82129071	82197828	7	10	79354998	79422960	7	RRID:RGD_1642282	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT.
1642283	SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	68842878	72827158	1 - by flanking markers	10	67642121	71779712	1 - by flanking markers	10	67988035	71870652	1 - by flanking markers	10	69424852	69424978	1 - by flanking markers	RRID:RGD_1642283	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642284	SS-<i>Fgl2<sup>m2Mcwi</i></sup>		PGA		mutant	Unknown		Fgl2<i><sup>m2Mcwi</sup></i>	1642181	4	9176333	9181976	7	4	10315666	10321309	7	4	10323598	10329241	7	4	13710566	13716207	7	RRID:RGD_1642284	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT.
1642285	SS.LEW-(<i>D10Arb9-D10Rat57</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	64308668	74388696	1 - by flanking markers	10	66048908	73484175	1 - by flanking markers	10	65590122	73582866	1 - by flanking markers	10	63221094	70982751	1 - by flanking markers	RRID:RGD_1642285	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642287	SS.LEW-(<i>D10Arb9-D10Mco84</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	64308668	70757419	1 - by flanking markers	10	66048908	69542910	1 - by flanking markers	10	65590122	69910996	1 - by flanking markers	10	63221094	67502273	1 - by flanking markers	RRID:RGD_1642287	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642288	SS.LEW-(<i>D10Mco89-D10Got101</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72684998	78262332	1 - by flanking markers	10	71638135	77223025	1 - by flanking markers	10	71727774	77360263	1 - by flanking markers	10	69282350	74676620	1 - by flanking markers	RRID:RGD_1642288	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642289	SS-<i>Serpina5<sup>m1Mcwi</i></sup>		PGA		mutant	Unknown		Serpina5<i><sup>m1Mcwi</sup></i>	1642167	6	128156901	128161334	7	6	136972583	136990812	7	6	127753152	127772403	7	6	123009224	123028412	7	RRID:RGD_1642289	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT.
1642362	SS-<i>Has1<sup>m3Mcwi</i></sup>		PGA		mutant	Unknown		Has1<i><sup>m3Mcwi</sup></i>	1642359	1	56503365	56516133	7	1	60640270	60652067	7	1	59720612	59732409	7	1	58693411	58705653	7	RRID:RGD_1642362	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC.
1642363	BN-<i>Fgl2<sup>m3Mcwi</i></sup>		PGA		mutant	Unknown		Fgl2<i><sup>m3Mcwi</sup></i>	1642355	4	9176333	9181976	7	4	10315666	10321309	7	4	10323598	10329241	7	4	13710566	13716207	7	RRID:RGD_1642363	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT.
1642364	SS-<i>Ghsr<sup>m3Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=421>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ghsr<i><sup>m3Mcwi</sup></i>	1642357	2	113269623	113272999	7	2	132784207	132789319	7	2	113065953	113071265	7	2	110268489	110271865	7	RRID:RRRC_00421	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA.
1642365	SS-<i>Fgl2<sup>m4Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=420>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Fgl2<i><sup>m4Mcwi</sup></i>	1642354	4	9176333	9181976	7	4	10315666	10321309	7	4	10323598	10329241	7	4	13710566	13716207	7	RRID:RRRC_00420	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT.
1642366	SS-<i>Lcat<sup>m4Mcwi</i></sup>		PhysGen, Rat Resource & Research Center		mutant	Extinct (as of 2017-01-26)		Lcat<i><sup>m4Mcwi</sup></i>	1642358	19	35781507	35784966	7	19	48780364	48783830	7	19	37913333	37916799	7	19	33834748	33838214	7	RRID:RGD_1642366	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT.
1642367	BN-<i>Ccr2<sup>m2Mcwi</i></sup>		PhysGen		mutant	Extinct (as of 2017-01-26)		Ccr2<i><sup>m2Mcwi</sup></i>	1642356	8	128892784	128893905	7									8	123734465	123742483	7	RRID:RGD_1642367	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC.
1642439	SS-<i>Lcat<sup>m5Mcwi</i></sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=419>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lcat<i><sup>m5Mcwi</sup></i>	1642438	19	35781507	35784966	7	19	48780364	48783830	7	19	37913333	37916799	7	19	33834748	33838214	7	RRID:RRRC_00419	Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA.
1642689	BN.OLETF-(<i>D1Rat169-D1Rat90</i>)/Got		Otsuka Pharmacuetical Company, Tokushima, Japan		congenic	Unknown		Prlhr	71037	1	229876870	267111153	1 - by flanking markers	1	251652807	289137268	1 - by flanking markers	1	244401175	281795785	1 - by flanking markers	1	224054293	259647894	1 - by flanking markers	RRID:RGD_1642689	OLETF/Got females were crossed with BN/Crlj to produce F<sub>1</sub> which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped
1642690	LA-<i>cp</i>/NJcr		Department of Surgery, University of Alberta, Edmonton, Canada		congenic	Unknown																				RRID:RGD_1642690	Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta.
1642968	SS.LEW-(<i>D10Mco84-D10Rat58</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	70757255	71067824	1 - by flanking markers	10	69542746	70966782	1 - by flanking markers	10	69910832	70202084	1 - by flanking markers	10	67502108	67785171	1 - by flanking markers	RRID:RGD_1642968	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642969	SS.LEW-(<i>D10Mco84-D10Mco134</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	70757255	70757419	1 - by flanking markers	10	69542746	69542910	1 - by flanking markers	10	69910832	69910996	1 - by flanking markers	10	67502108	67502273	1 - by flanking markers	RRID:RGD_1642969	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642970	SS.LEW-(<i>D10Mco113-D10Got93</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72827032	72827158	1 - by flanking markers	10	71779587	71779712	1 - by flanking markers	10	71870527	71870652	1 - by flanking markers	10	69424852	69424978	1 - by flanking markers	RRID:RGD_1642970	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642971	SS.LEW-(<i>D10Mco84-D10Mco129</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	70757255	70757419	1 - by flanking markers	10	69542746	69542910	1 - by flanking markers	10	69910832	69910996	1 - by flanking markers	10	67502108	67502273	1 - by flanking markers	RRID:RGD_1642971	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642972	SS.LEW-(<i>D10Mco84-D10Mco143</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	70757255	70757419	1 - by flanking markers	10	69542746	69542910	1 - by flanking markers	10	69910832	69910996	1 - by flanking markers	10	67502108	67502273	1 - by flanking markers	RRID:RGD_1642972	This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
1642989	SS-Tg(CAG-EGFP)1Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Cryopreserved Sperm (as of 2019-04-04)																				RRID:RGD_1642989	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642990	SD-Tg(CAG-EGFP)63Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642990	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.
1642991	SS-Tg(CAG-eGFP)18Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642991	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642992	SS-Tg(CAG-EGFP)28Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642992	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642993	SD-Tg(CAG-EGFP)97Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642993	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.
1642994	SS-Tg(CAG-EGFP)43Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642994	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642995	SS-Tg(CAG-eGFP)10Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642995	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642996	SS-Tg(CAG-EGFP)2Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642996	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1642997	SS-Tg(CAG-EGFP)23Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		transgenic	Unknown																				RRID:RGD_1642997	This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.
1643001	FH/Unc	Fawn-hooded	Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina		inbred	Unknown																				RRID:RGD_1643001	A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill
1643002	SHR.WKY-(<i>D1Rat420-D1Got161</i>)/Njs		Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK		congenic	Unknown		Spon1	619918	1	167931247	167931390	1 - by flanking markers	1	181904343	181904486	1 - by flanking markers	1	174905726	174905869	1 - by flanking markers	1	164310419	164310563	1 - by flanking markers	RRID:RGD_1643002	Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR
1643007	DA.ACI-(<i>D12Wox12-D12Rat53</i>)/Arb		The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland		congenic	Unknown				12	20932555	43863270	1 - by flanking markers	12	24663002	50380790	1 - by flanking markers	12	22650721	48598906	1 - by flanking markers	12	19610889	42828880	1 - by flanking markers	RRID:RGD_1643007	ACI/SegHsd and DA/OlaHsd were crossed to get F<sub>2</sub> animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd
1643010	F344.OLETF-(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tj		University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan		congenic	Unknown																				RRID:RGD_1643010	double congenic strain generated by intercrossing F344.OLETF-(<i>D7Rat18-D7Mit2</i>)/Tj and F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj and F<sub>2</sub> rats screened for homozygosity
2289819	SS.MNS-(<i>D10Mco62-D10Got99</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72063231	76465800	1 - by flanking markers	10	70763267	74612561	1 - by flanking markers	10	75493824	75493944	1 - by flanking markers	10	72964095	72964216	1 - by flanking markers	RRID:RGD_2289819	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289820	SS.MNS-(<i>D10Mco30-D10Got91</i>)/1Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	78112169	1 - by flanking markers	10	73693979	77074440	1 - by flanking markers	10	76420583	77211758	1 - by flanking markers	10	73887148	73887455	1 - by flanking markers	RRID:RGD_2289820	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289821	SS.MNS-(<i>D10Mco30-D10Got91</i>)/3Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	78112169	1 - by flanking markers	10	73693979	77074440	1 - by flanking markers	10	76420583	77211758	1 - by flanking markers	10	73887148	73887455	1 - by flanking markers	RRID:RGD_2289821	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289822	SS.MNS-(<i>D10Mco30-D10Got112</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	79857935	1 - by flanking markers	10	73693979	78816367	1 - by flanking markers	10	76420583	78970405	1 - by flanking markers	10	73887148	76246212	1 - by flanking markers	RRID:RGD_2289822	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289823	SS.MNS-(<i>D10Mco62-D10Mco30</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	72063231	77547622	1 - by flanking markers	10	70763267	73694285	1 - by flanking markers	10	76420583	76420889	1 - by flanking markers	10	73887148	73887455	1 - by flanking markers	RRID:RGD_2289823	This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289824	SS.MNS-(<i>D10Mco30-D10Got101</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	78262332	1 - by flanking markers	10	73693979	77223025	1 - by flanking markers	10	76420583	77360263	1 - by flanking markers	10	73887148	74676620	1 - by flanking markers	RRID:RGD_2289824	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289825	SS.MNS-(<i>D10Rat24-D10Mco31</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	79229067	84284667	1 - by flanking markers	10	78194957	83220224	1 - by flanking markers	10	78343027	83411656	1 - by flanking markers	10	75631887	80537228	1 - by flanking markers	RRID:RGD_2289825	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289826	SS.MNS-(<i>D10Mco30-D10Got91</i>)/2Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	78112169	1 - by flanking markers	10	73693979	77074440	1 - by flanking markers	10	76420583	77211758	1 - by flanking markers	10	73887148	73887455	1 - by flanking markers	RRID:RGD_2289826	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289827	SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				10	77547289	84284667	1 - by flanking markers	10	73693979	83220224	1 - by flanking markers	10	76420583	83411656	1 - by flanking markers	10	73887148	80537228	1 - by flanking markers	RRID:RGD_2289827	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289913	SS.MNS-(<i>D10Rat13-D10Rat12</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	97152234	99198997	1 - by flanking markers	10	95701164	97759008	1 - by flanking markers	10	95967019	98044833	1 - by flanking markers	10	92698959	94725019	1 - by flanking markers	RRID:RGD_2289913	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289916	SS.MNS-(<i>D10Mco15-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	98392296	101848683	1 - by flanking markers	10	97028717	97028928	1 - by flanking markers	10	97308358	97308569	1 - by flanking markers	10	93995749	93995963	1 - by flanking markers	RRID:RGD_2289916	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2289917	SS.MNS-(<i>D10Mco70-D10Mit11</i>)/Jr		Medical College of Ohio, Toledo		congenic	Unknown				10	101355656	101848683	1 - by flanking markers	10	99976910	99977168	1 - by flanking markers	10	100287441	100287699	1 - by flanking markers	10	96836006	96836268	1 - by flanking markers	RRID:RGD_2289917	This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2290056	F344-<i>Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=423>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup>	2290055	4	105866419	106099850	7	4	165192607	165237016	7	4	100422256	100465152	7	4	104614665	104653122	7	RRID:RRRC_00423	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4<sup>th</sup> intron of the Rbed1 gene.
2290057	F344-TgTn(T2/Bart3)1Ceb		PGA		transgenic	Cryopreserved Sperm																				RRID:RGD_2290057	The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.
2290064	F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=344>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup>	2290060	2	143350286	143485716	7	2	163115873	163282223	7	2	143433102	143605757	7	2	138307676	138476856	7	RRID:RRRC_00344	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene.
2290065	F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup></i>		PGA		mutant	Unknown		CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup>	2290059																	RRID:RGD_2290065	this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).
2290066	F344-<i>Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup></i>		PGA		mutant	Unknown		Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup>	2290061	1	99805922	100758002	7	1	106397933	107260905	7	1	105348577	106218970	7	1	99709305	100573872	7	RRID:RGD_2290066	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1.
2290067	F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup></i>		PGA		mutant	Unknown		BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup>	2290062																	RRID:RGD_2290067	this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).
2290078	F344-<i>Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=385>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup>	2290068	8	63578001	63783813	7	8	64335907	64534890	7	8	64573248	64777607	7	8	60149234	60352330	7	RRID:RRRC_00385	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene.
2290079	F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup></i>		PGA		mutant	Unknown		BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup>	2290069																	RRID:RGD_2290079	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290080	F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup></i>		PGA		mutant	Unknown		BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup>	2290074																	RRID:RGD_2290080	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290081	F344-<i>BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup></i>		PGA	<a href=http://www.rrrc.us/Strain/?x=367>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm		BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup>	2290072																	RRID:RRRC_00367	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290082	F344-<i>Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=425>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup>	2290071	13	60584348	61024196	7	13	68507826	68938032	7	13	63526486	63959390	7	13	58413883	58846828	7	RRID:RRRC_00425	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene.
2290083	F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup></i>		PGA		mutant	Unknown		Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup>	2290073	3	133734890	134249326	7	3	145760074	146259491	7	3	139333942	139835728	7	3	132552119	133051192	7	RRID:RGD_2290083	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene.
2290100	F344-<i>Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup></i>		PGA		mutant	Unknown		Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup>	2290086	3	141385480	141407860	7	3	152905464	152927857	7	3	146546424	146568828	7	3	139575659	139598163	7	RRID:RGD_2290100	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Entpd6 gene.
2290101	F344-<i>CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup></i>		PGA		mutant	Unknown		CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup>	2290092																	RRID:RGD_2290101	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290102	F344-<i>Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup></i>		PGA		mutant	Unknown		Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup>	2290085	X	10344050	10424665	7	X	121716856	121876640	7	X	121578965	121735014	7	X	113942309	114107299	7	RRID:RGD_2290102	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene.
2290103	F344-<i>Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=343>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup>	2290090	16	63937796	64126183	7	16	62632432	63718738	7	16	62969573	64065063	7	16	59250658	60304519	7	RRID:RRRC_00343	this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene.
2290104	F344-<i>Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup></i>		PGA		mutant	Unknown		Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup>	2290088	11	4273771	5330393	7	11	7871257	8090100	7	11	4175078	4397335	7	11	4548367	5525420	7	RRID:RGD_2290104	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene.
2290105	F344-<i>Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup></i>		PGA		mutant	Unknown		Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup>	2290097	1	82436626	82523827	7	1	85379609	85467354	7	1	84168494	84254679	7	1	82650750	82738345	7	RRID:RGD_2290105	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene.
2290106	F344-<i>BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup></i>		PGA		mutant	Unknown		BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup>	2290070																	RRID:RGD_2290106	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290107	F344-<i>Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup></i>		PGA		mutant	Unknown		Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup>	2290095	3	138826625	138830963	7	3	150801395	150805733	7	3	144427430	144431768	7	3	137432049	137436654	7	RRID:RGD_2290107	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cyss gene.
2290108	F344-<i>LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=338>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup>	2290089	15	30634899	32273880	7													RRID:RRRC_00338	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene.
2290109	F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup></i>		PGA		mutant	Unknown		CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup>	2290087																	RRID:RGD_2290109	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290110	F344-<i>Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=362>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup>	2290096	20	37349188	37397427	7	20	29715580	29824252	7	20	27895981	28004767	7	20	26309833	26418511	7	RRID:RRRC_00362	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene.
2290111	F344-<i>Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup></i>		PGA		mutant	Unknown		Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup>	2290093	3	137650903	137654776	7	3	149628692	149632565	7	3	143219671	143223544	7	3	136336923	136340796	7	RRID:RGD_2290111	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cst3 gene.
2290112	F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup></i>		PGA		mutant	Unknown		CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup>	2290094																	RRID:RGD_2290112	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290113	F344-<i>Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=387>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup>	2290098	7	63388665	63566226	7	7	66221368	66695803	7	7	66017066	66496690	7	7	58942598	59418640	7	RRID:RRRC_00387	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene.
2290114	F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup></i>		PGA		mutant	Unknown		Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup>	2290091	3	133734890	134249326	7	3	145760074	146259491	7	3	139333942	139835728	7	3	132552119	133051192	7	RRID:RGD_2290114	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene.
2290135	F344-<i>Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=337>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup>	2290123	1	120539002	120600102	7	1	128095353	128156041	7	1	127010587	127071570	7	1	119689626	119750711	7	RRID:RRRC_00337	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Chsy1.
2290136	F344-<i>Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup></i>		PGA		mutant	Unknown		Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup>	2290127	6	126403837	126538501	7	6	135226112	135364945	7	6	126015799	126158727	7	6	121279590	121419811	7	RRID:RGD_2290136	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Slc24a4 gene.
2290137	F344-<i>BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup></i>		PGA	<a href=http://www.rrrc.us/Strain/?x=361>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm		BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup>	2290126																	RRID:RRRC_00361	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290138	F344-<i>Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup></i>		PGA		mutant	Extinct (as of 2016-12-12)		Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup>	2290128	5	128736183	128739369	7	5	130891667	131081696	7	5	127043344	127233395	7	5	122222155	122412141	7	RRID:RRRC_00332	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene.
2290139	F344-<i>AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup></i>		PGA		mutant	Unknown		AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup>	2290122																	RRID:RGD_2290139	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290140	F344-<i>BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup></i>		PGA		mutant	Unknown		BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup>	2290115																	RRID:RGD_2290140	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290141	F344-<i>Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup></i>		PGA, Transposagen.	<a href=http://www.rrrc.us/Strain/?x=381>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2016-11-11)		Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup>	2290121	10	7040725	7137154	7	10	5894187	6002068	7	10	7093406	7200439	7	10	6996688	7092835	7	RRID:RRRC_00381	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene.
2290142	F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup></i>		PGA		mutant	Unknown		LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup>	2290118																	RRID:RGD_2290142	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.
2290143	F344-<i>Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=335>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup>	2290116	3	137447072	137490500	7	3	149431212	149473190	7	3	143017571	143063904	7	3	136132248	136179280	7	RRID:RRRC_00335	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene.
2290144	F344-<i>Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=334>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-13)		Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup>	2290129	14	28385112	28854677	7	14	28183727	29040121	7	14	28362176	29226085	7	14	26336320	27104060	7	RRID:RRRC_00334	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene.
2290145	F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup></i>		PGA		mutant	Unknown		BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup>	2290120																	RRID:RGD_2290145	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2290146	F344-<i>Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=380>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup>	2290125	1	242794858	243103437	7	1	264652842	264956664	7	1	257156023	257465440	7	1	236243445	236552571	7	RRID:RRRC_00380	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene.
2290147	F344-<i>Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=331>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup>	2290124	3	127691668	127825206	7	3	139023075	139151792	7	3	132560437	132689313	7	3	126847878	126978010	7	RRID:RRRC_00331	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Sptlc3 gene.
2290148	F344-<i>Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup></i>		PGA		mutant	Extinct (as of 2016-12-21)		Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup>	2290117	8	67313472	67542723	7	8	67784868	68010809	7	8	68055976	68282656	7	8	63625220	63852090	7	RRID:RRRC_00333	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene.
2290159	F344-<i>Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup></i>		PGA		mutant	Unknown		Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup>	2290150	15	5180002	5186910	7													RRID:RGD_2290159	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene.
2290160	F344-<i>Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=326>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup>	2290154	12	36678613	36753316	7	12	42938832	43014142	7	12	41073296	41149799	7	12	35542389	35618901	7	RRID:RRRC_00326	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene.
2290161	F344-<i>Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup></i>		PGA		mutant	Extinct (as of 2017-01-30)		Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup>	2290156	13	82971926	82995262	7	13	90108152	90202246	7	13	85465015	85559113	7	13	79460229	79483557	7	RRID:RRRC_00328	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene.
2290162	F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=379>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup>	2290149	19	27722430	28363639	7	19	40508684	41132035	7	19	29592889	30341528	7	19	25920189	26670085	7	RRID:RRRC_00379	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.
2290163	F344-TgTn(T2/Bart3)2Ceb	transposon sleeping beauty	PGA		transgenic	Extinct (as of 2016-11-14)																				RRID:RGD_2290163	The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.
2290164	F344-<i>Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=325>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm; Cryorecovery (as of 2024-04-16)		Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup>	2290153	1	35803552	36269628	7	1	42947742	43158478	7	1	41608287	42086662	7	1	41512146	41983382	7	RRID:RRRC_00325	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109<sup>th</sup> intron of the Syne1 gene.
2290165	F344-<i>Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup></i>		PGA		mutant	Extinct (as of 2017-01-24)		Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup>	2290157	8	28587019	29019888	7	8	30073163	31070882	7	8	30039332	31041755	7	8	27376582	28366604	7	RRID:RRRC_00327	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene.
2290166	F344-<i>Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=424>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup>	2290155	1	209628425	209643694	7	1	229198739	229215831	7	1	222207887	222224993	7	1	204143257	204160384	7	RRID:RRRC_00424	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene.
2290167	F344-<i>Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup></i>		PGA		mutant	Unknown		Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup>	2290152	11	70735283	70930374	7	11	75239783	75454358	7	11	72164566	72378895	7	11	68911883	69103230	7	RRID:RGD_2290167	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Dlg1 gene.
2290168	F344-<i>Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup></i>		PGA		mutant	Extinct (as of 2017-01-24)		Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup>	2290151	2	219410394	219550910	7	2	246260843	246406296	7	2	226899604	227044916	7	2	210858515	211003480	7	RRID:RRRC_00330	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene.
2290169	F344-Tg(PGK2-sb11)Ceb	Sleeping beauty transposase transgenic	PGA		transgenic	Extinct (as of 2016-11-14)																				RRID:RGD_2290169	sb11 cDNA linked to human PGK2 promoter was used.
2290170	F344-<i>Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=329>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup>	2290158	18	86064574	86157909	7	18	85337942	85433295	7	18	86299392	86394772	7	18	82449924	82545107	7	RRID:RRRC_00329	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3<sup>rd</sup> intron of the Cd226 gene.
2290171	F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup></i>		PGA		mutant	Unknown		LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup>	2290119																	RRID:RGD_2290171	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.
2290186	SD-Tg(SOD1*G93A)39		Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan		transgenic	Unknown		SOD1	730855																	RRID:RGD_2290186	SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation
2290187	SD-Tg(SOD1*H46R)4		Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan		transgenic	Unknown		SOD1	730855																	RRID:RGD_2290187	SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation
2290272	SS/JrNgs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=798> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=798> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension																			RRID:RGD_2290272	strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan
2290273	SHRSP.WKY-<i>(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)</i>/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=785> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=785> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2290273	The desired fragment is transferred from WKY to SHRSP
2290274	SHRSP.WKY-<i>(D15Rat2-D15Rat94)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=795> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=795> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			15	11832728	76115762	1 - by flanking markers	15	15643978	80627247	1 - by flanking markers	15	11605245	77072316	1 - by flanking markers	15	10355054	69625966	1 - by flanking markers	RRID:RGD_2290274	This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2290275	SHRSP.WKY-<i>(D3Tkyo7-D3Rat1)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=786&StrainsPage=20&StrainsDir=Asc>National Bio Resource Project</a> Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=786&StrainsPage=20&StrainsDir=Asc>National Bio Resource Project</a> Japan	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	170016252	170016653	1 - by flanking markers	3	180127863	180128021	1 - by flanking markers	3	176417943	176418101	1 - by flanking markers	3	168026691	168026850	1 - by flanking markers	RRID:RGD_2290275	The desired fragment is transferred from WKY to SHRSP
2290276	SHRSP.WKY-<i>(D3Mgh16-D3Mgh15)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=787> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=787> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	6373335	118757096	1 - by flanking markers	3	11361699	130099054	1 - by flanking markers	3	6000748	123599709	1 - by flanking markers	3	10778704	118275626	1 - by flanking markers	RRID:RGD_2290276	This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2290277	SHRSP.WKY-<i>(D3Rat227-D3Rat166)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=783> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=783> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	41054012	101359980	1 - by flanking markers	3	50522686	113470358	1 - by flanking markers	3	45406058	106900596	1 - by flanking markers	3	43827364	102200699	1 - by flanking markers	RRID:RGD_2290277	The desired fragment is transferred from WKY to SHRSP
2290278	SR/JrNgs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=799> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=799> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension																			RRID:RGD_2290278	strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan
2290279	SHRSP.WKY-<i>(D15Rat68-D15Rat106)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=796> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=796> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			15	62521452	106177917	1 - by flanking markers	15	67139660	109944957	1 - by flanking markers	15	63498932	106550657	1 - by flanking markers	15	56484420	98288169	1 - by flanking markers	RRID:RGD_2290279	This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2290280	SHRSP.WKY-<i>(D3Mgh16-D3Rat110)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=780> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=780> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	6373335	42729760	1 - by flanking markers	3	11361699	53824856	1 - by flanking markers	3	6000748	47155284	1 - by flanking markers	3	10778704	10778823	1 - by flanking markers	RRID:RGD_2290280	The desired fragment is transferred from WKY to SHRSP
2290281	SHRSP.WKY-<i>(D3Rat227-D3Rat1)</i>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=794> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=794> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	41054012	170016653	1 - by flanking markers	3	50522686	180128021	1 - by flanking markers	3	45406058	176418101	1 - by flanking markers	3	43827364	168026850	1 - by flanking markers	RRID:RGD_2290281	This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2290282	SHRSP.WKY-<i>(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)</i>/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=784> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=784> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2290282	The desired fragment is transferred from WKY to SHRSP
2290298	SHR-Tg(Thy1-MAPT)318		Axon-Neuroscience GmbH, Vienna, Austria		transgenic	Unknown		MAPT	736496																	RRID:RGD_2290298	SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391
2290299	SHR-Tg(Thy1-MAPT)72		Axon-Neuroscience GmbH, Vienna, Austria		transgenic	Unknown		MAPT	736496																	RRID:RGD_2290299	SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391
2290311	SD-Tg(SOD1*G93A)26Dwc		Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California		transgenic	Unknown		SOD1	730855																	RRID:RGD_2290311	SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation
2290386	SD-Tg(Wld<sup>s</sup>)23Cole		University of Cologne, Cologne, Germany		transgenic	Unknown																				RRID:RGD_2290386	SD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changes
2290387	SD-Tg(UbC-APPswe)6590		Karolinska Institutet, Stockholm, Sweden		transgenic	Unknown		APP	736021																	RRID:RGD_2290387	SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation
2290391	SD-Tg(Wld<sup>s</sup>)79Cole		University of Cologne, Cologne, Germany		transgenic	Unknown																				RRID:RGD_2290391	SD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changes
2290429	SS-Tg(ApoC3-CETP)53Opaz		Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. 	<a href=http://www.rrrc.us/Strain/?x=310>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00310	SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter
2291840	F344-<i>Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup></i>		PGA		mutant	Extinct (as of 2016-10-17)		Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup>	2291839	3	133021912	133073987	7	3	145054445	145114445	7	3	138624517	138684530	7	3	131855890	131908217	7	RRID:RGD_2291840	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene.
2292168	ISIAH	Inherited stress-induced arterial hypertension	Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia		inbred	Unknown																				RRID:RGD_2292168	Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress
2292384	SS.LEW-(<i>D10Chm167-D10Chm257</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	70589279	71366998	1 - by flanking markers	10	69375493	71016171	1 - by flanking markers	10	69742043	70500971	1 - by flanking markers	10	67335465	68083956	1 - by flanking markers	RRID:RGD_2292384	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.
2292385	SS.LEW-(<i>D10Mco30-D10Got107</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	77547289	78712717	1 - by flanking markers	10	73693979	77664589	1 - by flanking markers	10	76420583	77803328	1 - by flanking markers	10	73887148	75121215	1 - by flanking markers	RRID:RGD_2292385	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.
2292386	SS.LEW-(<i>D10Chm155-D10Rat127</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	87272312	100040883	1 - by flanking markers	10	86214887	98591695	1 - by flanking markers	10	86418952	98888676	1 - by flanking markers	10	83463114	95552352	1 - by flanking markers	RRID:RGD_2292386	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.
2292387	SS.LEW-(<i>D10Chm224-D10Chm259</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	74705355	75291923	1 - by flanking markers	10	75776633	76309841	1 - by flanking markers	10	74325927	74326153	1 - by flanking markers	10	71831756	71831983	1 - by flanking markers	RRID:RGD_2292387	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.
2292388	SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	71262405	71366998	1 - by flanking markers	10	70027256	71016171	1 - by flanking markers	10	70396378	70500971	1 - by flanking markers	10	67979320	68083956	1 - by flanking markers	RRID:RGD_2292388	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.
2292389	SS.LEW-(<i>D10Chm10-D10Chm14</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	96778676	99233951	1 - by flanking markers	10	95351725	97793613	1 - by flanking markers	10	95617075	98079438	1 - by flanking markers	10	92348201	94759977	1 - by flanking markers	RRID:RGD_2292389	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat13-D10Rat11</i>)/Ayd.
2292390	SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada		congenic	Unknown				10	75706467	76081753	1 - by flanking markers	10	75018615	75388855	1 - by flanking markers	10	74712046	75083773	1 - by flanking markers	10	72219294	72590339	1 - by flanking markers	RRID:RGD_2292390	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.
2292451	F344-<i>Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=386>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup>	2292450	11	65129572	65455115	7	11	69337663	69661463	7	11	66246624	66566331	7	11	63334667	63654270	7	RRID:RRRC_00386	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene.
2292452	F344-<i>Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=342>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup>	2292449	3	139434170	139834916	7	3	151405855	151571801	7	3	145031427	145199273	7	3	138030995	138234646	7	RRID:RRRC_00342	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene.
2292453	F344-<i>BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=345>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm		BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup>	2292448																	RRID:RRRC_00345	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2292454	F344-<i>RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup>	2292447																	RRID:RGD_2292454	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene.
2292459	WF.LEW-<i>RVFV</i>		<a href=http://www.rrrc.us/Strain/?x=208>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=208>Rat Resource and Research Center</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15)																				RRID:RRRC_00208	This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain.
2292526	SS-Tg(Atp1a1)48Opaz		<a href=http://www.rrrc.us/Strain/?x=281>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=281>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24)																				RRID:RRRC_00281	SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase
2292527	SS-Tg(RA1V9)64Opaz		<a href=http://www.rrrc.us/Strain/?x=308>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=308>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00308	Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal.
2292528	F344-Tg(APPswe)Opaz		<a href=http://www.rrrc.us/Strain/?x=283>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=283>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00283	F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter
2292529	LEW-Tg((ROSA)26Sor-luc)11Jmsk		<a href=http://www.rrrc.us/Strain/?x=299>Rat Resource and Research Center</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=649> National BioResource Project for the Rat in Japan</a>	<a href=http://www.rrrc.us/Strain/?x=299>Rat Resource and Research Center</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=649> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm (as of 2017-08-08)	Development																			RRID:RRRC_00299	LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site
2292530	SD-Tg(Pou5f1-Dsred)		<a href=http://www.rrrc.us/Strain/?x=320>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=320>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00320	This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells.
2292531	SD-Tg(Pou5f1-EGFP)		<a href=http://www.rrrc.us/Strain/?x=319>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=319>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23)																				RRID:RRRC_00319	This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP.
2292532	F344-Tg(betaCTF-l45F)		<a href=http://www.rrrc.us/Strain/?x=277>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=277>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00277	F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein
2292564	ACI.COP-(<i>D6Rat80-D6Rat146</i>)/Shul		Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska		congenic	Unknown				6	16302145	16302283	1 - by flanking markers	6	26052697	26052834	1 - by flanking markers	6	16100120	16100257	1 - by flanking markers	6	2299357	2299495	1 - by flanking markers	RRID:RGD_2292564	Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped
2292565	ACI.COP-(<i>D3Mgh16-D3Rat119</i>)/Shul		Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska		congenic	Unknown				3	6373335	52643538	1 - by flanking markers	3	11361699	63334520	1 - by flanking markers	3	6000748	56715367	1 - by flanking markers	3	10778704	55223816	1 - by flanking markers	RRID:RGD_2292565	Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped
2292566	ACI.COP-(<i>D3Rat130-D3Rat114</i>)/Shul		Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska		congenic	Unknown				3	44551252	149496698	1 - by flanking markers	3	55227530	160347840	1 - by flanking markers	3	48561928	155263151	1 - by flanking markers	3	47233211	147415807	1 - by flanking markers	RRID:RGD_2292566	Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped
2292567	ACI.COP-(<i>D10Mgh20-D10Rat4</i>)/Shul		Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska		congenic	Unknown				10	53781126	107033716	1 - by flanking markers	10	53376677	105533612	1 - by flanking markers	10	105875105	105875260	1 - by flanking markers	10	102134116	102134272	1 - by flanking markers	RRID:RGD_2292567	Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped
2292647	SS.LEW-(<I>D1Mco36-D1Rat106</I>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	122991895	139471673	1 - by flanking markers	1	130267716	146282094	1 - by flanking markers	1	129208943	145354344	1 - by flanking markers	1	121833674	137184926	1 - by flanking markers	RRID:RGD_2292647	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292648	SS.LEW-(<I>D1Mco36-D1Mco77</I>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	122991895	122992360	1 - by flanking markers	1	130267716	130268180	1 - by flanking markers	1	129208943	129209407	1 - by flanking markers	1	121833674	121834139	1 - by flanking markers	RRID:RGD_2292648	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292649	SS.LEW-(<I>D1Mco36-D1Rat131</I>)/1Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	122991895	145648920	1 - by flanking markers	1	130267716	159182239	1 - by flanking markers	1	129208943	152871103	1 - by flanking markers	1	121833674	142990467	1 - by flanking markers	RRID:RGD_2292649	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292650	SS.LEW-(<I>D1Mco36-D1Rat131</I>)/2Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	122991895	145648920	1 - by flanking markers	1	130267716	159182239	1 - by flanking markers	1	129208943	152871103	1 - by flanking markers	1	121833674	142990467	1 - by flanking markers	RRID:RGD_2292650	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292651	SS.LEW-(<I>D1Mco99-D1Rat49</I>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	157497884	157498254	1 - by flanking markers	1	171330622	171330794	1 - by flanking markers	1	165129767	165129939	1 - by flanking markers	1	154464069	154464242	1 - by flanking markers	RRID:RGD_2292651	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292652	SS.LEW-(<I>D1Mco85-D1Rat49</I>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	157497884	157498254	1 - by flanking markers	1	171330622	171330794	1 - by flanking markers	1	165129767	165129939	1 - by flanking markers	1	154464069	154464242	1 - by flanking markers	RRID:RGD_2292652	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2292653	SS.LEW-(<i>D1Mco36-D1Mco101</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				1	97174943	122992360	1 - by flanking markers	1	103735751	130268180	1 - by flanking markers	1	102658741	129209407	1 - by flanking markers	1	97146283	121834139	1 - by flanking markers	RRID:RGD_2292653	This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2293012	ACI.BBDP-(<i>RT1<sup>u</sup></i>)(<i>Gimap5</i>)/Sunn		Sunnybrook Research Institute, Toronto, Ontario, Canada.	<a href=http://www.rrrc.us/Strain/?x=788>Rat Resource and Research Center</a>	congenic	Unknown																				RRID:RRRC_00788	2 BBDP regions [Iddm1(RT1u) and Iddm2(Gimap5)] were introgressed into the ACI/SegHsd background
2293120	LOU.BN-(<i>D10Mgh1-D10Mgh14</i>)/Ins		Cardiovascular Physiopathology, INSERM, Montpellier, France		congenic	Unknown		Ace	2493	10	65379850	65379965	1 - by flanking markers	10	65109232	65109346	1 - by flanking markers	10	66539729	66539843	1 - by flanking markers	10	64155469	64155584	1 - by flanking markers	RRID:RGD_2293120	segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU
2293143	SS.BN-(<i>D13Rat20-D13Rat127</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown		Ren	3554	13	38329089	55373537	1 - by flanking markers	13	23200281	47267192	1 - by flanking markers	13	17996178	42155682	1 - by flanking markers	13	37262092	53383120	1 - by flanking markers	RRID:RGD_2293143	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2293144	SS.BN-(<i>D13Rat91-D13Rat179</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	46911975	60669696	1 - by flanking markers	13	55853015	68592209	1 - by flanking markers	13	50799478	63611529	1 - by flanking markers	13	45417753	58498119	1 - by flanking markers	RRID:RGD_2293144	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2293145	SS.BN-(<i>D13Hmgc64-RN34_13048990782</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown		Ren	3554	13;13;13	49428397;48990782;45215472	49428577;48990782;45215667	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	13;13	58314588;54170894	58314767;54171089	1 - by flanking markers;1 - by flanking markers	13;13	49102205;53264698	49102400;53264877	1 - by flanking markers;1 - by flanking markers	13;13	43763752;47841075	43763948;47841255	1 - by flanking markers;1 - by flanking markers	RRID:RGD_2293145	SS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2293146	SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13;5	38329089;97701780	45828716;97703112	1 - by flanking markers;1 - by flanking markers	13;5	47267053;100631702	54791605;100633034	1 - by flanking markers;1 - by flanking markers	13;5	42155543;96601805	49720682;96603137	1 - by flanking markers;1 - by flanking markers	13;5	37262092;93541170	37262232;93542503	1 - by flanking markers;1 - by flanking markers	RRID:RGD_2293146	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2293354	LEW.WKY-(<i>D16Rat88-D16Rat40</i>)/Tja		Imperial College, London, UK	<a href=http://www.rrrc.us/Strain/?x=708>Rat Resource and Research Center</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)				16	819225	60432230	1 - by flanking markers	16	1534408	59992088	1 - by flanking markers	16	1550187	60316851	1 - by flanking markers	16	832236	56733837	1 - by flanking markers	RRID:RRRC_00708	segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd
2293355	WKY.LEW-(<i>D16Rat88-D16Rat40</i>)/Tja		Imperial College, London, UK		congenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)				16	819225	60432230	1 - by flanking markers	16	1534408	59992088	1 - by flanking markers	16	1550187	60316851	1 - by flanking markers	16	832236	56733837	1 - by flanking markers	RRID:RRRC_00706	22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl
2293729	SHR-<i>Gja8</i><sup>m1-/-Cub</sup>		Department of Biology, Charles University in Prague, Prague, Czech Republic		mutant	Unknown		Gja8<sup>m1Cub</sup>	12791992					2	218536831	218538447	7	2	199052374	199052374	8	2	184492360	184492360	8	RRID:RGD_2293729	This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7Q
2293761	LH-Chr 17<sup>BN</sup>/Mav		Laboratoire de Physiologie, Lyon Cedex , France		consomic	Unknown																				RRID:RGD_2293761	Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped
2293770	SHHF/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		inbred	Unknown																				RRID:RGD_2293770	Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding
2293832	LOU.BN-(<i>D6Rat128-D6Rat115</i>)/Ins		INSERM, Paris, France		congenic	Unknown				6	76613351	116550459	1 - by flanking markers	6	86645162	125802733	1 - by flanking markers	6	77111071	116576287	1 - by flanking markers	6	73691999	111838254	1 - by flanking markers	RRID:RGD_2293832	segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross
2298494	Kini:DA,PVG-G10		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		advanced_intercross_line	Unknown																				RRID:RGD_2298494	Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG.1AV1 females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couples
2298498	W/Gaox		Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China		inbred	Unknown																				RRID:RGD_2298498	Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University
2298772	WF<sup>fzHsd</sup>	Fuzzy rat	Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia	<a href=http://www.rrrc.us/Strain/?x=340>Rat Resource and Research Center</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-14)																				RRID:RRRC_00340	Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987)
2299122	F344-<i>Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>	2299101	3	128002479	128228127	7	3	139347611	139588372	7	3	132888785	133131213	7	3	127176416	127408039	7	RRID:RGD_2299122	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene.
2299123	F344-<i>AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup></i>		PhysGen		mutant	Unknown		AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup>	2299108																	RRID:RGD_2299123	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2299124	F344-<i>Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=350>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup>	2299109	2	180669525	180684724	7	2	207318101	207333435	7	2	187915701	187931035	7	2	174012726	174028062	7	RRID:RRRC_00350	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene.
2299125	F344-<i>Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=356>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup>	2299113	14	109197317	109434306	7	14	112609601	112636341	7	14	112719482	112900724	7	14	102126574	102359207	7	RRID:RRRC_00356	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene.
2299126	F344-<i>Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=348>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup>	2299100	14	66284290	67452628	7	14	65635533	66780362	7	14	65549362	66749181	7	14	61380699	62531399	7	RRID:RRRC_00348	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene.
2299127	F344-<i>Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup>	2299094	4	116280880	116330122	7	4	177461600	177511382	7	4	112714023	112823659	7	4	114593773	114643011	7	RRID:RGD_2299127	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene.
2299128	F344-<i>Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=432>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm; Cryorecovery (as of 2024-04-16)		Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup>	2299103	1	18203466	18885462	7	1	20002787	20647256	7	1	18491264	19143486	7	1	17672675	18320641	7	RRID:RRRC_00432	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene.
2299129	F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup></i>		PhysGen, Transposagen		mutant	Extinct (as of 2017-01-26)		Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup>	2299107	3	80921606	82413671	7	3	92119546	93502229	7	3	85421169	86821783	7	3	82305495	83684039	7	RRID:RGD_2299129	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene.
2299130	F344-<i>Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=426>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-13)		Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup>	2299093	3	154636530	154660637	7	3	166306001	166330108	7	3	160115840	160139947	7	3	152398745	152422854	7	RRID:RRRC_00426	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene.
2299131	F344-<i>Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=388>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup>	2299115	16	80979323	80991796	7	16	80641991	80657693	7	16	81153489	81165442	7	16	76122501	76135792	7	RRID:RRRC_00388	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene.
2299132	F344-<i>Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup>	2299116	8	50765645	51108962	7	8	50460752	50796128	7	8	51858906	52200591	7	8	47847836	48178703	7	RRID:RGD_2299132	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene.
2299133	F344-<i>Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=357>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup>	2299098	2	236522381	236638692	7	2	262787595	262899803	7	2	244258550	244370983	7	2	227500366	227645213	7	RRID:RRRC_00357	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene.
2299134	F344-<i>Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=347>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup>	2299105	1	188518590	188643804	7	1	209449940	209577459	7	1	202432366	202560628	7	1	183829794	183959319	7	RRID:RRRC_00347	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene.
2299135	F344-<i>Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=354>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup>	2299106	7	40171454	40383441	7	7	43829446	44052611	7	7	43249369	44024278	7	7	36709564	37485810	7	RRID:RRRC_00354	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene.
2299136	F344-<i>Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup>	2299117	3	141921547	141961697	7	3	153455882	153496985	7	3	147102394	147143576	7	3	140098540	140139342	7	RRID:RGD_2299136	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene.
2299137	F344-<i>Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=383>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup>	2299110	9	66843898	67967970	7	9	74804287	75310350	7	9	75021790	76178936	7	9	69523733	70596743	7	RRID:RRRC_00383	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene.
2299138	F344-<i>Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=449>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup>	2299118	1	209211740	209318064	7	1	228789462	228899340	7	1	221792191	221908047	7	1	203726420	203842301	7	RRID:RRRC_00449	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene.
2299139	F344-<i>Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup>	2299114	1	163380065	163467261	7	1	177487073	177576072	7	1	170473792	170570220	7	1	159990785	160077990	7	RRID:RGD_2299139	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene.
2299140	F344-<i>Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=384>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup>	2298938	18	68026795	69140741	7	18	65688901	66793126	7	18	66518213	67629801	7	18	64868987	65972783	7	RRID:RRRC_00384	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene.
2299141	F344-<i>Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup>	2299104	18	35865837	36318308	7	18	36647298	37076455	7	18	36985709	37421383	7	18	34653716	35080889	7	RRID:RGD_2299141	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene.
2299142	F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup></i>		PhysGen, Transposagen		mutant	Extinct (as of 2017-01-26)		Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup>	2299095	19	27722430	28363639	7	19	40508684	41132035	7	19	29592889	30341528	7	19	25920189	26670085	7	RRID:RGD_2299142	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.
2299143	F344-<i>Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=346>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup>	2299111	3	130967515	131250402	7	3	143103727	143381598	7	3	136596621	136936809	7	3	129974692	130254194	7	RRID:RRRC_00346	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene.
2299144	F344-<i>Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=368>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup>	2299099	1	24514752	24925948	7	1	26865461	27248423	7	1	25403390	25787664	7	1	23955651	24410494	7	RRID:RRRC_00368	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene.
2299145	F344-<i>Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup>	2299096	18	16283291	16328357	7	18	16209135	16256883	7	18	16450160	16497913	7	18	15791418	15839338	7	RRID:RGD_2299145	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene.
2299146	F344-<i>Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup>	2299097	1	195263489	195303249	7	1	214818446	214920034	7	1	207820719	207987123	7	1	190344331	190494815	7	RRID:RGD_2299146	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene.
2299147	F344-<i>Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=349>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup>	2299112	3	86868129	86948468	7	3	97950297	98119477	7	3	91290207	91461208	7	3	88001951	88173532	7	RRID:RRRC_00349	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene.
2299148	F344-<i>Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=355>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup>	2299102	3	91408864	91436603	7	3	102575250	102646194	7	3	95955126	96024316	7	3	92385329	92449559	7	RRID:RRRC_00355	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene.
2300018	SHRSP.ZUC-(<i>D5Rat4-D5Rat36</i>)/IzmDmcr		Mukogawa Women's University, Nishinomiya, Hyogo Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=735> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2300018	Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm
2300195	EHC.BN-(<i>D14Rat43-D14Rat132</i>)/Kyu		Kyushu University, Fukuoka, Japan		congenic	Unknown				14	79256324	107101727	1 - by flanking markers	14	78419915	110102984	1 - by flanking markers	14	78446303	110402569	1 - by flanking markers	14	100147356	100147478	1 - by flanking markers	RRID:RGD_2300195	EHC/Seac and BN/Seac were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics
2300215	SHR.BN-(<i>D10Mgh3-D10Rat85</i>)/Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				10	48994688	100090454	1 - by flanking markers	10	49018990	98640289	1 - by flanking markers	10	49239646	98939361	1 - by flanking markers	10	47494000	95600487	1 - by flanking markers	RRID:RGD_2300215	Congenic substrain derived from SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv
2300216	SHR-Tg(PEPCK-SREBF1)1Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		SREBF1	69473																	RRID:RGD_2300216	SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal
2300217	SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown		Srebf1	69423	10	46461684	100090454	1 - by flanking markers	10	46326015	98640289	1 - by flanking markers	10	46570996	98939361	1 - by flanking markers	10	45007637	95600487	1 - by flanking markers	RRID:RGD_2300217	53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background
2301079	F344-<i>Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=360>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup>	2301078	2	256228792	256644029	7	2	283549882	283934360	7	2	264910594	265300860	7	2	247146616	247634945	7	RRID:RRRC_00360	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7.
2301080	F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=359>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup>	2301076	3	80921606	82413671	7	3	92119546	93502229	7	3	85421169	86821783	7	3	82305495	83684039	7	RRID:RRRC_00359	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene.
2301081	F344-<i>Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=358>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup>	2301077	5	171675007	171703353	7	5	175729143	175759868	7	5	172273450	172303905	7	5	165431278	165461716	7	RRID:RRRC_00358	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1.
2301246	SS.LEW-(<i>D3Rat61-D3Wox1</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	147852788	168149595	1 - by flanking markers	3	158115782	182470017	1 - by flanking markers	3	153381237	174632112	1 - by flanking markers	3	145925360	166177555	1 - by flanking markers	RRID:RGD_2301246	A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
2301247	SS.LEW-(<i>D16Got3-D16Rat112</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				16	64718	3531727	1 - by flanking markers	16	773329	4149422	1 - by flanking markers	16	778415	4203372	1 - by flanking markers	16	110590	3447332	1 - by flanking markers	RRID:RGD_2301247	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Mit2-D16Chm23</i>)/Ayd
2301248	SS.LEW-(<i>D3Got33-D3Chm68</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	45100293	60708929	1 - by flanking markers	3	55769295	71451283	1 - by flanking markers	3	49115270	64892832	1 - by flanking markers	3	47769862	62962984	1 - by flanking markers	RRID:RGD_2301248	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd
2301249	SS.LEW-(<i>D18Rat30-D18Chm29</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	5682011	12249935	1 - by flanking markers	18	5795276	15461904	1 - by flanking markers	18	5825946	15691464	1 - by flanking markers	18	5584537	11796356	1 - by flanking markers	RRID:RGD_2301249	A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.
2301315	LE/Orl	Long-Evans/Cryptorchid	Centre Nationale de la Researche Scientifique, Orleans, France		inbred	Unknown																				RRID:RGD_2301315	Obtained from Centre Nationale de la Researche Scientifique, Orleans, France
2301330	KH		International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma		inbred	Unknown																				RRID:RGD_2301330	Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma
2301367	SHRSP.WKY-(<I>D2Mit5-D2Rat133</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown				2	66680022	170817807	1 - by flanking markers	2	86560119	197513270	1 - by flanking markers	2	66828049	178177553	1 - by flanking markers	2	66118275	164552628	1 - by flanking markers	RRID:RGD_2301367	Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment
2301368	SHRSP.WKY-(<I>D2Wox15-D2Rat133</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown				2	170817613	170817807	1 - by flanking markers	2	197513076	197513270	1 - by flanking markers	2	178177359	178177553	1 - by flanking markers	2	164552433	164552628	1 - by flanking markers	RRID:RGD_2301368	Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment
2301369	SHRSP.WKY-(<I>D2Rat132-D2Rat53</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown				2	196277776	204077687	1 - by flanking markers	2	223058573	230770799	1 - by flanking markers	2	203613889	211301253	1 - by flanking markers	2	188657176	196146841	1 - by flanking markers	RRID:RGD_2301369	Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment
2301370	SHRSP.WKY-(<I>D2Wox9-D2Rat231</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown				2	141259937	190384899	1 - by flanking markers	2	161271919	216143762	1 - by flanking markers	2	141583337	196645063	1 - by flanking markers	2	136445150	183048631	1 - by flanking markers	RRID:RGD_2301370	Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment
2301371	SHRSP.WKY-(<I>D2Mit21-D2Rat157</I>)/Gcrc		University of Glasgow, Western Infirmary, Glasgow, UK		congenic	Unknown		Gstm1|Vcam1|S1pr1	2755|3952|61958	2	182724363	216711836	1 - by flanking markers	2	209270725	241761983	1 - by flanking markers									RRID:RGD_2301371	Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment
2301381	SS.LEW-(<I>D18Chm41-D18Rat92</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	30891173	53898282	1 - by flanking markers	18	30797572	52299753	1 - by flanking markers	18	31109532	53083766	1 - by flanking markers	18	29804982	51515008	1 - by flanking markers	RRID:RGD_2301381	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301382	SS.LEW-(<I>D18Chm91-D18Rat67</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	12677191	23780206	1 - by flanking markers	18	15053338	23867696	1 - by flanking markers	18	15274408	24147513	1 - by flanking markers	18	12205066	23012468	1 - by flanking markers	RRID:RGD_2301382	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301383	SS.LEW-(<I>D18Chm31-D18Rat55</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	2848113	54856651	1 - by flanking markers	18	2761846	53346447	1 - by flanking markers	18	2745212	54108474	1 - by flanking markers	18	52539763	52539863	1 - by flanking markers	RRID:RGD_2301383	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301384	SS.LEW-(<I>D18Chm41-D18Rat45</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	30891173	77511190	1 - by flanking markers	18	30797572	76318715	1 - by flanking markers	18	31109532	77212332	1 - by flanking markers	18	29804982	74055742	1 - by flanking markers	RRID:RGD_2301384	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301385	SS.LEW-(<I>D18Rat29-D18Rat55</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	13904295	54856651	1 - by flanking markers	18	13042236	53346447	1 - by flanking markers	18	13257458	54108474	1 - by flanking markers	18	13529795	52539863	1 - by flanking markers	RRID:RGD_2301385	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301386	SS.LEW-(<I>D18Rat61-D18Rat45</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	61571526	77511190	1 - by flanking markers	18	60167906	76318715	1 - by flanking markers	18	60971508	77212332	1 - by flanking markers	18	58805687	74055742	1 - by flanking markers	RRID:RGD_2301386	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301387	SS.LEW-(<I>D18Rat67-D18Rat55</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	23779885	54856651	1 - by flanking markers	18	23867550	53346447	1 - by flanking markers	18	24147367	54108474	1 - by flanking markers	18	23012321	52539863	1 - by flanking markers	RRID:RGD_2301387	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301388	SS.LEW-(<I>D18Chm56-D18Rat55</I>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	49014933	54856651	1 - by flanking markers	18	47711090	53346447	1 - by flanking markers	18	48499359	54108474	1 - by flanking markers	18	46969392	52539863	1 - by flanking markers	RRID:RGD_2301388	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
2301700	F344-<i>Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=373>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup>	2301697	15	39722469	39849214	7	15	44749770	44878760	7	15	40937652	41066645	7	15	34778479	34907645	7	RRID:RRRC_00373	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene.
2301701	F344-<i>Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=370>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup>	2301698	3	118061713	118171300	7	3	129475237	129582992	7	3	122976066	123084585	7	3	117650146	117759744	7	RRID:RRRC_00370	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene.
2301702	F344-<i>Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=371>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup>	2301696	16	19835921	19866795	7	16	20950430	21047301	7	16	21100923	21131795	7	16	19352659	19383533	7	RRID:RRRC_00371	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene.
2301937	BN.GH-(<i>D18Rat41-D18Mgh4</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				18	59279066	79585133	1 - by flanking markers	18	57699045	79012652	1 - by flanking markers	18	58476128	79948741	1 - by flanking markers	18;6	56594589;118921813	76477940;118921891	1 - by flanking markers;1 - by flanking markers	RRID:RGD_2301937	Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations
2301938	BN.GH-(<i>D6Mit12-D6Rat15</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				6	3158401	105011726	1 - by flanking markers	6	2916444	113050815	1 - by flanking markers	6	104890044	104890216	1 - by flanking markers	6	100873387	100873560	1 - by flanking markers	RRID:RGD_2301938	Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations
2301939	BN.GH-(<i>D2Rat22-D2Mgh11</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				2	69302718	69303085	1 - by flanking markers	2	88968735	223460027	1 - by flanking markers	2	69243686	204022555	1 - by flanking markers	2	68462860	189039377	1 - by flanking markers	RRID:RGD_2301939	Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations
2301986	BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown																				RRID:RGD_2301986	desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background
2301987	BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown																				RRID:RGD_2301987	desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background
2301988	BN.GH-(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown																				RRID:RGD_2301988	desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background
2301989	BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwi		Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown																				RRID:RGD_2301989	desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background
2302067	F344/DuCrlSwe		Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden		inbred	Unknown																				RRID:RGD_2302067	Substrain of Fischer rats maintained at Malmo, Sweden
2302080	Rhd:F344,GK-G21		Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden		advanced_intercross_line	Unknown																				RRID:RGD_2302080	GK/Swe and F344/Swe were bred to create F<sub>1</sub> generation, couples of F<sub>1</sub> with GK/Swe and F344/Swe females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding random couples which were intercrossed to get further generations
2302081	DA.E3-(<i>D11Got79-D11Wox5</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				11	82238710	85432136	1 - by flanking markers	11	86800287	90495881	1 - by flanking markers	11	83727048	87444587	1 - by flanking markers	11	80039141	83440803	1 - by flanking markers	RRID:RGD_2302081	This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.'
2302106	SHRSP.WKY-(<I>D1Rat44-D1Arb21</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=485> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=485> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	153754139	187092492	1 - by flanking markers	1	167707459	206277202	1 - by flanking markers	1	161493758	199254774	1 - by flanking markers	1	150872626	182418476	1 - by flanking markers	RRID:RGD_2302106	SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection
2302108	SHRSP.WKY-(<I>D1Mgh5-D1Wox29</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=446> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=446> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	78134304	124614852	1 - by flanking markers	1	80946174	131822376	1 - by flanking markers	1	79689548	130779320	1 - by flanking markers	1	78430536	123350581	1 - by flanking markers	RRID:RGD_2302108	SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection
2302109	SHRSP.WKY-(<I>D1Mgh5-D1Rat44</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=444> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=444> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	78134304	153754250	1 - by flanking markers	1	80946174	167707569	1 - by flanking markers	1	79689548	161493868	1 - by flanking markers	1	78430536	150872737	1 - by flanking markers	RRID:RGD_2302109	SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection
2302110	SHRSP.WKY-(<I>Apbb1-D1Arb21</I>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=488> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=488> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension	Apbb1	2122	1	163282918	187092492	1 - by flanking markers	1	177393531	206277202	1 - by flanking markers	1	170387625	199254774	1 - by flanking markers	1	159896889	182418476	1 - by flanking markers	RRID:RGD_2302110	SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection
2302132	SHRSP-Tg(Tagln-ACE2)6918Bdr		Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany		transgenic	Unknown		Tagln|ACE2	3723|1347174																	RRID:RGD_2302132	Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos
2302141	F344-Tg(Cyp1a1-Ren2)10Jmul		University of Edinburgh Medical School, Edinburgh, UK		transgenic	Unknown		Cyp1a1|Ren2	2458|1622375																	RRID:RGD_2302141	Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis.
2302148	SHR-Tg(EEF1A1-Cd36)10Ipcv		Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		Cd36	2301																	RRID:RGD_2302148	Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)
2302149	SHR-Tg(EEF1A1-Cd36)19Ipcv		Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		Cd36	2301																	RRID:RGD_2302149	Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)
2302150	SHR-Tg(EEF1A1-Cd36)93Ipcv		Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		Cd36	2301																	RRID:RGD_2302150	Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter).
2302151	SHR-Tg(EEF1A1-Cd36)106Ipcv		Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		Cd36	2301																	RRID:RGD_2302151	Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)
2302279	F344.SDT-(<i>D3Wox9-D3Arb20</i>)/Kbe		Kobe University School of Medicine, Chuo-ku, Kobe, Japan		congenic	Unknown				3	47722501	47722628	1 - by flanking markers	3	58456360	58456486	1 - by flanking markers	3	51821710	51821836	1 - by flanking markers	3	50436913	50437042	1 - by flanking markers	RRID:RGD_2302279	Female F344/NSlc were crossed with male SDT/CrljJcl, then female F<sub>1</sub> were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers
2302387	DA.ACI-(<i>D2Mit12-D2Mgh29</i>)/Nsi		North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.	<a href=http://www.rrrc.us/Strain/?x=667>Rat Resource and Research Center</a>	congenic	Cryopreserved Sperm (as of 2019-02-18)	arthritis/autoimmunity studies			2	174730375	227310008	1 - by flanking markers	2	74640967	201405160	1 - by flanking markers	2	181990297	235290110	1 - by flanking markers	2	168358098	218414891	1 - by flanking markers	RRID:RRRC_00667	Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi
2302649	F344-<i>Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=435>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup>	2302645	5	136277224	136297339	7	5	138152068	138689234	7	5	134885377	134905492	7	5	129511224	129532498	7	RRID:RRRC_00435	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene.
2302650	F344-<i>Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=470>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup>	2302641	15	58555747	58762870	7	15	63013519	63564418	7	15	59331134	59884512	7	15	52517833	53079752	7	RRID:RRRC_00470	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene.
2302651	F344-<i>Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=431>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup>	2302638	4	168892865	168928286	7	4	227986994	228022556	7	4	165426365	165460140	7	4	164873735	164985429	7	RRID:RRRC_00431	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene.
2302652	F344-<i>Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=436>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup>	2302644	2	40196097	41311012	7	2	59292847	60521358	7	2	40219999	41468551	7	2	40014933	41529190	7	RRID:RRRC_00436	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene.
2302653	F344-<i>Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=377>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup>	2302647	2	200053185	200075536	7	2	226696252	226717551	7	2	207277088	207301245	7	2	192292041	192315142	7	RRID:RRRC_00377	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene.
2302654	F344-<i>Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=390>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup>	2302637	7	83586771	84932392	7	7	86689912	87802035	7	7	86695703	88072106	7	7	78747322	80066466	7	RRID:RRRC_00390	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene.
2302655	F344-<i>Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=376>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup>	2302646	7	43667983	44133854	7	7	47197110	47603261	7	7	47179596	47586777	7	7	40392377	40806685	7	RRID:RRRC_00376	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene.
2302656	F344-<i>Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup>	2302642	1	262689300	262721591	7	1	284572208	284623736	7	1	277190557	277242779	7	1	255437438	255476737	7	RRID:RGD_2302656	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene.
2302657	F344-<i>Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=375>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm; Cryorecovery (as of 2024-04-16)		Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup>	2302648	5	51172243	51226644	7	5	54588113	54644440	7	5	50019159	50075533	7	5	49123758	49181552	7	RRID:RRRC_00375	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene.
2302658	F344-<i>Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=428>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup>	2302640	11	51655446	51799132	7	11	56153038	56397255	7	11	52983286	53228557	7	11	50381249	50628934	7	RRID:RRRC_00428	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene.
2302659	F344-<i>Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=374>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup>	2302636	16	49415658	49518663	7	16	49051539	49159381	7	16	49328958	49432415	7	16	46134552	46238471	7	RRID:RRRC_00374	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene.
2302660	F344-<i>Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=378>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup>	2302639	8	46739657	46799051	7	8	46714981	46777484	7	8	48094233	48198499	7	8	44101776	44164863	7	RRID:RRRC_00378	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1.
2302661	F344-<i>Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=389>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup>	2302635	8	43260379	43429258	7	8	61200537	61378124	7	8	44160634	44399110	7	8	40654492	40893869	7	RRID:RRRC_00389	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene.
2302662	F344-<i>Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=372>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup>	2302643	2	139241142	139317101	7	2	158930294	159004937	7	2	139453774	139528479	7	2	134382002	134517622	7	RRID:RRRC_00372	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene.
2302666	Scr:sP	Sardinian alcohol-preferring rats	The Scripps Research Institute, LaJolla, California		outbred	Unknown																				RRID:RGD_2302666	sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding.
2302984	SS.BN-(<i>D13Rat151-D13Rat197</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	64083138	80109632	1 - by flanking markers	13	71941043	87516988	1 - by flanking markers	13	66971778	66971975	1 - by flanking markers	13	61825626	61825824	1 - by flanking markers	RRID:RGD_2302984	SS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302985	SS.BN-(<i>D13Rat111-D13Got22</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13;13;13;5	32030139;42627610;45828608;97701780	32030259;42627837;45828716;97703112	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	13;13;13;5	54791498;40421740;51509286;100631702	54791605;40421859;51509512;100633034	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	5;13;13;13	96601805;49720575;46444570;35301263	96603137;49720682;46444796;35301382	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	13;13;5	41184022;30395351;93541170	41184251;30395471;93542503	1 - by flanking markers;1 - by flanking markers;1 - by flanking markers	RRID:RGD_2302985	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302986	SS.BN-(<i>D13Rat88-D13Rat91</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	42627610	46912163	1 - by flanking markers	13	51509286	55853202	1 - by flanking markers	13	46444570	50799665	1 - by flanking markers	13	41184022	45417941	1 - by flanking markers	RRID:RGD_2302986	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302987	SS.BN-(<i>D13Rat7-D13Rat60</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	1084268	13053933	1 - by flanking markers	13	19518130	32069874	1 - by flanking markers	13	14279081	26919398	1 - by flanking markers	13	11766535	23001904	1 - by flanking markers	RRID:RGD_2302987	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302989	SS.BN-(<i>D13Rat57-D13Rat192</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	80109432	100133413	1 - by flanking markers	13	87516787	109040616	1 - by flanking markers	13	104392076	104392271	1 - by flanking markers	13	95722244	95722440	1 - by flanking markers	RRID:RGD_2302989	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302994	SS.BN-(<i>D13Rat127-D13Rat61</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	55373161	63301678	1 - by flanking markers	13	23200281	71179041	1 - by flanking markers	13	17996178	66204711	1 - by flanking markers	13	53382878	61058159	1 - by flanking markers	RRID:RGD_2302994	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302995	SS.BN-(<i>D13Rat115-D13Rat101</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	35719010	49428577	1 - by flanking markers	13	44763184	58314767	1 - by flanking markers	13	39639775	53264877	1 - by flanking markers	13	34778619	47841255	1 - by flanking markers	RRID:RGD_2302995	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302996	SS.BN-(<i>D13Rat7-D13Rat88</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	1084268	38329229	1 - by flanking markers	13	19518130	47267192	1 - by flanking markers	13	14279081	42155682	1 - by flanking markers	13	11766535	37262232	1 - by flanking markers	RRID:RGD_2302996	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302997	SS.BN-(<i>D13Rat91-D13Got45</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	44872181	63301678	1 - by flanking markers	13	53846466	71179041	1 - by flanking markers	13	48776655	66204711	1 - by flanking markers	13	43437904	61058159	1 - by flanking markers	RRID:RGD_2302997	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2302999	SS.BN-(<i>D13Rat178-D13Got45</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	57566232	64083335	1 - by flanking markers	13	65516837	71941240	1 - by flanking markers	13	60528276	66971975	1 - by flanking markers	13	55481090	61825824	1 - by flanking markers	RRID:RGD_2302999	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303000	SS.BN-(<i>D13Rat123-D13Rat150</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	44872181	57566359	1 - by flanking markers	13	53846466	65516963	1 - by flanking markers	13	48776655	60528402	1 - by flanking markers	13	43437904	55481217	1 - by flanking markers	RRID:RGD_2303000	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303001	SS.BN-(<i>D13Rat111-D13Rat127</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	32030139	49428577	1 - by flanking markers	13	40421740	58314767	1 - by flanking markers	13	35301263	53264877	1 - by flanking markers	13	30395351	47841255	1 - by flanking markers	RRID:RGD_2303001	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303002	SS.BN-(<i>D13Rat123-D13Rat197</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	42627610	76779489	1 - by flanking markers	13	51509286	83929327	1 - by flanking markers	13	46444570	79034003	1 - by flanking markers	13	41184022	73485113	1 - by flanking markers	RRID:RGD_2303002	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303003	SS.BN-(<i>D13Rat7-D13Rat127</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	1084268	49428577	1 - by flanking markers	13	19518130	58314767	1 - by flanking markers	13	14279081	53264877	1 - by flanking markers	13	11766535	47841255	1 - by flanking markers	RRID:RGD_2303003	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303004	SS.BN-(<i>D13Rat115-D13Rat61</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	63301384	67752598	1 - by flanking markers	13	71178814	75143303	1 - by flanking markers	13	66204484	70172216	1 - by flanking markers	13	61057931	64901750	1 - by flanking markers	RRID:RGD_2303004	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303005	SS.BN-(<i>D13Rat127-D13Rat77</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	55373161	57922038	1 - by flanking markers	13	23200281	65861506	1 - by flanking markers	13	17996178	60876578	1 - by flanking markers	13	53382878	55829942	1 - by flanking markers	RRID:RGD_2303005	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303006	SS.BN-(<i>D13Rat101-D13Rat46</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	46269934	72638941	1 - by flanking markers	13	55560677	79943775	1 - by flanking markers	13	75026588	75026713	1 - by flanking markers	13	69535761	69535887	1 - by flanking markers	RRID:RGD_2303006	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303007	SS.BN-(<i>D13Rat127-D13Rat46</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	55373161	72638941	1 - by flanking markers	13	23200281	79943775	1 - by flanking markers	13	17996178	75026713	1 - by flanking markers	13	53382878	69535887	1 - by flanking markers	RRID:RGD_2303007	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303008	SS.BN-(<i>D13Rat61-D13GRat197</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	63301384	76779489	1 - by flanking markers	13	71178814	83929327	1 - by flanking markers	13	66204484	79034003	1 - by flanking markers	13	61057931	73485113	1 - by flanking markers	RRID:RGD_2303008	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303009	SS.BN-(<i>D13Rat183-D13Rat192</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	77336098	100133413	1 - by flanking markers	13	84460970	109040616	1 - by flanking markers	13	79567081	104392271	1 - by flanking markers	13	74023918	95722440	1 - by flanking markers	RRID:RGD_2303009	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303010	SS.BN-(<i>D13Got51-D13Rat192</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	69494047	100133413	1 - by flanking markers	13	76974692	109040616	1 - by flanking markers	13	72031440	104392271	1 - by flanking markers	13	66706825	95722440	1 - by flanking markers	RRID:RGD_2303010	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303011	SS.BN-(<i>D13Got51-D13Rat57</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				13	69494047	80109632	1 - by flanking markers	13	76974692	87516988	1 - by flanking markers	13	72031440	72031708	1 - by flanking markers	13	66706825	66707096	1 - by flanking markers	RRID:RGD_2303011	SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
2303099	F344-<i>Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=430>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup>	2303095	3	44657361	45153509	7	3	55325680	55822973	7	3	48662450	49168716	7	3	47329338	47822122	7	RRID:RRRC_00430	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene.
2303100	F344-<i>Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=438>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup>	2303097	1	238643040	238665699	7	1	260197556	260275962	7	1	252976071	253054500	7	1	232184004	232262170	7	RRID:RRRC_00438	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene.
2303101	F344-<i>Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=471>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup>	2303094	2	154837841	155145882	7	2	174966379	175400010	7	2	155555798	156011438	7	2	149137025	149603540	7	RRID:RRRC_00471	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene.
2303102	F344-<i>Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=429>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm; Cryorecovery (as of 2024-04-16)		Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup>	2303098	6	145190931	145516859	7	6	154698519	155011384	7	6	145784893	146099212	7	6	138839175	139155554	7	RRID:RRRC_00429	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene.
2303103	F344-<i>Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=455>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup>	2303096	15	50225405	50460627	7	15	55252902	55466149	7	15	51528587	51740626	7	15	44920946	45134188	7	RRID:RRRC_00455	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene.
2303116	SPRD.WKY-(<i>D10Rat91-D10Rat135</i>)/Ibmm		Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium		congenic	Unknown				10	9762188	108776963	1 - by flanking markers	10	8619955	108145987	1 - by flanking markers	10	9841807	108540162	1 - by flanking markers	10	9658275	104670812	1 - by flanking markers	RRID:RGD_2303116	SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.
2303117	SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)(<i>D18Rat102-D18Rat44</i>)/Ibmm		Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium		congenic	Unknown																				RRID:RGD_2303117	Double congenic strain generated by intercrossing SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm and SPRD.WKY-(<i>D18Rat102-D18Rat44</i>)/Ibmm; F<sub>1</sub> animals were intercrossed and F<sub>2</sub> screened for heterozygousity by markers
2303148	SS.SHR-(<i>D9Wox16-D9Rat76</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	18476042	33497026	1 - by flanking markers	9	24681016	40929956	1 - by flanking markers	9	25819185	41261265	1 - by flanking markers	9	22198773	36962591	1 - by flanking markers	RRID:RGD_2303148	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303149	SS.SHR-(<i>D9Wox16-D9Mco73</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	18476042	47764357	1 - by flanking markers	9	24681016	55323208	1 - by flanking markers	9	25819185	55627498	1 - by flanking markers	9	22198773	50687400	1 - by flanking markers	RRID:RGD_2303149	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region.
2303150	SS.SHR-(<i>D9Mco74-D9Rat64</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	25174989	91131755	1 - by flanking markers	9	31484855	98715585	1 - by flanking markers	9	32677807	99041268	1 - by flanking markers	9	28806563	92491790	1 - by flanking markers	RRID:RGD_2303150	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303151	SS.SHR-(<i>D9Wox16-D9Mco77</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	18476042	54083264	1 - by flanking markers	9	24681016	64294638	1 - by flanking markers	9	25819185	64491201	1 - by flanking markers	9	22198773	56777289	1 - by flanking markers	RRID:RGD_2303151	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303152	SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	44842118	90249887	1 - by flanking markers	9	52352690	97845437	1 - by flanking markers	9	52686874	98164303	1 - by flanking markers	9	47902208	91616855	1 - by flanking markers	RRID:RGD_2303152	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303153	SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	77170797	90249887	1 - by flanking markers	9	83451810	97845437	1 - by flanking markers	9	83686153	98164303	1 - by flanking markers	9	79271511	91616855	1 - by flanking markers	RRID:RGD_2303153	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303154	SS.SHR-(<i>D9Wox16-D9Mco85</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				9	18476042	76456066	1 - by flanking markers	9	24681016	82659881	1 - by flanking markers	9	25819185	82890620	1 - by flanking markers	9	22198773	78595166	1 - by flanking markers	RRID:RGD_2303154	This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2303504	LEW/JmsNgs	congenital hydrocephalus rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a	inbred	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology; Ophthalmology																			RRID:RGD_2303504	Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.
2303610	SD/HsdCwr		Case Western Reserve University School of Medicine, Cleveland, Ohio		inbred	Unknown																				RRID:RGD_2303610	derived from SD/Hsd by cousin-cousin mating for more than 20 generations
2303611	BN/HsdMcwiCwr		Case Western Reserve University School of Medicine, Cleveland, Ohio		inbred	Unknown																				RRID:RGD_2303611	derived from BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating
2303640	WAG/RijCmcr		Center for Medical Countermeasures Against Radiological Terrorism, Medical College of Wisconsin		inbred	Unknown																				RRID:RGD_2303640	Substrain of WAG/Rij, separated from the Rijswijk colony in about 1975, now maintained at Medical College of Wisconsin
2303739	RDW/UmeSlc			This strain is no longer available from NBRP-Rat (June 2022).	inbred	Unknown (as of 2022-06-09)	Metabolism																			RRID:RGD_2303739	From Tohoku University to Slc (1999)
2303759	WT/Jtt	whitish teeth rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=476 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=476 > National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Dentistry																			RRID:RGD_2303759	In 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating.
2303761	SD-Tg(CAG-EGFP)4Osb	Green rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=559> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=559> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals																				RRID:RGD_2303761	This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc.
2303779	OLETF-Chr 14<sup>F344</sup>/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=500 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=500 > National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303779	Chromosome 14 from F344 is introgressed in OLETF background
2303784	SHR-Chr 4<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=606> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=606> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2303784	Chromosome 3 from WKY is introgressed into the genomic background of SHR
2303785	SHRSP-Chr 3<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=605> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=605> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2303785	Chromosome 3 from WKY is introgressed into the genomic background of SHRSP
2303792	WTC.ZI-<i>Atrn<sup>zi</sup></i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=22> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=22> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology	Atrn<sup><i>zi</i></sup>	40902832																	RRID:RGD_2303792	Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University
2303793	WTC.DMY-<i>dmy</i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=19> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=19> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_2303793	Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University
2303971	OLETF.F344-(<i>D7Mgh16-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=82> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=82> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	96491967	96492203	1 - by flanking markers	7	100584458	100584693	1 - by flanking markers	7	100004559	100004794	1 - by flanking markers	7	91256311	91256547	1 - by flanking markers	RRID:RGD_2303971	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.
2303972	BN-Chr 13<sup>SS</sup>/Mcwi		PhysGen		consomic	Unknown																				RRID:RGD_2303972	A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed
2303973	OLETF.F344-(<i>D10Wox7-D10Wox6</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=78> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=78> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			10	103550924	103551039	1 - by flanking markers	10	102101261	102101375	1 - by flanking markers	10	102427604	102427718	1 - by flanking markers	10	98952626	98952741	1 - by flanking markers	RRID:RGD_2303973	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating.
2303976	F344-<i>Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=472>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup>	2303974	2	103102679	103271273	7	2	122442002	122610354	7	2	102701903	102871257	7	2	100502791	100669713	7	RRID:RRRC_00472	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene.
2303977	F344-<i>Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=477>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup>	2303975	3	96123925	96237157	7	3	108441370	108751911	7	3	101843516	102203368	7	3	97235671	97550090	7	RRID:RRRC_00477	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene.
2303978	F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=83> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=83> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303978	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303979	F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=84> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=84> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303979	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303986	WKAH.LEC-<i>Atp7b<sup>hts</sup></i>/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=106> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=106> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11)	Cancer	Atp7b<sup>hts</sup>	11532742	16	74607988	74680080	7	16	74495179	74575822	7	16	74865516	74944935	7	16	69952286	70024404	7	RRID:RGD_2303986	A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.
2303987	F344.OLETF-(<i>D17Mgh4-Edn1</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=104> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=104> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity	Edn1	2532	17	28303886	28309775	1 - by flanking markers	17	24117499	24124188	1 - by flanking markers	17	22136814	22143745	1 - by flanking markers	17	22454924	22460812	1 - by flanking markers	RRID:RGD_2303987	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303988	F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D8Rat54-D8Mgh17</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=88> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=88> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303988	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303989	F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=96> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=96> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			9	33374546	63705951	1 - by flanking markers	9	40808491	70797404	1 - by flanking markers	9	41139089	71771476	1 - by flanking markers	9	36840385	66437242	1 - by flanking markers	RRID:RGD_2303989	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303990	F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=92> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=92> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			1	94356875	176616212	1 - by flanking markers	1	100372156	194998184	1 - by flanking markers	1	188051098	188051234	1 - by flanking markers	1	172711200	172711337	1 - by flanking markers	RRID:RGD_2303990	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303991	F344.OLETF-(<i>D7Rat31-D7Rat35</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=103 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=103 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	20307479	28488710	1 - by flanking markers	7	24326613	32338830	1 - by flanking markers	7	24175337	32258115	1 - by flanking markers	7	18169505	26029351	1 - by flanking markers	RRID:RGD_2303991	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303992	F344.OLETF-(<i>D5Mgh29-D5Mgh22</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=102 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=102 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			5	157584332	157584492	1 - by flanking markers	5	160953624	160953783	1 - by flanking markers	5	157212263	157212422	1 - by flanking markers	5	151005994	151006154	1 - by flanking markers	RRID:RGD_2303992	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303993	OLETF.F344-(<i>D9Mgh8-D9Mit2</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=97 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=97 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			9	33374546	63705951	1 - by flanking markers	9	40808491	70797404	1 - by flanking markers	9	41139089	71771476	1 - by flanking markers	9	36840385	66437242	1 - by flanking markers	RRID:RGD_2303993	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.
2303994	F344.OLETF-(<i>D5Mgh4-D5Rat21</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=95> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=95> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			5	99344678	99344842	1 - by flanking markers	5	102264251	102264414	1 - by flanking markers	5	98224053	98224216	1 - by flanking markers	5	95112065	95112231	1 - by flanking markers	RRID:RGD_2303994	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303995	F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			8	19796514	73102155	1 - by flanking markers	8	21850030	79245063	1 - by flanking markers	8	74917593	80840067	1 - by flanking markers	8	69349194	69349344	1 - by flanking markers	RRID:RGD_2303995	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303996	F344.Cg-<i>Foxn1<sup>rnu</sup></i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=541> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=541> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Immunology; Cancer	Foxn1	3970	10	64243323	64256847	1 - by flanking markers	10	66004940	66030134	1 - by flanking markers	10	65621142	65634666	1 - by flanking markers	10	63251400	63273710	1 - by flanking markers	RRID:RGD_2303996	This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University.
2303997	F344.OLETF-(<i>D7Mgh8-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=86> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=86> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303997	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2303998	WKAH.LEC-<i>Ptprk<sup>thid</sup></i>/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=107> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=107> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer	Ptprk	619706	1	17328563	17752200	1 - by flanking markers	1	18602550	19574958	1 - by flanking markers	1	17445052	18058266	1 - by flanking markers	1	16738896	17236687	1 - by flanking markers	RRID:RGD_2303998	A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.
2303999	F344.OLETF-(<i>D14Rat8-D14Rat26</i>)(<i>D14Rat18-D14Rat22</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=100> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=100> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2303999	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304000	F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=98 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=98 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			12	43801711	43801909	1 - by flanking markers	12	17721341	50319569	1 - by flanking markers	12	15714609	48536609	1 - by flanking markers	12	13635523	42767729	1 - by flanking markers	RRID:RGD_2304000	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304001	F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=89> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=89> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2304001	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304002	F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=91> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=91> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			11	61504311	84560241	1 - by flanking markers	11	65784365	89808503	1 - by flanking markers	11	62653194	86714631	1 - by flanking markers	11	59802622	82566702	1 - by flanking markers	RRID:RGD_2304002	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304003	F344.OLETF-(<i>D16Rat19-D16Rat13</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=101 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=101 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			16	35339929	77968799	1 - by flanking markers	16	35126908	77759249	1 - by flanking markers	16	35307110	78172206	1 - by flanking markers	16	31951520	73187298	1 - by flanking markers	RRID:RGD_2304003	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304004	F344.OLETF-(<i>D7Mit2-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=85> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=85> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2304004	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304016	BUF.ACI-(<i>D4Rat192-D4Rat66</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=165> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=165> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			4	161023350	161023765	1 - by flanking markers	4	224435359	224435481	1 - by flanking markers	4	157417581	157417703	1 - by flanking markers	4	157704599	157704722	1 - by flanking markers	RRID:RGD_2304016	This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.
2304017	F344.CVD-<i>Unc5c<sup>cvd</sup></i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=153> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=153> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05)	Neurobiology	Unc5c|Unc5c<sup>cvd</sup>	735109|12802355	2	239365109	239721231	7	2	265573406	265926229	7	2	247352390	247352390	8	2	230489880	230489880	8	RRID:RGD_2304017	CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University.
2304018	BUF.ACI-(<i>D4Rat226-D4Rat109</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=166> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=166> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			4	61542056	117094107	1 - by flanking markers	4	61331785	178404466	1 - by flanking markers	4	61612433	113728420	1 - by flanking markers	4	62837725	115401611	1 - by flanking markers	RRID:RGD_2304018	This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.
2304019	BUF.ACI-(<i>D15Rat68-D15Rat29</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=168> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=168> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			15	62521452	108387411	1 - by flanking markers	15	67139660	67139799	1 - by flanking markers	15	63498932	63499071	1 - by flanking markers	15	56484420	56484560	1 - by flanking markers	RRID:RGD_2304019	This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method.
2304020	ACI.BUF-(<i>D15Rat97-D15Rat29</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=169> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=169> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			15	78048029	108387411	1 - by flanking markers	15	82573157	82573380	1 - by flanking markers	15	79033484	79033707	1 - by flanking markers	15	71477067	71477291	1 - by flanking markers	RRID:RGD_2304020	This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method.
2304037	DDI/Ddia	dokkyo diabetes insipidus rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=282> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=282> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Metabolism; Urology																			RRID:RGD_2304037	Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan
2304038	OP/Jtt	Opacitas	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=181> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=181> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Ophthalmology																			RRID:RGD_2304038	Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats.
2304039	WIC-<i>Tg<sup>rdw</sup></i>/Kts		School of Medicine, Kitasato University	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=193> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)	Metabolism	Tg<sup>rdw</sup>	12879860	7	104035776	104220754	7	7	107399165	107602400	7	7	107567063	107567063	8	7	98517376	98517376	8	RRID:RGD_2304039	Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene.
2304040	F344.OP-<i>Op</i>/Jtt		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=182> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=182> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Ophthalmology																			RRID:RGD_2304040	Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj.
2304041	SD-Tg(CAG-Rgn)Slc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=389> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=389> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals	Osteosis	Rgn	3560																	RRID:RGD_2304041	Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene
2304045	F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D14Rat23-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=392> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=392> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	41707592	1 - by flanking markers	14	2222207	61886417	1 - by flanking markers	14	2227825	61783215	1 - by flanking markers	14	1217606	39153750	1 - by flanking markers	RRID:RGD_2304045	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.
2304046	F344.ZUC-(<i>Lepr<sup>fa</sup></i>)(<i>D7Rat16-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=391> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=391> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	108647236	108647376	1 - by flanking markers	7	112143411	112143550	1 - by flanking markers	7	112204378	112204517	1 - by flanking markers	7	102920123	102920263	1 - by flanking markers	RRID:RGD_2304046	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.
2304047	F344.ZUC-<i>Lepr<sup>fa</sup></i>/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity	Lepr|Lepr<sup>fa</sup>	3001|13432153																	RRID:RGD_2304047	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating.
2304050	F344.OLETF-(<i>D14Rat23-D14Rat55</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=396 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=396 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	27571792	1 - by flanking markers	14	2222207	27510976	1 - by flanking markers	14	2227825	27686562	1 - by flanking markers	14	1217606	25656577	1 - by flanking markers	RRID:RGD_2304050	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304051	F344.OLETF-(<i>D14Rat8-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=399 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=399 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	32584630	41707592	1 - by flanking markers	14	32389647	61886417	1 - by flanking markers	14	32593926	61783215	1 - by flanking markers	14	30320092	39153750	1 - by flanking markers	RRID:RGD_2304051	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304052	F344.OLETF-(<i>D14Rat55-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=400 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=400 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	27571487	41707592	1 - by flanking markers	14	27510756	61886417	1 - by flanking markers	14	27686342	61783215	1 - by flanking markers	14	25656356	39153750	1 - by flanking markers	RRID:RGD_2304052	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304053	F344.OLETF-(<i>D14Rat23-D14Rat5</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=394 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=394 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	11589751	1 - by flanking markers	14	2222207	11868597	1 - by flanking markers	14	2227825	11926177	1 - by flanking markers	14	1217606	10277166	1 - by flanking markers	RRID:RGD_2304053	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304054	F344.OLETF-(<i>D14Rat23-D14Rat10</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=397 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=397 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	33157602	1 - by flanking markers	14	2222207	32957654	1 - by flanking markers	14	2227825	33163485	1 - by flanking markers	14	1217606	30883947	1 - by flanking markers	RRID:RGD_2304054	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304055	F344.OLETF-(<i>D14Wox1-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=404> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=404> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	41707423	41707592	1 - by flanking markers	14	61886249	61886417	1 - by flanking markers	14	61783047	61783215	1 - by flanking markers	14	39153581	39153750	1 - by flanking markers	RRID:RGD_2304055	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304056	F344.OLETF-(<i>D14Rat23-D14Wox14</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=395 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=395 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	21885861	1 - by flanking markers	14	2222207	21925011	1 - by flanking markers	14	2227825	22009966	1 - by flanking markers	14	1217606	1217776	1 - by flanking markers	RRID:RGD_2304056	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304057	F344.OLETF-(<i>D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=398 > National BioResource Project for the Rat in Japan</a	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=398 > National BioResource Project for the Rat in Japan</a	congenic	Cryopreserved Embryo	Diabetes Obesity			14	41707423	41707592	1 - by flanking markers	14	61886249	61886417	1 - by flanking markers	14	61783047	61783215	1 - by flanking markers	14	39153581	39153750	1 - by flanking markers	RRID:RGD_2304057	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304058	F344.OLETF-(<i>D14Rat143-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=402> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=402> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	19738306	41707592	1 - by flanking markers	14	19754557	61886417	1 - by flanking markers	14	19847829	61783215	1 - by flanking markers	14	18212584	39153750	1 - by flanking markers	RRID:RGD_2304058	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304059	F344.OLETF-(<i>D14Rat5-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=403> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=403> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	11589293	41707592	1 - by flanking markers	14	11868448	61886417	1 - by flanking markers	14	11926028	61783215	1 - by flanking markers	14	10277016	39153750	1 - by flanking markers	RRID:RGD_2304059	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304060	F344.OLETF-(<i>D14Wox14-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=401> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=401> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	21885743	41707592	1 - by flanking markers	14	21924894	61886417	1 - by flanking markers	14	22009849	61783215	1 - by flanking markers	14	39153581	39153750	1 - by flanking markers	RRID:RGD_2304060	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.
2304061	F344.OLETF-(<i>D14Rat23</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=393 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=393 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	1764386	1764554	1 - by flanking markers	14	2222207	2222374	1 - by flanking markers	14	2227825	2227992	1 - by flanking markers	14	1217606	1217776	1 - by flanking markers	RRID:RGD_2304061	Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.
2304063	KDP-Tg(H2Kd-Cblb)2Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=451> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=451> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Diabetes Obesity; Immunology	Cblb	620535																	RRID:RGD_2304063	Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).
2304064	KDP-Tg(H2Kd-Cblb)1Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=450> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=450> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Diabetes Obesity; Immunology	Cblb	620535																	RRID:RGD_2304064	Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).
2304065	KDP-Tg(INS-Cblb)1Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=452> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=452> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Diabetes Obesity; Immunology	Cblb	620535																	RRID:RGD_2304065	Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).
2304066	KDP-Tg(CAG-Cblb)1Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=453> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=453> National BioResource Project for the Rat in Japan</a>	transgenic	Unknown		Cblb	620535																	RRID:RGD_2304066	Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).
2304074	WKY.BUF-<i>Tsr1d</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=465> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=465> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer																			RRID:RGD_2304074	This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred.
2304075	ACI.BUF-<i>Pur1</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=467> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=467> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Urology																			RRID:RGD_2304075	This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred.
2304076	WKY.BUF-<i>Thym1, Thym2</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=464> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=464> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo (as of 2018-03-14)	Cancer																			RRID:RGD_2304076	This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred.
2304077	WKY.BUF-<i>Pur1s</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=462> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=462> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Urology																			RRID:RGD_2304077	This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.
2304078	ACI.BUF-<i>Ten1</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=468> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=468> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo																				RRID:RGD_2304078	This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.
2304079	WKY.BUF-<i>Ten1</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=471> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=471> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo																				RRID:RGD_2304079	This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.
2304080	ACI.BUF-<i>Aftm1</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=469> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=469> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_2304080	This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.
2304081	WKY.BUF-<i>Pur1w</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=463> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=463> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Urology																			RRID:RGD_2304081	This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.
2304082	WKY.BUF-<i>Ten2</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=466> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=466> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Urology																			RRID:RGD_2304082	This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.
2304083	ACI.BUF-<i>Ten2</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=470> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=470> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo																				RRID:RGD_2304083	This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.
2304093	SHRSP.WKY-(<i>D1Rat106-D1Arb21</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=484 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=484 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	139471535	187092492	1 - by flanking markers	1	146068162	206277202	1 - by flanking markers	1	145140412	199254774	1 - by flanking markers	1	137184788	182418476	1 - by flanking markers	RRID:RGD_2304093	Developed by the depositor
2304094	SHRSP.WKY-(<i>D1Smu12-D1Rat44</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=447 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=447 > National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Cardio Hypertension			1	153754139	153754250	1 - by flanking markers	1	167707459	167707569	1 - by flanking markers	1	161493758	161493868	1 - by flanking markers	1	150872626	150872737	1 - by flanking markers	RRID:RGD_2304094	This is a congenic strain developed by the depositor.
2304095	W-Tg(Plcb2-WGA-EGFP)F1Abek		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=455 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=455 > National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo																				RRID:RGD_2304095	This is a transgenic strain developed by the depositor.
2304096	SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/1Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=486 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=486 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	157497884	187092492	1 - by flanking markers	1	171330622	206277202	1 - by flanking markers	1	165129767	199254774	1 - by flanking markers	1	154464069	182418476	1 - by flanking markers	RRID:RGD_2304096	Developed by the depositor
2304097	SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/2Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=448> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=448> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	157497884	187092492	1 - by flanking markers	1	171330622	206277202	1 - by flanking markers	1	165129767	199254774	1 - by flanking markers	1	154464069	182418476	1 - by flanking markers	RRID:RGD_2304097	This is a congenic strain developed by the depositor.
2304098	SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=487 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=487 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	187092235	187092492	1 - by flanking markers	1	206276946	206277202	1 - by flanking markers	1	199254518	199254774	1 - by flanking markers	1	182418219	182418476	1 - by flanking markers	RRID:RGD_2304098	Developed by the depositor
2304099	SHRSP.WKY-(<i>D1Smu12-D1Arb21</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=482 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=482 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	187092235	187092492	1 - by flanking markers	1	206276946	206277202	1 - by flanking markers	1	199254518	199254774	1 - by flanking markers	1	182418219	182418476	1 - by flanking markers	RRID:RGD_2304099	This is a congenic strain developed by the depositor.
2304100	SHRSP.WKY-(<i>D1Rat39-D1Arb21</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=481 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=481 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	125983422	187092492	1 - by flanking markers	1	133172202	206277202	1 - by flanking markers	1	132134307	199254774	1 - by flanking markers	1	124668437	182418476	1 - by flanking markers	RRID:RGD_2304100	This is a congenic strain developed by the depositor.
2304101	SHRSP.WKY-(<i>D1Rat43-D1Arb21</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=483 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=483 > National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	187092235	187092492	1 - by flanking markers	1	206276946	206277202	1 - by flanking markers	1	144634295	199254774	1 - by flanking markers	1	182418219	182418476	1 - by flanking markers	RRID:RGD_2304101	This is a congenic strain developed by the depositor.
2304102	SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=445> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=445> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	78134304	139471673	1 - by flanking markers	1	80946174	146282094	1 - by flanking markers	1	79689548	145354344	1 - by flanking markers	1	78430536	137184926	1 - by flanking markers	RRID:RGD_2304102	This is a congenic strain developed by the depositor.
2304104	W-Tg(Plcb2-WGA-EGFP)M1Abek		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=456> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=456> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo																				RRID:RGD_2304104	This is a transgenic strain developed by the depositor.
2304120	SHRSP/2Ta		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=417> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=417> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension																			RRID:RGD_2304120	Kyo > Ta (1972)
2304121	DA.WF-(<i>D1Mit1-D1Mit3</i>)/Kop		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=522> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=522> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer			1	146971846	146971983	1 - by flanking markers	1	162692213	162692800	1 - by flanking markers	1	156446196	156446783	1 - by flanking markers	1	144267353	144267916	1 - by flanking markers	RRID:RGD_2304121	This congenic strain in the DA background by introgressing a segment from WF
2304122	DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)/Kop		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=523> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=523> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer																			RRID:RGD_2304122	This congenic strain in the DA background by introgressing a segment from WF
2304123	DA.WF-(<i>D4Mit11-Nos3</i>)/Kop		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=524> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=524> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer	Nos3	3186	4	6158847	91330856	1 - by flanking markers	4	7333272	157291359	1 - by flanking markers	4	7321908	92484312	1 - by flanking markers	4	10793834	91360801	1 - by flanking markers	RRID:RGD_2304123	This congenic strain in the DA background by introgressing a segment from WF
2304124	DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)(<i>D1Mit1-D1Mit3</i>)/Kop		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=520> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=520> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer																			RRID:RGD_2304124	This congenic strain in the DA background by introgressing a segment from WF
2304125	DRH.F344-(<i>D1Mgh8-D1Mgh12</i>)/Shigm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=492> National BioResource Project for the Rat in Japan</a>, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=492> National BioResource Project for the Rat in Japan</a>, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer			1	156124624	247322277	1 - by flanking markers	1	169999389	270717037	1 - by flanking markers	1	163796316	163796432	1 - by flanking markers	1	153136852	153136969	1 - by flanking markers	RRID:RGD_2304125	desired fragment from F344 was introgressed into DRH background
2304200	W-Tg(CAG-ABO*A)32Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=535 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=535 > National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Hematology	Abo3	628609																	RRID:RGD_2304200	This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.
2304201	F344-<i>Galntl6<sup>Tn(sb-T2/Bart3)2.311McwiRrrc</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=450>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Galntl6<sup>Tn(sb-T2/Bart3)2.311Mcwi</sup>	2304194	16	34557663	35853849	7	16	34380195	35619972	7	16	34551052	35803840	7	16	31192880	32443979	7	RRID:RRRC_00450	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene.
2304202	F344-<i>RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=437>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup>	2304193	17	38022396	38039975	7	17	34865901	34882646	7	17	32973695	32990440	7	17	31661713	31678816	7	RRID:RRRC_00437	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323.
2304203	W-Tg(CAG-DsRed2/GFP)1Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=532> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=532> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RGD_2304203	DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.
2304204	W-Tg(CAG-ABO*B)13Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=527> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=527> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Hematology	Abo3	628609																	RRID:RGD_2304204	This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.
2304205	W-Tg(Alb-DsRed2)34Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=528> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=528> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RGD_2304205	This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.
2304206	W-Tg(CAG-DsRed2/GFP)15Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=533> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=300>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=533> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=300>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RRRC_00300	DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.
2304207	F344-<i>Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=434>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup>	2304196	5	166567412	166579423	7	5	170076617	170089776	7	5	166430305	166443485	7	5	159928260	159941512	7	RRID:RRRC_00434	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene.
2304208	F344-<i>Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=479>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup>	2304197	3	54396312	54717148	7	3	65122705	65409814	7	3	58632338	58925127	7	3	56809388	57101332	7	RRID:RRRC_00479	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene.
2304209	F344-<i>Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup>	2304199	1	222545682	222726307	7	1	241354340	241541103	7	1	234252757	234442597	7	1	216363629	216544390	7	RRID:RGD_2304209	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene.
2304210	W-Tg(Alb-DsRed2)42Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=529> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=260>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=529> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=260>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RRRC_00260	This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.
2304211	W-Tg(CAG-cre)81Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=534> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=301>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=534> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=301>Rat Resource and Research Center</a>	transgenic	Live Animals; Cryopreserved Embryo (as of 2018-07-16)	Development																			RRID:RRRC_00301	This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School.
2304212	F344-<i>RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=453>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup>	2304198	17	21066144	21067040	7	17	17584757	17585688	7	17	15526295	15527253	7					RRID:RRRC_00453	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503.
2304213	F344-<i>P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=433>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup>	2304195	4	160964297	160978321	7	4	224377005	224392881	7	4	157359331	157375186	7	4	157646242	157662035	7	RRID:RRRC_00433	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene.
2304214	W-Tg(CAG-ABO*B)2Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=526 > National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=526 > National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Hematology	Abo3	628609																	RRID:RGD_2304214	This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.
2304215	F344-Tg(XPO1)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=575> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=575> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer; Infectious																			RRID:RGD_2304215	F344/DuCrj Tg rat inoculated with human crm1 genome (BAC)
2304221	WTC-<i>swh</i>/Kyo		Kyoto University	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=539> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11)	Dermatology	Edaradd<sup><i>swhKyo</i></sup>	14398765	17	67056373	67143933	7	17	92462305	92503399	7	17	90802280	90843476	7	17	85866629	85910612	7	RRID:RGD_2304221	The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-<i>Atrn<sup>zi</sup></i> colony at the National Cancer Center Research Institute in 1998. After elimination of <i>zi</i> allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene.
2304222	WIAR/Iar	Inbred Wistar-Imamichi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=536> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=536> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)	Metabolism; Development																			RRID:RGD_2304222	Strain developed by the depositor. This strain was established by inbreeding of Wistar-Imamichi rats by sib-mating. Strain characteristic is same as that of Wistar-Imamichi. (Nov 6, 2009)
2304241	F344-Tg(CXCR4)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=560> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=560> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Infectious	CXCR4	732176																	RRID:RGD_2304241	Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj.
2304242	WTC-<i>Kcnq1<sup>dfk</sup></i>Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=548> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=548> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm (as of 2017-04-05)	Otorhinology; Internal Organ	Kcnq1|Kcnq1<sup>dfk</sup>	621503|12802344	1	203383401	203803687	7	1	223154713	223490458	7	1	216377021	216379067	8	1	198374486	198376539	8	RRID:RGD_2304242	Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-<i>Kcnq1<sup>dfk</sup></i>/Kyo rat is a mutant for circling behavior. although the Atrn<sup>zi</sup> allele of WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic rats was eliminated, the circling behavior remained.
2304277	SHRSP.WKY-(<i>D1Rat36-D1Rat106</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=619> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=619> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	128874534	139471673	1 - by flanking markers	1	136045631	146282094	1 - by flanking markers	1	135022396	145354344	1 - by flanking markers	1	127453884	137184926	1 - by flanking markers	RRID:RGD_2304277	Developed by the DEPOSITOR
2304278	DA-Tg(Alb-HSVtk)5Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=651> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=651> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RGD_2304278	This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis.
2304279	W-Tg(MT2A-Myc)1Ys		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=699> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=699> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Reproduction; Development	Myc	3130																	RRID:RGD_2304279	This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).
2304280	SHR/Shi		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=666> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=666> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension																			RRID:RGD_2304280	Developed by the DEPOSITOR
2304281	SERC/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=657> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=657> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Sperm (as of 2024-09-24)	Neurobiology																			RRID:RGD_2304281	Developed by the DEPOSITOR
2304282	IEW/Ihr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=733> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=733> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Neurobiology; Ophthalmology																			RRID:RGD_2304282	mutant of Ihara epileptic rat.
2304283	SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=614> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=614> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	78134304	94626661	1 - by flanking markers	1	80946174	101198506	1 - by flanking markers	1	79689548	100133395	1 - by flanking markers	1	78430536	94644553	1 - by flanking markers	RRID:RGD_2304283	Developed by the DEPOSITOR
2304284	SHRSP.WKY-(<i>D1Mgh5-D1Rat116</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=609> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=609> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	78134304	218467340	1 - by flanking markers	1	80946174	239429964	1 - by flanking markers	1	79689548	232297227	1 - by flanking markers	1	78430536	212458660	1 - by flanking markers	RRID:RGD_2304284	Developed by the DEPOSITOR
2304285	BDIX/NemOda		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=579> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=579> National BioResource Project for the Rat in Japan</a>	inbred	Unknown	Cancer																			RRID:RGD_2304285	This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992.
2304286	DMYC/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=624> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=624> National BioResource Project for the Rat in Japan</a>	coisogenic	Cryopreserved Sperm																				RRID:RGD_2304286	Developed by the DEPOSITOR
2304287	ACI.F344-(<i>D16Rat17-D16Rat15</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=621> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=621> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cancer																			RRID:RGD_2304287	F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain.
2304288	ACI.BUF-(<i>D20Img2-D20Rat5</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=595> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=595> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Cancer			20	18411845	18411969	1 - by flanking markers	20	21025611	21025734	1 - by flanking markers	20	18872150	18872273	1 - by flanking markers	20	17617832	17617956	1 - by flanking markers	RRID:RGD_2304288	Developed by the DEPOSITOR
2304289	SHRSP.WKY-(<i>D1Mgh5-D1Rat349</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=617> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=617> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	78134304	130788777	1 - by flanking markers	1	80946174	137735636	1 - by flanking markers	1	79689548	136742994	1 - by flanking markers	1	78430536	78430678	1 - by flanking markers	RRID:RGD_2304289	Developed by the DEPOSITOR
2304290	BUF.ACI-(<i>D20Img2-D20Rat5</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=594> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=594> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Cancer			20	18411845	18411969	1 - by flanking markers	20	21025611	21025734	1 - by flanking markers	20	18872150	18872273	1 - by flanking markers	20	17617832	17617956	1 - by flanking markers	RRID:RGD_2304290	Developed by the DEPOSITOR
2304291	LEW-Tg(CAG-EGFP)1Ys		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=647> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=647> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Development																			RRID:RGD_2304291	This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.
2304292	LEW-Tg((ROSA)26Sor-luc)21Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=650> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=650> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo (as of 2017-08-08)	Development																			RRID:RGD_2304292	This strain expresses luciferase ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.
2304293	F344.LEC-<i>xhs1</i>/1Nrs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2304293	LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay
2304294	MPOD/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=622> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=622> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Cancer; Immunology																			RRID:RGD_2304294	Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait.
2304295	SHRSP.WKY-(<i>Igf1r-D1Rat36</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=616> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=616> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension	Igf1r	2869	1	122704976	128874670	1 - by flanking markers	1	129985761	136045766	1 - by flanking markers	1	128924921	135022531	1 - by flanking markers	1	121549831	127454022	1 - by flanking markers	RRID:RGD_2304295	Developed by the DEPOSITOR
2304296	KB/Oda		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=581> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=581> National BioResource Project for the Rat in Japan</a>	segregating_inbred	Cryopreserved Embryo																				RRID:RGD_2304296	Maintained by crossing heterozygotes of the albino locus (segregating inbred strain).
2304297	TM.KDP-<i>Cblb</i>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=608> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=608> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Immunology	Cblb	620535	11	49690402	49856762	1 - by flanking markers	11	54218260	54383403	1 - by flanking markers	11	51037383	51202761	1 - by flanking markers	11	48589878	48756940	1 - by flanking markers	RRID:RGD_2304297	Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).
2304298	SD-Tg(Tuba1a-EYFP)Okn		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=603> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=603> National BioResource Project for the Rat in Japan</a>	transgenic	Unknown																				RRID:RGD_2304298	This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter.
2304299	LEW-Tg(Alb-GFP)6Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=652> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=652> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RGD_2304299	This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School.
2304300	W-Tg(S100b-EGFP)Scell		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=673> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=673> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology; Metabolism																			RRID:RGD_2304300	Developed by microinjecting the transgene into Wistar rats
2304301	SHRSP.WKY-(<i>Slco3a1-D1Rat106</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=618> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=618> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension	Slco3a1	620227	1	129580126	139471673	1 - by flanking markers	1	136793300	146282094	1 - by flanking markers	1	135790854	145354344	1 - by flanking markers	1	128106232	137184926	1 - by flanking markers	RRID:RGD_2304301	Developed by the DEPOSITOR
2304302	SHRSP.WKY-(<i>D1Rat44-D1Arb21</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=612> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=612> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	153754139	187092492	1 - by flanking markers	1	167707459	206277202	1 - by flanking markers	1	161493758	199254774	1 - by flanking markers	1	150872626	182418476	1 - by flanking markers	RRID:RGD_2304302	Developed by the DEPOSITOR
2304303	W-Tg(MT2A-Myc)2Ys		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=698> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=698> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Reproduction; Development	Myc	3130																	RRID:RGD_2304303	This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).
2304304	SHRSP.WKY-(<i>D1Rat209-D1Arb21</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=613> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=613> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	187092235	187092492	1 - by flanking markers	1	206276946	206277202	1 - by flanking markers	1	142486986	199254774	1 - by flanking markers	1	134641522	182418476	1 - by flanking markers	RRID:RGD_2304304	Developed by the DEPOSITOR
2304305	DOB/Oda		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=582> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=582> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo																				RRID:RGD_2304305	This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000.
2304306	BUF.ACI-(<i>D20Img2-Cdkn1a</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=599> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=599> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Cancer	Cdkn1a	69328	20	7376325	7386778	1 - by flanking markers	20	8592437	8602879	1 - by flanking markers	20	6348422	6358864	1 - by flanking markers	20	7149177	7159727	1 - by flanking markers	RRID:RGD_2304306	Developed by the DEPOSITOR
2304307	ACI.BUF-(<i>D20Img2-Cdkn1a</i>)/Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=598> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=598> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Cancer	Cdkn1a	69328	20	7376325	7386778	1 - by flanking markers	20	8592437	8602879	1 - by flanking markers	20	6348422	6358864	1 - by flanking markers	20	7149177	7159727	1 - by flanking markers	RRID:RGD_2304307	Developed by the DEPOSITOR
2304308	ICR/Ihr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=731> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=731> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2019-08-05)	Neurobiology; Ophthalmology																			RRID:RGD_2304308	A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract.
2304309	SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=611> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=611> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	78134304	139471673	1 - by flanking markers	1	80946174	146282094	1 - by flanking markers	1	79689548	145354344	1 - by flanking markers	1	78430536	137184926	1 - by flanking markers	RRID:RGD_2304309	Developed by the DEPOSITOR
2304310	SD-Tg(Nes/Hspa1b-EGFP)Okn		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=602> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=602> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Neurobiology																			RRID:RGD_2304310	This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter.
2304311	LEW-Tg((ROSA)26Sor-lacZ)44JmskRrrc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=648> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=298>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=648> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=298>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo (as of 2017-08-08)	Development																			RRID:RRRC_00298	This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.
2304312	SHRSP.WKY-(<i>D1Mgh5-D1Rat36</i>)(<i>D1Rat44-D1Arb21</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=610> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=610> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2304312	Developed by the DEPOSITOR
2304313	SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=615> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=615> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension			1	78134304	85128763	1 - by flanking markers	1	80946174	89601109	1 - by flanking markers	1	79689548	79689689	1 - by flanking markers	1	78430536	78430678	1 - by flanking markers	RRID:RGD_2304313	Developed by the DEPOSITOR
2304314	BDIX.Cg-<i>Tal</i>/NemOda		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=607> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=607> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Osteosis																			RRID:RGD_2304314	Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain).
2304315	SHRSP.WKY-(<i>Calca-D1Arb21</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=620> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=620> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension	Calca	2254	1	172686168	187092492	1 - by flanking markers	1	191158061	206277202	1 - by flanking markers	1	184184018	199254774	1 - by flanking markers	1	168878212	182418476	1 - by flanking markers	RRID:RGD_2304315	Developed by the DEPOSITOR
2304316	F344.LEC-<i>xhs1</i>/2Nrs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=593> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=593> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2304316	LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay
2304329	WKY/Ezo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=568> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=568> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Cardio Hypertension																			RRID:RGD_2304329	Deposited by the DEPOSITOR
2304330	SD-Tg(HRAS)128Ncc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=668> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=668> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30)	Cancer																			RRID:RGD_2304330	This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.
2304331	F344-Tg(CCR5)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=674> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=674> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm	Infectious																			RRID:RGD_2304331	Deposited by the DEPOSITOR
2304332	HER/Wkmt		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=697> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=697> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Neurobiology																			RRID:RGD_2304332	Developed by the DEPOSITOR
2305934	F344-<i>Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=439>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup>	2305932	13	89951924	90028592	7	13	96782387	96860327	7	13	92264231	92340091	7	13	86203504	86279371	7	RRID:RRRC_00439	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene.
2305935	F344-<i>Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=476>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup>	2305933	14	110725089	110772578	7	14	113792257	113839936	7	14	114126931	114174459	7	14	103450074	103497687	7	RRID:RRRC_00476	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene.
2305939	SHRSP.WKY-(<i>D9Mit6-D9Rat83</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=690> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=690> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305939	Developed by the DEPOSITOR
2305940	SHRSP-Chr 7<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=688> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=688> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305940	Chromosome 7 from WKY is introgressed into the genomic background of SHRSP
2305941	SHR-Chr 15<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=695> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=695> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305941	Chromosome 15 from WKY is introgressed into the genomic background of SHR
2305942	SHR-Chr 3<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=694> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=694> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305942	Chromosome 3 from WKY is introgressed into the genomic background of SHR
2305943	SHRSP-Chr 15<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=692> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=692> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305943	Chromosome 15 from WKY is introgressed into the genomic background of SHRSP
2305944	SHRSP-Chr 4<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=687> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=687> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305944	Chromosome 4 from WKY is introgressed into the genomic background of SHRSP
2305945	SHRSP-Chr 13<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=691> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=691> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305945	Chromosome 13 from WKY is introgressed into the genomic background of SHRSP
2305946	SHR-Chr 1<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=693> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=693> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305946	Chromosome 1 from WKY is introgressed into the genomic background of SHR
2305947	SHR-Chr 19<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=696> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=696> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305947	Chromosome 19 from WKY is introgressed into the genomic background of SHR
2305948	SHRSP.WKY-(<i>D8Rat77-D8Rat16</i>)(<i>D8Tkyo10</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=689> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=689> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305948	Developed by the DEPOSITOR
2305949	SHRSP-Chr 1<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=686> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=686> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2305949	Chromosome 1 from WKY is introgressed into the genomic background of SHRSP
2305966	SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=864> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=864> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	congenic	Cryopreserved Sperm	Diabetes Obesity			1	63990899	126292805	1 - by flanking markers	1	63244295	133485967	1 - by flanking markers	1	64252881	132448306	1 - by flanking markers	1	65677942	124977364	1 - by flanking markers	RRID:RGD_2305966	Developed by the DEPOSITOR
2305967	SHR.SHRSP-(<i>D18Rat73-D18Rat11</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=866> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=866> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	congenic	Cryopreserved Sperm	Diabetes Obesity			18	52290789	71692408	1 - by flanking markers	18	50804228	69942605	1 - by flanking markers	18	51609032	70803264	1 - by flanking markers	18	49999958	68414117	1 - by flanking markers	RRID:RGD_2305967	Developed by the DEPOSITOR
2305968	SHRSP.WKY-(<i>D1Wox18-D1Rat39</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=862> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=862> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity			1	94626541	125983558	1 - by flanking markers	1	101198387	133172336	1 - by flanking markers	1	100133276	132134441	1 - by flanking markers	1	94644435	124668572	1 - by flanking markers	RRID:RGD_2305968	Developed by the DEPOSITOR
2305969	SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=861> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=861> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity			1	78134304	85128763	1 - by flanking markers	1	80946174	89601109	1 - by flanking markers	1	79689548	79689689	1 - by flanking markers	1	78430536	78430678	1 - by flanking markers	RRID:RGD_2305969	Developed by the DEPOSITOR
2305970	DA-Tg(Alb-TTR*V30M)7Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=703> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=703> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RGD_2305970	This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.
2305971	SHRSP.SHR-(<i>D18Rat73-D18Rat11</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	congenic	Cryopreserved Sperm	Diabetes Obesity			18	52290789	71692408	1 - by flanking markers	18	50804228	69942605	1 - by flanking markers	18	51609032	70803264	1 - by flanking markers	18	49999958	68414117	1 - by flanking markers	RRID:RGD_2305971	Developed by the DEPOSITOR
2305972	WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)(<i>Bcl2-D13Mgh7</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=838> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=838> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305972	Developed by the DEPOSITOR
2305973	SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.	congenic	Cryopreserved Sperm	Diabetes Obesity			1	63990899	126292805	1 - by flanking markers	1	63244295	133485967	1 - by flanking markers	1	64252881	132448306	1 - by flanking markers	1	65677942	124977364	1 - by flanking markers	RRID:RGD_2305973	Developed by the DEPOSITOR
2305974	WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=858> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=858> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305974	Developed by the DEPOSITOR
2305975	SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=860> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=860> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity			1	78134304	94626661	1 - by flanking markers	1	80946174	101198506	1 - by flanking markers	1	79689548	100133395	1 - by flanking markers	1	78430536	94644553	1 - by flanking markers	RRID:RGD_2305975	Developed by the DEPOSITOR
2305976	DA-Tg(Alb-TTR*V30M)9Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=705> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=339>Rat Resource & Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=705> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=339>Rat Resource & Research Center</a>	transgenic	Cryopreserved Embryo	Development																			RRID:RRRC_00339	This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.
2305977	ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=702> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=702> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			16	350121	67547357	1 - by flanking markers	16	1084304	67099528	1 - by flanking markers	16	1090054	1090164	1 - by flanking markers	16	380245	380356	1 - by flanking markers	RRID:RGD_2305977	F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals.
2305978	LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=706> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=706> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo (as of 2017-08-08)	Development																			RRID:RGD_2305978	This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School.
2305979	WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>Bcl2-D13Mgh7</i>)/Izm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=859> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=859> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305979	Developed by the DEPOSITOR
2305987	F344.OLETF-(<i>D7Mgh16-D7Wox46</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=844> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=844> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	96491967	113050225	1 - by flanking markers	7	100584458	116158165	1 - by flanking markers	7	100004559	116255796	1 - by flanking markers	7	91256311	106845450	1 - by flanking markers	RRID:RGD_2305987	Developed by the DEPOSITOR
2305988	(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=841> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=841> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305988	Developed by the DEPOSITOR
2305989	(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Z-Lepr<sup><i>fa</i></sup>/Tj</i>)F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=842> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=842> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305989	Developed by the DEPOSITOR
2305990	F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=836> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=836> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305990	Developed by the DEPOSITOR
2305991	(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj X F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=839> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=839> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305991	Developed by the DEPOSITOR
2305992	F344.OLETF-(<i>D7Mit16-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=820> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=820> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	120745845	120746007	1 - by flanking markers	7	123587556	123587717	1 - by flanking markers	7	123602837	123602998	1 - by flanking markers	7	113886156	113886318	1 - by flanking markers	RRID:RGD_2305992	Developed by the DEPOSITOR
2305993	F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=834> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=834> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305993	Developed by the DEPOSITOR
2305994	F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/1Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=835> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=835> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Diabetes Obesity																			RRID:RGD_2305994	Developed by the DEPOSITOR
2305995	F344.OLETF-(<i>D7Got130-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=837> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=837> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305995	Developed by the DEPOSITOR
2305996	F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=843> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=843> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305996	Developed by the DEPOSITOR
2305997	(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/2Tj x F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=840> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=840> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2305997	Developed by the DEPOSITOR
2305998	F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D8Rat54-D8Mgh17</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=809> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=809> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			8	19796514	73102155	1 - by flanking markers	8	21850030	79245063	1 - by flanking markers	8	74917593	80840067	1 - by flanking markers	8	69349194	69349344	1 - by flanking markers	RRID:RGD_2305998	Developed by the DEPOSITOR
2305999	F344.OLETF-(<i>D7Mgh16-D7Rat70</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=830> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=830> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	96491967	117397170	1 - by flanking markers	7	100584458	120641361	1 - by flanking markers	7	100004559	120648531	1 - by flanking markers	7	91256311	110979877	1 - by flanking markers	RRID:RGD_2305999	Developed by the DEPOSITOR
2306000	F344.OLETF-(<i>D7Rat70-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=831> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=831> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	117396947	117397170	1 - by flanking markers	7	120641139	120641361	1 - by flanking markers	7	120648309	120648531	1 - by flanking markers	7	110979654	110979877	1 - by flanking markers	RRID:RGD_2306000	Developed by the DEPOSITOR
2306001	F344.OLETF-(<i>D7Rat176-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=832> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=832> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	111200727	111200952	1 - by flanking markers	7	114641525	114641749	1 - by flanking markers	7	114708083	114708307	1 - by flanking markers	7	105399233	105399458	1 - by flanking markers	RRID:RGD_2306001	Developed by the DEPOSITOR
2306002	F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/1Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=833> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=833> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306002	Developed by the DEPOSITOR
2306003	F344.OLETF-(<i>D7Wox46-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=845> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=845> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	113050053	113050225	1 - by flanking markers	7	116157993	116158165	1 - by flanking markers	7	116255624	116255796	1 - by flanking markers	7	106845277	106845450	1 - by flanking markers	RRID:RGD_2306003	Developed by the DEPOSITOR
2306004	F344.OLETF-(<i>D7Mgh16-D7Mit16</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=821> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=821> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	96491967	120746007	1 - by flanking markers	7	100584458	123587717	1 - by flanking markers	7	100004559	123602998	1 - by flanking markers	7	91256311	113886318	1 - by flanking markers	RRID:RGD_2306004	Developed by the DEPOSITOR
2306013	F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=853> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=853> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			14	32584630	70077314	1 - by flanking markers	14	32389647	69559504	1 - by flanking markers	14	32593926	69517234	1 - by flanking markers	14	30320092	65026991	1 - by flanking markers	RRID:RGD_2306013	Developed by the DEPOSITOR
2306014	F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=848> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=848> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			8	19796514	73102155	1 - by flanking markers	8	21850030	79245063	1 - by flanking markers	8	74917593	80840067	1 - by flanking markers	8	69349194	69349344	1 - by flanking markers	RRID:RGD_2306014	Developed by the DEPOSITOR
2306015	F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=852> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=852> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			12	43801711	43801909	1 - by flanking markers	12	17721341	50319569	1 - by flanking markers	12	15714609	48536609	1 - by flanking markers	12	13635523	42767729	1 - by flanking markers	RRID:RGD_2306015	Developed by the DEPOSITOR
2306016	F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=849> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=849> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			11	61504311	84560241	1 - by flanking markers	11	65784365	89808503	1 - by flanking markers	11	62653194	86714631	1 - by flanking markers	11	59802622	82566702	1 - by flanking markers	RRID:RGD_2306016	Developed by the DEPOSITOR
2306017	(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D14Rat23-D14Rat12</i>))F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=856> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=856> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306017	Developed by the DEPOSITOR
2306018	F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=851> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=851> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			9	33374546	63705951	1 - by flanking markers	9	40808491	70797404	1 - by flanking markers	9	41139089	71771476	1 - by flanking markers	9	36840385	66437242	1 - by flanking markers	RRID:RGD_2306018	Developed by the DEPOSITOR
2306019	F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=850> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=850> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			1	94356875	176616212	1 - by flanking markers	1	100372156	194998184	1 - by flanking markers	1	188051098	188051234	1 - by flanking markers	1	172711200	172711337	1 - by flanking markers	RRID:RGD_2306019	Developed by the DEPOSITOR
2306020	(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>))F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=857> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=857> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306020	Developed by the DEPOSITOR
2306021	SHR-Chr 2<sup>WKY</sup>/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=713> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=713> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity; Cardio Hypertension																			RRID:RGD_2306021	Developed by the DEPOSITOR
2306022	KCI/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=630> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=630> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Sperm (as of 2024-09-24)	Neurobiology	Pcdh15	1590969	20	14507804	15240479	7	20	17138580	19021206	7	20	14952213	15334745	7	20	13997094	15496446	7	RRID:RGD_2306022	Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003.
2306023	F344-Tg(CCNT1)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=712> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=712> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Infectious	CCNT1	1322457																	RRID:RGD_2306023	Developed by the DEPOSITOR
2306024	FOK/Ncu	Furuyama rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=759> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=759> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_2306024	These are resistant to hot environment.
2306025	WMN/Nrs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=675> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=675> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Cancer; Metabolism																			RRID:RGD_2306025	Developed by the DEPOSITOR
2306026	F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=854> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=854> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			16	51452966	77968799	1 - by flanking markers	16	51050772	77759249	1 - by flanking markers	16	51339600	78172206	1 - by flanking markers	16	48143982	73187298	1 - by flanking markers	RRID:RGD_2306026	Developed by the DEPOSITOR
2306027	WM/Nrs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=676> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=676> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals; Cryopreserved Embryo	Cancer; Metabolism																			RRID:RGD_2306027	Developed by the DEPOSITOR
2306028	F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=847> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=847> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306028	Developed by the DEPOSITOR
2306029	(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=855> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=855> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306029	Developed by the DEPOSITOR
2306030	F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=846> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=846> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2306030	Developed by the DEPOSITOR
2306033	SHR.Cg-<i>Lepr<sup>cp</sup></i>/NDmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=734> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=734> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals	Diabetes Obesity; Cardio Hypertension	Lepr<sup>cp</sup>	11570565																	RRID:RGD_2306033	Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999.
2306034	NER.F344-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Rat100-D5Rat234</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=729> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=729> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Neurobiology																			RRID:RGD_2306034	Developed by the DEPOSITOR
2306035	F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=727> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=727> National BioResource Project for the Rat in Japan</a>	congenic	Live Animals	Neurobiology																			RRID:RGD_2306035	This double congenic strain was established by crossing F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo and F344.NER-(<i>D5Mgh4-D5Rat36</i>)/Kyo
2306036	F344-<i>Apc<sup>m1</i>Kyo</sup>		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=714> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=714> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Sperm (as of 2017-03-14)	Cancer	Apc|Apc<sup>m1Kyo</sup>	2123|12792252	18	26732147	26790383	7	18	26725560	26820837	7	18	27011710	27106323	7	18	25828558	25925511	7	RRID:RGD_2306036	F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven).
2306037	F344-Tg(CD4)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=700> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=700> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Infectious																			RRID:RGD_2306037	Developed by the DEPOSITOR
2306041	F344-<i>Scn1a<sup>m2Kyo</sup></i>		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=715> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=715> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Neurobiology	Scn1a<sup>m2Kyo</sup>	12792284	3	48238528	48364143	7	3	59016641	59135580	7	3	52437310	52437310	8	3	50998498	50998498	8	RRID:RGD_2306041	Established by ENU mutagenesis. A point mutation in Scn1a gene.
2306042	F344-<i>Scn1a<sup>m1Kyo</sup></i>		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=716> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=716> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Sperm (as of 2017-05-04)	Neurobiology	Scn1a<sup>m1Kyo</sup>	12792283	3	48238528	48364143	7	3	59016641	59135580	7	3	52408707	52408707	8	3	50969024	50969024	8	RRID:RGD_2306042	Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model.
2306043	SHR/4Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=566> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=566> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306043	Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure
2306044	SHRSP/3Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=567> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=567> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306044	Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line
2306045	SHR/2Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=564> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=564> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306045	Developed by the DEPOSITOR, one of the SHR substrains from B2 line
2306046	W-Tg(CAG-EGFP)3Ys		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=741> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=741> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Embryo																				RRID:RGD_2306046	This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.
2306047	W-Tg(Gnrh1-EGFP)Nphy		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=704> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=704> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm		Gnrh1	2720																	RRID:RGD_2306047	This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence.
2306048	SHR/3Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=565> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=565> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306048	Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure
2306049	SHRSP/4Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=736> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=736> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306049	Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis
2306050	SHRSP/5Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=737> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=737> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306050	Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis
2306051	SHRSP/2Dmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=563> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=563> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals	Cardio Hypertension	Cd36	2301																	RRID:RGD_2306051	Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line
2306058	LEC.W-Tg(CAG-Zfml)30Ncms/Ncms		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=782> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=782> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2306058	Developed by the DEPOSITOR
2306059	DA.Cg-<i>Foxn1<sup>rnu</sup> Lyst<sup>bg</sup></i>/Slc		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=760> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=760> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Immunology; Hematology	Foxn1|Lyst	3970|621837																	RRID:RGD_2306059	Developed by the DEPOSITOR
2306060	LEC.W-Tg(CAG-Zfml)26Ncms/Ncms		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=781> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=781> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2306060	Developed by the DEPOSITOR
2306061	ACI.BUF-<i>Pur1, Thym2</i>/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=739> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=739> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Metabolism																			RRID:RGD_2306061	The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002.
2306062	W-Tg(Per1-luc)1Oa		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=740> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=273>Rat Resource and Research Center</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=740> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=273>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00273	Developed by the DEPOSITOR
2306063	LEC.W-Tg(CAG-Zfml)21Ncms/Ncms		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=738> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=738> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2306063	Developed by the DEPOSITOR
2306064	MPR/Iar		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=745> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=745> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24)	Metabolism; Osteosis	Arsb|Arsb<sup>MPR</sup>	2158|12792967	2	24067560	24223821	7	2	42559079	42717753	7	2	23385154	23543028	7	2	25002210	25162675	7	RRID:RGD_2306064	Developed by the DEPOSITOR
2306070	WIC-Tg(Wap-GH1)1Mni		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=789> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=789> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm (as of 2017-04-21)	Diabetes Obesity; Metabolism																			RRID:RGD_2306070	Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).
2306071	F344-Tg(CAG-EGFP)Ncco		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=576> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=576> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity; Cancer; Metabolism																			RRID:RGD_2306071	Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method
2306072	ACI.F344-(<i>D16Nkg74</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=768> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=768> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_2306072	A sub congenic strain of ACI/N.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg
2306073	WIC-Tg(Wap-GH1)2Mni		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=788> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=788> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm (as of 2017-04-21)	Diabetes Obesity; Metabolism																			RRID:RGD_2306073	Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).
2306076	ACI.F344-(<i>D16Nkg9-D16Nkg38</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=793> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=793> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_2306076	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals.
2306077	ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=791> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=791> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer			16	59398206	59398647	1 - by flanking markers	16	58966446	58966664	1 - by flanking markers	16	59285775	59285993	1 - by flanking markers	16	55711087	55711306	1 - by flanking markers	RRID:RGD_2306077	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating.
2306078	KFRS4A/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=801> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=801> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm (as of 2024-09-24)	Neurobiology; Behavior																			RRID:RGD_2306078	Developed by the DEPOSITOR
2306079	ACI.F344-(<i>D16Nkg87-D16Nkg105</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=792> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=792> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cancer																			RRID:RGD_2306079	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals.
2306085	TCR/Ibu	Toyoda Circling Rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=800> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=800> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Neurobiology; Behavior																			RRID:RGD_2306085	A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007.
2306089	ACI.BUF-(<i>D7Wox16-D7Rat69</i>)/Mna		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=803> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=803> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cancer			7	64611964	113044228	1 - by flanking markers	7	67991394	116151991	1 - by flanking markers	7	67801457	67801690	1 - by flanking markers	7	60460452	60460686	1 - by flanking markers	RRID:RGD_2306089	The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing.
2306090	ExHC/Ta	Exogenously hypercholesterolemic rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=804> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=804> National BioResource Project for the Rat in Japan</a>	inbred	Live Animals (as of 2017-04-19)	Metabolism																			RRID:RGD_2306090	Developed by the DEPOSITOR
2306098	ACI.F344-(<i>D16Nkg30-D16Mgh6</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=828> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=828> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm				16	49150370	49150515	1 - by flanking markers	16	48766016	48766115	1 - by flanking markers	16	49051407	49051506	1 - by flanking markers	16	45868397	45868497	1 - by flanking markers	RRID:RGD_2306098	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.
2306099	SHR.WKY-(<i>D15Tkyo3-D15Rat68</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=807> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=807> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			15	62521452	62521592	1 - by flanking markers	15	67139660	67139799	1 - by flanking markers	15	63498932	63499071	1 - by flanking markers	15	56484420	56484560	1 - by flanking markers	RRID:RGD_2306099	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306100	SHR.WKY-(<i>D3Tkyo7-D3Rat1</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=815> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=815> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	99858951	170016653	1 - by flanking markers	3	112038782	180128021	1 - by flanking markers	3	105465332	176418101	1 - by flanking markers	3	100769917	168026850	1 - by flanking markers	RRID:RGD_2306100	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306101	LEC.BN-(<i>D4Mgh16-D4Rat233</i>)/Hkv		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=875> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=875> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm				4	61646674	108329449	1 - by flanking markers	4	61427427	170105737	1 - by flanking markers	4	61708103	105384025	1 - by flanking markers	4	62933269	107032773	1 - by flanking markers	RRID:RGD_2306101	Developed by the DEPOSITOR
2306102	BN.LEC-(<i>D4Rat128-D4Rat106</i>)/Hkv		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=879> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=879> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm				4	79189959	117887968	1 - by flanking markers	4	145335315	179959894	1 - by flanking markers	4	80666353	115372927	1 - by flanking markers	4	79986873	116179656	1 - by flanking markers	RRID:RGD_2306102	Developed by the DEPOSITOR
2306103	SHRSP/Sums		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=873> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=873> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo																				RRID:RGD_2306103	Developed by the DEPOSITOR
2306104	BN.LEC-(<i>D4Rat184-D4Rat238</i>)/Hkv		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=878> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=878> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm				4	120665583	142160377	1 - by flanking markers	4	182854846	203361566	1 - by flanking markers	4	118283596	138891201	1 - by flanking markers	4	118928273	139725596	1 - by flanking markers	RRID:RGD_2306104	Developed by the DEPOSITOR
2306105	BN.LEC-(<i>D4Rat128-D4Rat238</i>)/Hkv		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=877> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=877> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm				4	79189959	142160377	1 - by flanking markers	4	145335315	203361566	1 - by flanking markers	4	80666353	138891201	1 - by flanking markers	4	79986873	139725596	1 - by flanking markers	RRID:RGD_2306105	Developed by the DEPOSITOR
2306106	CLX/Ta	Circling behavior linked to the X-chromosome (CLX)	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=813> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=813> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo (as of 2024-09-24)	Behavior																			RRID:RGD_2306106	Developed by the DEPOSITOR
2306107	SD-Tg(Sp6)58Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=868> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=868> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm (as of 2017-08-22)	Dentistry; Development	Sp6	1306768																	RRID:RGD_2306107	The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.
2306108	SHR.WKY-(<i>D3Mit9-D3Wox16</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=814> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=814> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	26674018	89245110	1 - by flanking markers	3	39535971	100667805	1 - by flanking markers	3	34394121	94028641	1 - by flanking markers	3	30356773	90477342	1 - by flanking markers	RRID:RGD_2306108	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306109	SHR.WKY-(<i>D3Mgh6-D3Rat1</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=817> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=817> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	50522618	170016653	1 - by flanking markers	3	61249840	180128021	1 - by flanking markers	3	54630948	176418101	1 - by flanking markers	3	53184593	168026850	1 - by flanking markers	RRID:RGD_2306109	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306110	IER/Sums		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=870> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=870> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Neurobiology																			RRID:RGD_2306110	Developed by the DEPOSITOR
2306111	LEC.BN-(<i>D4Mgh16-D4Rat233</i>)(<i>D4Rat271-D4Rat238</i>)/Hkv		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=876> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=876> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2306111	Developed by the DEPOSITOR
2306112	ZDF-<i>Lepr<sup>fa</i>CrlCrlj</sup>		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=778> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=778> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Embryo	Diabetes Obesity	Lepr	3001	5	122320075	122503449	7	5	124380327	124556585	7	5	120503475	120682281	7	5	116294409	116477904	7	RRID:RGD_2306112	Developed by the DEPOSITOR
2306113	SD-Tg(Sp6)6Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=867> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=867> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Dentistry; Development	Sp6	1306768																	RRID:RGD_2306113	Developed by the DEPOSITOR
2306114	SHR.WKY-(<i>D3Mgh16-D3Rat110</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=806> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=806> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	6373335	42729760	1 - by flanking markers	3	11361699	53824856	1 - by flanking markers	3	6000748	47155284	1 - by flanking markers	3	10778704	10778823	1 - by flanking markers	RRID:RGD_2306114	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306115	SHR.WKY-(<i>D3Mgh16-D3Rat166</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=816> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=816> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			3	6373335	101359980	1 - by flanking markers	3	11361699	113470358	1 - by flanking markers	3	6000748	106900596	1 - by flanking markers	3	10778704	102200699	1 - by flanking markers	RRID:RGD_2306115	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306116	SD-Tg(Sp6)5Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=819> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=819> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Dentistry; Development	Sp6	1306768																	RRID:RGD_2306116	The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.
2306117	ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=827> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=827> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2306117	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.
2306118	SHR.WKY-(<i>D15Rat95-D15Rat106</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=808> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=808> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			15	69469532	106177917	1 - by flanking markers	15	74166614	109944957	1 - by flanking markers	15	70559420	106550657	1 - by flanking markers	15	63180675	98288169	1 - by flanking markers	RRID:RGD_2306118	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306119	F344-Tg(CD4,CCNT1)1Hik		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=805> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=805> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Infectious																			RRID:RGD_2306119	Developed by the DEPOSITOR
2306120	SHR.WKY-(<i>D4Wox27-D4Rat15</i>)/Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=818> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=818> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Diabetes Obesity; Cardio Hypertension			4	460493	47890193	1 - by flanking markers	4	3096322	48448808	1 - by flanking markers	4	3044017	48656399	1 - by flanking markers	4	5218294	50119996	1 - by flanking markers	RRID:RGD_2306120	This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.
2306276	F344-<i>Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=456>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup>	2306273	4	60406942	61284294	7	4	60287465	61081401	7	4	60549128	61358305	7	4	61807706	62584316	7	RRID:RRRC_00456	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene.
2306277	F344-<i>Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=454>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup>	2306274	4	96622363	96624479	7	4	162420268	162549350	7	4	97634925	97763478	7	4	96011118	96134767	7	RRID:RRRC_00454	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene.
2306278	F344-AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=448>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-31)		AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>	2306272																	RRID:RRRC_00448	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325.
2306279	F344-<i>Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=446>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup>	2306275	15	68905784	69267707	7	15	73538942	74007617	7	15	69928507	70400077	7	15	62543375	63013060	7	RRID:RRRC_00446	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene.
2306529	BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown				4	75808584	77809321	1 - by flanking markers	4	142052025	144005977	1 - by flanking markers	4	77380565	79326833	1 - by flanking markers	4	76721312	78654798	1 - by flanking markers	RRID:RGD_2306529	Parental strain BBDR.BBDP-(<I>D4Rhw17-ss99306861</i>)(<I>D4Rhw11-D4Rhw10</I>)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic
2306532	BBDR.F344-(<i>D4Rat27-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306532	Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA
2306533	BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/2Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RRRC_00469	Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw
2306534	BBDR.F344-(<i>D4Rat102-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306534	Congenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw
2306535	BBDR.F344-(<i>D4Rat253-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306535	Congenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw
2306536	BBDR.F344-(<i>D4Arb11-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306536	Congenic substrains generated by intercrossing male BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw and female BBDR/Rhw
2306537	BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/1Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306537	Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw
2306538	BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306538	Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation
2306539	BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/3Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306539	Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA
2306540	BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306540	Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA
2306541	BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington	<a href=http://www.rrrc.us/Strain/?x=457>Rat Resource and Research Center</a>	congenic	Unknown																				RRID:RRRC_00457	BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed
2306542	BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306542	Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA
2306543	BBDR.F344-(<i>D4Got59-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306543	BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed
2306544	BBDR.F344-(<i>D4Rat26-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown																				RRID:RGD_2306544	Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA
2306709	BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/3Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown				4	75732943	75733127	1 - by flanking markers	4	141978848	141979031	1 - by flanking markers	4	77307388	79562753	1 - by flanking markers	4	76647384	78886189	1 - by flanking markers	RRID:RGD_2306709	This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.
2306710	F344-<i>Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=447>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup>	2306701	11	69481117	69547133	7	11	73980288	74048100	7	11	70895141	70963121	7	11	67656241	67725889	7	RRID:RRRC_00447	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene.
2306711	F344-<i>FM117003<sup>Tn(sb-T2/Bart3)2.321McwiRrrc</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=475>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm		FM117003<sup>Tn(sb-T2/Bart3)2.321Mcwi</sup>	2306703																	RRID:RRRC_00475	this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb
2306712	BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/2Rhw		Department of Medicine, University of Washington, Seattle, Washington		congenic	Unknown				4	75732943	75733127	1 - by flanking markers	4	141978848	141979031	1 - by flanking markers	4	77307388	79562753	1 - by flanking markers	4	76647384	78886189	1 - by flanking markers	RRID:RGD_2306712	This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.
2306717	BBDP/WorSunn		Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada	<a href=http://www.rrrc.us/Strain/?x=787>Rat Resource and Research Center</a>	inbred	Cryopreserved Sperm; Cryorecovery (as of 2018-11-12)																				RRID:RRRC_00787	These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada.
2306784	Kini:DA,PVG-G12		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		advanced_intercross_line	Unknown																				RRID:RGD_2306784	Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1<sup>a</sup> MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG/OlaHsd females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couples
2306815	SS.SR-(<I>D7Rat67-D7Mco7</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	111506104	113014423	1 - by flanking markers	7	114961803	116100169	1 - by flanking markers	7	115041287	115041463	1 - by flanking markers	7	105699315	105699492	1 - by flanking markers	RRID:RGD_2306815	Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped
2306816	SS.SR-(<I>D7Mco19-D7Mco7</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	112800232	113014423	1 - by flanking markers	7	115828017	116100169	1 - by flanking markers	7	115922628	115922885	1 - by flanking markers	7	106571501	106571759	1 - by flanking markers	RRID:RGD_2306816	Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped
2306817	SS.SR-(<I>D7Uia1-D7Mco19</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108875615	112800489	1 - by flanking markers	7	112367543	115828274	1 - by flanking markers	7	112429186	115922885	1 - by flanking markers	7	103146217	106571759	1 - by flanking markers	RRID:RGD_2306817	Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped
2306818	SS.SR-(<I>D7Rat131-D7Mco7</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	111882387	113014423	1 - by flanking markers	7	115334997	116100169	1 - by flanking markers	7	115421039	115421228	1 - by flanking markers	7	106074002	106074194	1 - by flanking markers	RRID:RGD_2306818	Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped
2306819	SS.SR-(<I>D7Uia1-D7Rat131</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108875615	111882577	1 - by flanking markers	7	112367543	115335186	1 - by flanking markers	7	112429186	115421228	1 - by flanking markers	7	103146217	106074194	1 - by flanking markers	RRID:RGD_2306819	Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped
2306820	SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	171009566	171009778	1 - by flanking markers	3	181074759	181074971	1 - by flanking markers	3	177366448	177366660	1 - by flanking markers	3	168974481	168974694	1 - by flanking markers	RRID:RGD_2306820	SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome
2306823	SS.SR-(<i>D3Arb14-D3Mco36</i>)(<i>D7Mco19-D7Mco7</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown																				RRID:RGD_2306823	SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco were crossed with SS.SR-(<i>D7Mco19-D7Mco7</i>)/Jr and then F<sub>1</sub> rats were backcrossed with SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred
2306840	E3.DA-(<i>D4Wox22-D4Got132</i>)(<i>D12Wox5-D12Rat26</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown																				RRID:RGD_2306840	This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers
2306841	E3.DA-(<i>D12Wox5-D12Rat26</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				12	23845554	23845733	1 - by flanking markers	12	17721341	27718984	1 - by flanking markers	12	15714609	25711626	1 - by flanking markers	12	13635523	22692658	1 - by flanking markers	RRID:RGD_2306841	This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers
2306842	E3.DA-(<i>D20Rat45-D20Rat47</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				6;20	133455626;1616332	133455718;5447494	1 - by flanking markers;1 - by flanking markers	20	4059279	8810333	1 - by flanking markers	20	2018654	6567533	1 - by flanking markers	20	1527842	5304690	1 - by flanking markers	RRID:RGD_2306842	This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers
2306874	F344-<i>Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=441>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup>	2306873	2	127564813	127639564	7	2	147063971	147216092	7	2	127459089	127521327	7	2	123600972	123685331	7	RRID:RRRC_00441	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene.
2306875	F344-<i>Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup>	2306872	13	77472950	77480210	7	13	84590119	84605900	7	13	79696811	79717581	7	13	74151519	74172760	7	RRID:RGD_2306875	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene.
2306892	SHR.BN-(<i>D2Rat114-D2Rat123</i>)/Jk		Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.	<a href=http://genetica.incor.usp.br>Genetica</a>	congenic	Unknown				2	36432989	112326568	1 - by flanking markers	2	55361257	131889716	1 - by flanking markers	2	36245223	112175725	1 - by flanking markers	2	109366814	109366971	1 - by flanking markers	RRID:RGD_2306892	Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals
2306893	SHR.BN-(<i>D16Rat87-D16Mgh1</i>)/Jk		Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.	<a href=http://genetica.incor.usp.br>Genetica</a>	congenic	Unknown				16	3464719	46137590	1 - by flanking markers	16	4082652	45651269	1 - by flanking markers	16	4136355	45905331	1 - by flanking markers	16	3380150	43025077	1 - by flanking markers	RRID:RGD_2306893	Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals
2306894	SHR.BN-(<i>D4Rat33-D4Rat54</i>)/Jk		Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.	<a href=http://genetica.incor.usp.br>Genetica</a>	congenic	Unknown				4	80205349	121829076	1 - by flanking markers	4	146540904	184799673	1 - by flanking markers	4	81874073	119546974	1 - by flanking markers	4	81006124	120102625	1 - by flanking markers	RRID:RGD_2306894	Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals
2306895	SHR.BN-(<i>D2Rat226-D2Rat294</i>)/Jk		Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. 	<a href=http://genetica.incor.usp.br>Genetica</a>	congenic	Unknown				2	170338294	236153712	1 - by flanking markers	2	197020226	262435073	1 - by flanking markers	2	177680772	243901375	1 - by flanking markers	2	164073756	227146641	1 - by flanking markers	RRID:RGD_2306895	Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals
2306961	RLA/Verh	Roman low avoidance	Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium		inbred	Unknown																				RRID:RGD_2306961	Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium
2306962	RHA/Verh	Roman high avoidance	Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium		inbred	Unknown																				RRID:RGD_2306962	Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium
2307077	HXB4/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307077	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307078	HXB27/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307078	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307079	HXB3/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307079	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307080	HXB20/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307080	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307081	HXB31/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307081	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307082	HXB18/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307082	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307083	HXB10/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307083	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307084	HXB24/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307084	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307085	HXB17/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307085	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307086	HXB7/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307086	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307087	SHR.BN-(<i>D18Rat32-D18Rat12</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown																				RRID:RGD_2307087	A segment of chr 18 from BN was introgressed into the SHR background
2307088	HXB22/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307088	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307089	HXB29/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307089	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307090	SHR.BN10/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown																				RRID:RGD_2307090	A segment of chr 10 from BN was introgressed into the SHR background
2307091	HXB13/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307091	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307092	HXB14/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307092	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307093	HXB23/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307093	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307094	HXB1/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307094	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307095	HXB15/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307095	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307096	HXB2/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307096	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307097	HXB21/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307097	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307098	HXB25/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307098	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307099	HXB5/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307099	Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub
2307115	BXH5/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307115	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307116	PXO3-2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307116	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307117	PXO5-2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307117	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307118	PXO9/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307118	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307119	PXO7-1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307119	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307120	PXO7-2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307120	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307121	BXH2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307121	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307122	PXO8-1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307122	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307123	BXH13/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307123	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307124	BXH10/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307124	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307125	PXO6-2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307125	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307126	BXH8/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307126	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307127	BXH11/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307127	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307128	PXO5-1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307128	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307129	BXH9/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307129	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307130	PXO6-3/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307130	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307131	PXO8-2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307131	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307132	PXO10/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307132	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307134	BXH3/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307134	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307135	PXO4/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307135	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307136	BXH6/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307136	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307137	PXO6-1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307137	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307138	PXO1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307138	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307139	BXH12/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307139	Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv
2307155	SHR/1NCrl		MRC Clinical Sciences Centre, College School of Medicine, London, UK		inbred	Unknown																				RRID:RGD_2307155	To Charles River from NIH in 1973 at F32.
2307156	DA/ZtmKini		Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden		inbred	Unknown																				RRID:RGD_2307156	Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden.
2307157	PVG.1AV1/Kini		Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown																				RRID:RGD_2307157	Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden.
2307159	SHRSR.SHRSP-(<i>Klk1-Mt1-ps1</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Mt1-ps1|Klk1c12	3118|1303192	1	94355758	185690396	1 - by flanking markers	1	100371040	204941832	1 - by flanking markers	1	99298965	197963072	1 - by flanking markers	1	94378103	181133270	1 - by flanking markers	RRID:RGD_2307159	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307160	SHRSR.SHRSP-(<i>Klk1-D1Mit3</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Klk1c12	1303192	1	94355758	146971983	1 - by flanking markers	1	100371040	162692800	1 - by flanking markers	1	99298965	156446783	1 - by flanking markers	1	94378103	144267916	1 - by flanking markers	RRID:RGD_2307160	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307161	SHRSR.SHRSP-(<i>D1Rat134-Mt1-ps1</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Mt1-ps1	3118	1	135467526	185690396	1 - by flanking markers	1	142390027	204941832	1 - by flanking markers	1	141429089	197963072	1 - by flanking markers	1	133634986	181133270	1 - by flanking markers	RRID:RGD_2307161	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307166	SHRSP.SHRSR-(<i>Klk1-Mt1-ps1</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Mt1-ps1|Klk1c12	3118|1303192	1	94355758	185690396	1 - by flanking markers	1	100371040	204941832	1 - by flanking markers	1	99298965	197963072	1 - by flanking markers	1	94378103	181133270	1 - by flanking markers	RRID:RGD_2307166	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307167	SHRSP.SHRSR-(<i>Klk1-D1Mit3</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Klk1c12	1303192	1	94355758	146971983	1 - by flanking markers	1	100371040	162692800	1 - by flanking markers	1	99298965	156446783	1 - by flanking markers	1	94378103	144267916	1 - by flanking markers	RRID:RGD_2307167	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307168	SHRSR/Bbb	Spontaneously Hypertensive Rat, Stroke Resistant	Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		inbred	Unknown																				RRID:RGD_2307168	This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany.
2307169	SHRSP.SHRSR-(<i>D1Rat134-Mt1-ps1</i>)/Bbb		Max-Delbruck-Center for Molecular Medicine, Berlin, Germany		congenic	Unknown		Mt1-ps1	3118	1	135467526	185690396	1 - by flanking markers	1	142390027	204941832	1 - by flanking markers	1	141429089	197963072	1 - by flanking markers	1	133634986	181133270	1 - by flanking markers	RRID:RGD_2307169	SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest
2307298	BN/HanKini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		inbred	Unknown																				RRID:RGD_2307298	Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany)
2307299	ACI/ZtmKini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		inbred	Unknown																				RRID:RGD_2307299	substrain of ACI derived from ACI/Ztm
2307300	LEW.1AV1/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown																				RRID:RGD_2307300	Substrain of LEW.1AV1
2307301	DA.LEW.RT1f-(<i>D20Wox15-D20Wox13</i>)/Rhd		Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden		congenic	Unknown				20	2790524	6695696	1 - by flanking markers	20	5249993	10234922	1 - by flanking markers	20	3151827	8034632	1 - by flanking markers	20	2646407	6515143	1 - by flanking markers	RRID:RGD_2307301	RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers
2307317	MHS	Milan Hypertensive Strain	Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy		outbred	Unknown																				RRID:RGD_2307317	Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure
2307318	BDIX/Ifz		Duisburg-Essen University Medical School, Essen, Germany		inbred	Unknown																				RRID:RGD_2307318	derived from Berlin-Druckrey strain BDIX
2307319	MNS/N	Milan normotensive strain	<a href=http://www.rrrc.us/Strain/?x=171>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=171>Rat Resource and Research Center</a>	inbred	Cryopreserved Embryo																				RRID:RRRC_00171	Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.
2307355	PXO3-1/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307355	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307356	PXO2/Cub		Charles University, Department of Biology, Prague, Czech Republic		recombinant_inbred	Unknown																				RRID:RGD_2307356	Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.
2307357	BDV/Ztm		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		inbred	Unknown																				RRID:RGD_2307357	Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles.
2307358	LUDW/OlaHsd	Ludwig	<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ludw-inbred-rat/> Envigo</a>	<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ludw-inbred-rat/> Envigo</a>	inbred	Cryorecovery																				RRID:RGD_2307358	Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979.
2307359	BUF/SimRijHsd			Harlan Sprague Dawley, Inc., Indianapolis, IN	inbred	Unknown																				RRID:RGD_2307359	Developed by Heston in 1946 from a Buffalo
2307360	DA.BI.RT1i-(<i>D20Rat42-D20Rat31</i>)/Rhd		Section for Medical Inflammation Research, Lund University, Lund, Sweden.		congenic	Unknown				20	4582054	10410227	1 - by flanking markers	20	6265460	12972703	1 - by flanking markers	20	4186104	10800530	1 - by flanking markers	20	4459698	10078919	1 - by flanking markers	RRID:RGD_2307360	RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han.
2307441	F344-<i>Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=452>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup>	2307440	11	25036792	25157304	7	11	28591553	28702298	7	11	24967936	25078740	7	11	24557620	24664007	7	RRID:RRRC_00452	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene.
2307442	F344-<i>Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=451>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup>	2307439	11	10784947	11720646	7	11	13314508	13808775	7	11	9079291	10146302	7	11	10580863	11621675	7	RRID:RRRC_00451	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene.
2308816	Crl:WI(Han)		<a href=https://www.criver.com/products-services/find-model/wistar-han-igs-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/wistar-han-igs-rat?region=3611> Charles River Laboratories</a>	outbred	Unknown																				RRID:RGD_2308816	Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system.
2308851	Crl:OP(CD)	Obese Prone Rats	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	outbred	Unknown																				RRID:RGD_2308851	Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD).
2308852	Crl:LE	Long-Evans Rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2308852	Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978.
2308853	Crl:OR(CD)	Obese Resistant Rats	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	outbred	Unknown																				RRID:RGD_2308853	Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets.
2308885	GK/CskCrljCrl		<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_2308885	The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006.
2308886	SS/HsdMcwiCrl		<a href=https://www.criver.com/products-services/find-model/dahlsalt-sensitive-rat?region=3611> Charles River Laboratories</a>	<a href=https://www.criver.com/products-services/find-model/dahlsalt-sensitive-rat?region=3611> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_2308886	Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001.
2311049	SHROB/KolGmiCrl-<i>Lepr<sup>cp</i></sup>/Crl		<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	coisogenic	Unknown		Lepr<sup>cp</sup>	11570565																	RRID:RGD_2311049	This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001.
2311051	SHRSP/A3NCrl	Stroke Prone Rats	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_2311051	The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002.
2311070	BUF/CrCrl	Buffalo Rat	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2311070	Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).
2311071	ZDF-<i>Lepr<sup>fa</sup></i>/Crl		<a href=https://www.criver.com/products-services/find-model/zdf-rat-obese?region=3611>Charles River Laboratories </a>	<a href=https://www.criver.com/products-services/find-model/zdf-rat-obese?region=3611>Charles River Laboratories </a>	coisogenic	Unknown		Lepr	3001																	RRID:RGD_2311071	A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001.
2311072	FHH/EurMcwiCrl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2311072	An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001.
2311073	NBL/CrCrl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2311073	Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998.
2311074	BDIX/CrCrl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2311074	Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).
2311078	Crl:CD-<i>Hr<sup>hr</i></sup>	CD hairless rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2311078	This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic.
2311079	WF/CrCrl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2311079	J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).
2311082	SS-Chr 13<sup>BN</sup>/McwiCrl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	consomic	Unknown																				RRID:RGD_2311082	Developed at the Medical College of Wisconsin. To Charles River in 2003.
2311692	F344-<i>Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=478>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup>	2311691	10	68720729	68997721	7	10	67520649	67811744	7	10	67866939	68142864	7	10	65489153	65765812	7	RRID:RRRC_00478	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene.
2311693	F344-<i>Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup></i>		PhysGen, Transposagen		mutant	Extinct (as of 2017-01-26)		Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup>	2311689	8	105416072	105443969	7	8	108269643	108297339	7	8	108854134	108881519	7	8	101085579	101113339	7	RRID:RGD_2311693	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene.
2311694	F344-<i>Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=484>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup>	2311687	7	117441099	117469873	7	7	120839737	120881869	7	7	120846166	120891738	7	7	111174362	111216513	7	RRID:RRRC_00484	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene.
2312352	LEW.1N		Zentralinstitut fur Versuchstierzucht, Hannover, Germany		congenic	Unknown																				RRID:RGD_2312352	These congenic rats carry the RTl<sup>n</sup> haplotype on the LEW strain genetic background.
2312447	SD-Tg(Pmp22)Kan		Max Planck Institute for Experimental Medicine, Gottingen, Germany		transgenic	Unknown		Pmp22	11125																	RRID:RGD_2312447	This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library
2312466	Crl:LIS	Lister Hooded Rat	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312466	These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance.
2312471	Crl:ZUC(Orl)-<i>Lepr</i><sup>fa</sup>		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown		Lepr<sup>fa</sup>	13432153																	RRID:RGD_2312471	The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991.
2312472	Crl:WI(WU)	Wistar Wu Rat	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312472	Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987.
2312473	BDIX/OrlCrl	BDIX Rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2312473	Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991.
2312474	Crl:OFA(SD)		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312474	The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968.
2312498	WAG/RijCrl	WAG Rats	<a href=https://www.criver.com/products-services/find-model/wag-rat?region=3611>Charles River Laboratories </a>	<a href=https://www.criver.com/products-services/find-model/wag-rat?region=3611>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2312498	A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993.
2312499	Crl:NIH-<i>Foxn1</i><sup>rnu</sup>	Nude Rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312499	The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs.
2312504	Crlj:WI		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312504	Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981)
2312511	WF/IcoCrl	Wistar Rats	<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	inbred	Unknown																				RRID:RGD_2312511	Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970.
2312512	ZSF1-<i>Lepr<sup>fa</sup></i>, <i>Lepr<sup>cp</sup></i>/Crl		Genetic Models International, Indianapolis.	<a href=https://www.criver.com/products-services/find-model/zsf1-rat?region=3611>Charles River Laboratories </a>, <a href=https://www.criver.com/products-services/find-model/zsf1-rat-lean?region=3611>Charles River Laboratories </a>	hybrid	Unknown																				RRID:RGD_2312512	This F1 model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp), the lean female ZDF rat (+/fa) and the lean male SHHF rat (+/facp) ( RGD:401901201). Offspringcarring both mutations (fa:facp) are obese and develop insulin resistance, hyperglycaemia, and mild hypertension (ZSF1 obese). The heterozygous or wild type offspring (ZSF1 lean) are lean and exhibit no signs of obesity and diabetes. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. The progeny that are heterozygous for leptin receptor or wild type are lean and are used as control for the obese counter part.
2312513	Crlj:DON		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312513	Dr. Sato(1952) to Nippon Rat to CRLJ(1990)
2312514	Crlj:LEC		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown																				RRID:RGD_2312514	Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991).
2312518	Crlj:ZUC-<i>Lepr</i><sup>fa</sup>		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	outbred	Unknown		Lepr<sup>fa</sup>	13432153																	RRID:RGD_2312518	Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000)
2312577	SHR.BN-(<i>D18Rat99-D18Rat82</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				18	31654683	73666623	1 - by flanking markers	18	32165265	72695235	1 - by flanking markers	18	32487692	73016546	1 - by flanking markers	18	30558524	70263868	1 - by flanking markers	RRID:RGD_2312577	F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity
2312578	SHR.BN-(<i>D18Rat82</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				18	73666205	73666623	1 - by flanking markers	18	72695068	72695235	1 - by flanking markers	18	73016379	73016546	1 - by flanking markers	18	70263698	70263868	1 - by flanking markers	RRID:RGD_2312578	F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity
2312579	SHR.BN-(<i>D18Rat40-D18Rat82</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				18	62106066	73666623	1 - by flanking markers	18	60695794	72695235	1 - by flanking markers	18	61499531	73016546	1 - by flanking markers	18	59330409	70263868	1 - by flanking markers	RRID:RGD_2312579	F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity
2312580	SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv		Czech Academy of Sciences, Prague, Czech Republic		congenic	Unknown				18	73666205	73666623	1 - by flanking markers	18	72695068	72695235	1 - by flanking markers	18	3719547	73016546	1 - by flanking markers	18	70263698	70263868	1 - by flanking markers	RRID:RGD_2312580	SHR/OlaIpcv were crossed with BN/Crl, F<sub>1</sub> animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes
2312609	MWF-Chr 8<sup>SHR</sup>/Rkb		Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany		consomic	Unknown																				RRID:RGD_2312609	MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing
2312644	DA.WOKW-(<i>D3Mit10-D3Rat189</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				3	35797577	35797756	1 - by flanking markers	3	44863125	44863303	1 - by flanking markers	3	39773247	39773425	1 - by flanking markers	3	38710365	38710544	1 - by flanking markers	RRID:RGD_2312644	A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background
2312645	DA.WOKW-(<i>D16Rat88-D16Wox7</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				16	819225	63306215	1 - by flanking markers	16	1534408	62873174	1 - by flanking markers	16	1550187	63210301	1 - by flanking markers	16	832236	59492508	1 - by flanking markers	RRID:RGD_2312645	A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background
2312646	DA.WOKW-(<i>D5Mgh6-D5Mit5</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				5	71814715	109163425	1 - by flanking markers	5	75334610	112058005	1 - by flanking markers	5	71154828	108092802	1 - by flanking markers	5	68984307	104251008	1 - by flanking markers	RRID:RGD_2312646	A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background
2312647	DA.WOKW-(<i>D3Mgh5-D3Rat1</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				3	97523869	170016653	1 - by flanking markers	3	109733850	180128021	1 - by flanking markers	3	103141814	176418101	1 - by flanking markers	3	98535255	168026850	1 - by flanking markers	RRID:RGD_2312647	A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background
2312648	DA.WOKW-(<i>D10Mgh2-D10Rat4</i>)/K		Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany		congenic	Unknown				10	106422174	107033716	1 - by flanking markers	10	105533457	105533612	1 - by flanking markers	10	105875105	105875260	1 - by flanking markers	10	102134116	102134272	1 - by flanking markers	RRID:RGD_2312648	A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background
2312733	BN-Chr 13<sup>SS</sup> Chr 18<sup>SS</sup>/Mcwi		PhysGen		consomic	Cryopreserved Sperm																				RRID:RGD_2312733	A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed
2313181	LEW.1WR1/WorBrm		<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>	congenic	Unknown																				RRID:RGD_2313181	Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc.
2313209	WF.ART2/Wor		Universtiy of Massachusetts, Worcester, MA		congenic	Unknown																				RRID:RGD_2313209	developed at the Universtiy of Massachusetts, Medical School
2313221	SHHF-<i>Lepr<sup>cp</i></sup>/Crl		<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	congenic	Unknown		Lepr<sup>cp</sup>	11570565																	RRID:RGD_2313221	Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001.
2313222	BN/HsdMcwiCrl		<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>	inbred	Unknown																				RRID:RGD_2313222	BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River
2313231	LEWBNF1/Crl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	hybrid	Unknown																				RRID:RGD_2313231	This hybrid rat is a cross between a LEW female and a BN male rat.
2313232	WFF344F1/Crl		<a href=http://www.criver.com/>Charles River Laboratories </a>	<a href=http://www.criver.com/>Charles River Laboratories </a>	hybrid	Unknown																				RRID:RGD_2313232	This hybrid rat is a cross between a WF female and a F344 male rat.
2313342	BN-Chr 17<sup>LH</sup>/Mav		Laboratoire de Physiologie, Lyon Cedex , France		consomic	Unknown																				RRID:RGD_2313342	Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped
2313343	LH-Chr 13<sup>BN</sup>/Mav		Laboratoire de Physiologie, Lyon Cedex , France		consomic	Unknown																				RRID:RGD_2313343	Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped
2313384	Wild/Nov		Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia		wild	Unknown																				RRID:RGD_2313384	These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia
2313463	F344-<i>Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=474>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup>	2313459	7	45140154	45616620	7	7	48563521	49058116	7	7	48548932	49045852	7	7	41765716	42240104	7	RRID:RRRC_00474	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene.
2313464	F344-<i>Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup></i>		PhysGen, Transposagen		mutant	Extinct (as of 2017-01-26)		Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup>	2313460	19	12043818	12497663	7	19	23595328	24054765	7	19	12481563	12945320	7	19	11603129	12048930	7	RRID:RGD_2313464	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene.
2313465	F344-<i>Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=483>Rat Resource and Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup>	2313462	13	91715000	92058036	7	13	98486317	98812030	7	13	94025696	94355219	7	13	87895694	88232868	7	RRID:RRRC_00483	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene.
2313466	F344-<i>Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup></i>		PhysGen, Transposagen	<a href=http://www.rrrc.us/Strain/?x=473>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup>	2313461					5	134582789	135484937	7	5	130742297	131656581	7	5	125254963	126534367	7	RRID:RRRC_00473	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene.
2313588	SD-Tg(Ins2-IAPP)Soel		Pfizer, Inc, Groton, Connecticut		transgenic	Unknown																				RRID:RGD_2313588	Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter
2313693	SHR-Tg(PEPCK-SREBF1)2Ipcv		Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic		transgenic	Unknown		SREBF1	69473																	RRID:RGD_2313693	SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal
2313734	SD-Tg(H1/tetO-RNAi:Insr)29Bdr		Max-Delbruck Center for Molecular Medicine, Berlin, Germany		transgenic	Unknown																				RRID:RGD_2313734	Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter
2313735	SD-Tg(H1/tetO-RNAi:Insr)14Bdr		Max-Delbruck Center for Molecular Medicine, Berlin, Germany		transgenic	Unknown																				RRID:RGD_2313735	Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter
2313922	F344-Tg(Cyp1a1-Ren2)10.LEW-(<i>D10Rat142-D10Rat15</i>)/Jmul		Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK		congenic	Unknown				10	92448353	96667338	1 - by flanking markers	10	91113514	95243104	1 - by flanking markers	10	91345679	95508221	1 - by flanking markers	10	88207600	92238497	1 - by flanking markers	RRID:RGD_2313922	F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome.
2313923	LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(<i>D10Rat99-D10Rat11</i>)/Jmul		Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK		congenic	Unknown				10	89278229	100633982	1 - by flanking markers	10	88043769	99184250	1 - by flanking markers	10	88250522	99492409	1 - by flanking markers	10	85269536	96121100	1 - by flanking markers	RRID:RGD_2313923	F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome.
2313924	LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/Jmul		Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK		consomic	Unknown																				RRID:RGD_2313924	F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers
2314001	N:HS	Heterogeneous stock	Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain		outbred	Unknown																				RRID:RGD_2314001	Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin
2314009	NMcwi:HS	Heterogeneous stock	Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin		outbred	Unknown																				RRID:RGD_2314009	25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc.
2314027	SDT.Cg-<i>Lepr<sup>fa</sup></i>/Jtt	SDT fatty	Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan		congenic	Unknown																				RRID:RGD_2314027	<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic method
2314161	F344-<i>Kuru1</i>/Kyo	Kuru1	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=720> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=720> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314161	A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314162	F344-<i>Oune</i>/Kyo	Oune	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=718> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=718> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Sperm		Tbx6	1307716																	RRID:RGD_2314162	A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314163	F344-<i>Kcna1<sup>Adms</sup></i>/Kyo	ADMS (autosomal dominant myokymia and seizures) rat	The University of Tokyo, The Institute of Medical Science	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=724> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Sperm (as of 2017-05-04)		Kcna1<sup>Adms</sup>	12880383	4	163011777	163013522	7	4	226188851	226190596	7	4	159190781	159192526	7	4	159464223	159472905	7	RRID:RGD_2314163	This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model.
2314164	F344-<i>Kuru2</i>/Kyo	Kuru2	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=721> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=721> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314164	A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314165	ACI-<i>Chib</i>/Kyo	Chibi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=717> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=717> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Dermatology																			RRID:RGD_2314165	This strain was established by phenotype-driven ENU mutagenesis.
2314166	F344-<i>Tbr2</i>/Kyo	Tsubura2	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=723> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=723> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314166	A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314167	F344-<i>Kmch</i>/Kyo	Komachi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=719> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=719> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Sperm																				RRID:RGD_2314167	This strain was established by phenotype-driven ENU mutagenesis.
2314168	F344-<i>Tbr1</i>/Kyo	Tsubura1	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=722> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=722> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314168	A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314169	WTC.F344-<i>Scn1a<sup>m1Kyo</sup></i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=754> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=754> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm (as of 2024-04-16)		Scn1a<sup>m1Kyo</sup>	12792283																	RRID:RGD_2314169	This congenic strain was established by backcrossing F344-<i>Scn1a<sup>m1Kyo</sup></i> onto WTC/Kyo.
2314170	F344-<i>Egr<sup>m1Kyo</i></sup>	EGR (Excessive Grooming Rat), Kaikai, Kyo1897	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=725> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=725> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314170	This strain was established by phenotype-driven ENU mutagenesis.
2314224	F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=910> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=910> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			1	255026793	267111153	1 - by flanking markers	1	276721459	289137268	1 - by flanking markers	1	269279863	281795785	1 - by flanking markers	1	248393012	259647894	1 - by flanking markers	RRID:RGD_2314224	Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.
2314225	F344-Chr 15<sup>OLETF</sup>/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=914> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=914> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_2314225	Developed by the depositor
2314226	WI-Tg(WSCD2)3Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=881> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=881> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm		WSCD2	1605710																	RRID:RGD_2314226	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314227	WI-Tg(WSCD2)4Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=882> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=882> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm		WSCD2	1605710																	RRID:RGD_2314227	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314228	WI-Tg(WSCD2)5Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=883> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=883> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm		WSCD2	1605710																	RRID:RGD_2314228	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314229	F344.OLETF-(<i>D7Uwm22-D7Mgh20</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=916> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=916> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			7	123733466	123733601	1 - by flanking markers	7	126334525	126334660	1 - by flanking markers	7	126622888	126623023	1 - by flanking markers	7	116836447	116836583	1 - by flanking markers	RRID:RGD_2314229	Developed by the DEPOSITOR
2314230	F344-<i>Hr<sup>krh</i></sup>/Kyo	Hairless Kyoto, Hanako	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=757> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=757> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Dermatology; Urology																			RRID:RGD_2314230	A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).
2314231	F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/2Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=911> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=911> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			5	45499364	115361927	1 - by flanking markers	5	49028773	117961491	1 - by flanking markers	5	44404276	114014945	1 - by flanking markers	5	43726656	109897936	1 - by flanking markers	RRID:RGD_2314231	Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.
2314232	WI-Tg(WSCD2)1Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=880> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=880> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm		WSCD2	1605710																	RRID:RGD_2314232	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314243	SHR.WKY-(<i>D1Mgh2-D1Wox10</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=907> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=907> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Cardio Hypertension			1	22842898	220639653	1 - by flanking markers	1	24875821	244066407	1 - by flanking markers	1	23406428	236763528	1 - by flanking markers	1	22340647	214537671	1 - by flanking markers	RRID:RGD_2314243	Developed by the depositor
2314244	BCR/Nn		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=887> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=887> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Neurobiology																			RRID:RGD_2314244	In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene).
2314245	WI-Tg(WSCD2)6Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=884> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=884> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm		WSCD2	1605710																	RRID:RGD_2314245	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314246	SHRSP.WKY-(<i>D1Rat117-D1Rat90</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=906> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=906> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Cardio Hypertension			1	219629755	267111153	1 - by flanking markers	1	240604381	289137268	1 - by flanking markers	1	233490105	281795785	1 - by flanking markers	1	213533809	259647894	1 - by flanking markers	RRID:RGD_2314246	Developed by the Depositor
2314247	WI-Tg(Prl-EGFP)Yamp		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=904> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=904> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Metabolism; Development																			RRID:RGD_2314247	A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats
2314313	NER.F344-(<i>D5Rat100-D5Rat234</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=893> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=893> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Neurobiology			5	68843563	68843964	1 - by flanking markers	5	70180341	70180484	1 - by flanking markers	5	65696672	65696815	1 - by flanking markers	5	66174080	66174226	1 - by flanking markers	RRID:RGD_2314313	The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.
2314314	NER.F344-(<i>D1Mgh6-D1Rat132</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=892> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=892> National BioResource Project for the Rat in Japan</a>	congenic	Unknown	Neurobiology			1	87656636	165996388	1 - by flanking markers	1	92524380	179788206	1 - by flanking markers	1	91394009	172789257	1 - by flanking markers	1	87790149	162457491	1 - by flanking markers	RRID:RGD_2314314	The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.
2314315	F344.NER-(<i>D5Mgh4-D5Rat36</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=891> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=891> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Neurobiology			5	145186817	145187034	1 - by flanking markers	5	147610023	147610238	1 - by flanking markers	5	143846157	143846372	1 - by flanking markers	5	138113556	138113774	1 - by flanking markers	RRID:RGD_2314315	The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.
2314316	F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=890> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=890> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Neurobiology			1	87656636	224420760	1 - by flanking markers	1	92524380	246113473	1 - by flanking markers	1	91394009	238824901	1 - by flanking markers	1	87790149	218748178	1 - by flanking markers	RRID:RGD_2314316	The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.
2314317	WTC.GRY-<i>Cacna1a<sup>gry</sup></i>/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=894> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=894> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm (as of 2017-05-04)	Neurobiology	Cacna1a|Cacna1a<sup>gry</sup>	2244|12880382																	RRID:RGD_2314317	Developed by the depositor
2314339	F344-<i>Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup></i>		PhysGen	<a href=http://www.rrrc.us/Strain/?x=480>Rat Resource & Research Center</a>	mutant	Cryopreserved Sperm (as of 2017-01-26)		Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup>	2314335	5	118806744	119131114	7	5	120981525	121281044	7	5	117038548	117340308	7	5	113061985	113364807	7	RRID:RRRC_00480	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene.
2314340	F344-<i>Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2016-10-24)		Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup>	2314337	3	115365279	115687566	7	3	126606586	126919666	7	3	120414311	120724809	7	3	115061069	115367032	7	RRID:RGD_2314340	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene.
2314341	F344-<i>Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2016-10-24)		Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup>	2314338	12	25518248	25541023	7									12	24104187	25194123	7	RRID:RGD_2314341	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene.
2314342	F344-<i>Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup></i>		PhysGen		mutant	Extinct (as of 2017-01-26)		Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup>	2314336	16	31144028	31144544	7	16	31198863	31240064	7	16	31349140	31390340	7	16	27981315	28143129	7	RRID:RGD_2314342	These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene.
2314360	ACI.F344-(<i>D16Mit5-D16Nkg27</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=871> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=871> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cancer																			RRID:RGD_2314360	This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals.
2314361	W-Tg(Slc32a1-YFP*)1Yyan		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=905> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=905> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Sperm	Neurobiology; Development																			RRID:RGD_2314361	This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.
2314362	F344-<i>Hrdk</i>/Kyo	Hairless dominant Kyoto	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=899> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=899> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm																				RRID:RGD_2314362	Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven).
2314363	W-Tg(Slc32a1-YFP*)2Yyan		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=908> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=908> National BioResource Project for the Rat in Japan</a>	transgenic	Live Animals; Cryopreserved Sperm	Neurobiology; Development																			RRID:RGD_2314363	This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.
2314364	ACI.F344-(<i>D16Nkg112-D16Nkg27</i>)/Nkg		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=902> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=902> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cancer																			RRID:RGD_2314364	This congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals.
2314365	KFRS2/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=901> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=901> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Ophthalmology; Dermatology	Tyr|Tyr<sup>siaKyo</sup>	1589755|13207345	1	143641257	143746315	7	1	157322968	157416594	7	1	151012598	151106802	7	1	141115036	141210207	7	RRID:RGD_2314365	A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.
2314368	F344-<i>Kcnn2<sup>Trdk</sup></i>/Kyo	Tremor dominant Kyoto	The University of Tokyo, The Institute of Medical Science	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=898> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm (as of 2021-07-15)	Neurobiology	Kcnn2<sup>Trdk</sup>	149735330	18	39560962	39705037	7	18	38822146	38864110	7	18	39331894	39479574	7	18	37817966	38258347	7	RRID:RGD_2314368	Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2.
2314375	LE.AR-<i>Ednrb<sup>sl</i></sup>/Okkm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=823> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=823> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo (as of 2017-03-28)	Internal Organ	Ednrb|Ednrb<sup>sl</sup>	2536|10755424	15	87893141	87898700	7	15	91500400	91531979	7	15	88034987	88035287	8	15	80670748	80671048	8	RRID:RGD_2314375	AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).
2314376	KFRS4/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=919> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=919> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals; Cryopreserved Embryo (as of 2021-10-05)	Ophthalmology; Dermatology																			RRID:RGD_2314376	A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14.
2314377	KFRS3B/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=918> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=918> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Ophthalmology; Dermatology																			RRID:RGD_2314377	A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding.
2314378	AR-<i>Ednrb<sup>sl</i></sup>/Okkm	Aganglionosis rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=822> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=822> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo (as of 2016-10-31)	Internal Organ	Ednrb|Ednrb<sup>sl</sup>	2536|10755424	15	87893141	87898700	7	15	91500400	91531979	7	15	88034987	88035287	8	15	80670748	80671048	8	RRID:RGD_2314378	Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR)
2314379	KFRS6/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=921> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=921> National BioResource Project for the Rat in Japan</a>	mutant	Live Animals	Dermatology																			RRID:RGD_2314379	A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo.
2314380	SD-Tg(CAG-lacZ)541Htsu		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=903> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=903> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm																				RRID:RGD_2314380	Developed by the depositor
2314381	KFRS5A/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=920> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=920> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Dermatology	Krt71<sup>Rex</sup>	11570416					7	141143396	141166531	7	7	143345201	143371346	7	7	132873532	132898975	7	RRID:RGD_2314381	A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo.
2314382	SD-Tg(CAG-HRAS*G12V)250Htsu		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=790> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=790> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Cancer	HRAS	730881																	RRID:RGD_2314382	This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter
2314383	KFRS3A/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=917> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=917> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm	Ophthalmology; Dermatology																			RRID:RGD_2314383	A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.
2314396	LCR/Mco	Low-capacity runners	Medical College of Ohio, Toledo, Ohio, USA		inbred	Unknown																				RRID:RGD_2314396	Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.
2314397	HCR/Mco	High-capacity runners	Medical College of Ohio, Toledo, Ohio, USA		inbred	Unknown																				RRID:RGD_2314397	Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.
2314414	LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb		Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany		transgenic	Unknown		Insr	2917																	RRID:RGD_2314414	LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter
2314415	LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb		Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany		transgenic	Unknown		Insr	2917																	RRID:RGD_2314415	LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter
2314477	LEW-<i>RT1<sup>DA</i></sup>/Rrrc		<a href=http://www.rrrc.us/Strain/?x=391>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=391>Rat Resource and Research Center</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00391	Sprague-Dawley RT1<sup>u</sup> haplotype backcrossed onto Lewis inbred strain.
2314478	LEW-<i>RT1.B<sup>m1Trg</i></sup>/Rrrc	RT1.B	<a href=http://www.rrrc.us/Strain/?x=392>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=392>Rat Resource and Research Center</a>	mutant	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RRRC_00392	ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain.
2314492	SBN.SBH-(<i>D1Rat148-D1Rat89</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	16325337	265343617	1 - by flanking markers	1	18951160	287349830	1 - by flanking markers	1	16470664	279986079	1 - by flanking markers	1	15760582	257976495	1 - by flanking markers	RRID:RGD_2314492	Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl
2314493	SBH.SBN-(<i>D1Mgh2-D1Rat74</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	22842898	227005733	1 - by flanking markers	1	24875821	248763894	1 - by flanking markers	1	23406428	241482368	1 - by flanking markers	1	22340647	221264292	1 - by flanking markers	RRID:RGD_2314493	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl
2314494	SBH.SBN-(<i>D1Rat137-D1Rat123</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	90306033	223729371	1 - by flanking markers	1	95325941	245519018	1 - by flanking markers	1	94225372	238220385	1 - by flanking markers	1	90532338	218108781	1 - by flanking markers	RRID:RGD_2314494	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl
2314495	SBN.SBH-(<i>D1Rat27-D1Mit7</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	90282040	240980321	1 - by flanking markers	1	95301716	262617374	1 - by flanking markers	1	94201400	94201552	1 - by flanking markers	1	90508614	90508767	1 - by flanking markers	RRID:RGD_2314495	Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl
2314496	SBH.SBN-(<i>D1Mgh2-D1Mgh11</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	22842898	22843363	1 - by flanking markers	1	24875821	24875970	1 - by flanking markers	1	23406428	23406577	1 - by flanking markers	1	22340647	22340797	1 - by flanking markers	RRID:RGD_2314496	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl
2314497	SBN.SBH-(<i>D1Rat101-D1Rat74</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	97174943	227005733	1 - by flanking markers	1	103735751	248763894	1 - by flanking markers	1	102658741	241482368	1 - by flanking markers	1	97146283	221264292	1 - by flanking markers	RRID:RGD_2314497	Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl
2314498	SBH.SBN-(<i>D1Rat137-D1Rat83</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	90306033	252133935	1 - by flanking markers	1	95325941	274017147	1 - by flanking markers	1	94225372	266587220	1 - by flanking markers	1	90532338	245701099	1 - by flanking markers	RRID:RGD_2314498	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl
2314499	SBN.SBH-(<i>D1Mgh17-D1Mgh14</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	9082836	263699089	1 - by flanking markers	1	10007292	285604895	1 - by flanking markers	1	8387052	278228889	1 - by flanking markers	1	8606496	256448636	1 - by flanking markers	RRID:RGD_2314499	Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl
2314500	SBH.SBN-(<i>D1Mgh2-D1Rat101</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	22842898	97175101	1 - by flanking markers	1	24875821	103735908	1 - by flanking markers	1	23406428	102658898	1 - by flanking markers	1	22340647	97146439	1 - by flanking markers	RRID:RGD_2314500	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl
2314501	SBH.SBN-(<i>D1Wox11-D1Rat137</i>)/Ygl		Ben Gurion University Barzilai Medical Center, Ashkelon, Israel		congenic	Unknown				1	64145811	90306478	1 - by flanking markers	1	63399232	95326185	1 - by flanking markers	1	64407177	94225616	1 - by flanking markers	1	65832929	90532583	1 - by flanking markers	RRID:RGD_2314501	Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl
2314530	SS.SHR-(<i>D8Uia1-D8Rat90</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				8	19055857	114974688	1 - by flanking markers	8	20954930	118204000	1 - by flanking markers	8	118862625	118862813	1 - by flanking markers	8	110572032	110572221	1 - by flanking markers	RRID:RGD_2314530	SS/Jr females were bred with SHR/NHsd males and their female F<sub>1</sub> were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers
2314531	SHR.SS-(<i>D13Rat1-D13Mgh6</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				13	10555730	101704301	1 - by flanking markers	13	29679984	108279142	1 - by flanking markers	13	24501968	103613733	1 - by flanking markers	13	20605555	97213863	1 - by flanking markers	RRID:RGD_2314531	SS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers
2314532	SHR.SS-(<i>D8Uia1-D8Rat90</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown				8	19055857	114974688	1 - by flanking markers	8	20954930	118204000	1 - by flanking markers	8	118862625	118862813	1 - by flanking markers	8	110572032	110572221	1 - by flanking markers	RRID:RGD_2314532	SS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers
2314655	BRAT-<i>Avp<sup>di</i></sup>/BluHsd	Brattleboro		Harlan	mutant	Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)		Avp<sup>di</sup>	13627261	3	118205007	118206985	7	3	129615610	129627147	7	3	123117482	123119460	7	3	117793447	117805091	7	RRID:RGD_2314655	Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988.
2314861	WAG/RijYcb		<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>	<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>	inbred	Unknown																				RRID:RGD_2314861	Substrain of WAG/Rij; from Netherlands to Yale University.
2314904	WAG-<i>F8<sup>m1Ycb</sup></i>		<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>	<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>	mutant	Unknown		F8<i><sup>m1Ycb</sup></i>	2314903	18	121134	162008	7	18	413447	444491	7	18	394478	394478	8	18	145719	145719	8	RRID:RGD_2314904	This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline.
2314928	Slc:W	Slc: Wistar	<a href=http://www.labanimal.co.kr/product/slc03.html> SLC, Japan</a>	<a href=http://www.labanimal.co.kr/product/slc03.html> SLC, Japan</a>	outbred	Unknown																				RRID:RGD_2314928	Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain.
2314934	WST.F344-<i>Ker</i>/Kyo	Wistar/ST-Boo	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=755> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=755> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2314934	This congenic strain was established by backcrossing F344-<i>Ker</i>/Kyo (NBRP No.0458) onto Slc:WST
2314935	WST.F344-<i>Kmch</i>/Kyo	Wistar/ST-Komachi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=756> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=756> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm																				RRID:RGD_2314935	This congenic strain was established by backcrossing F344-<i>Kmch</i>/Kyo (NBRP No.0458) onto Slc:WST.
2314936	WI-Tg(WSCD2)Tkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=874> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=874> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm (as of 2017-08-24)																				RRID:RGD_2314936	A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.
2314937	F344.OLETF-(<i>D5Mgh20-D5Mgh22</i>)/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=915> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=915> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo	Diabetes Obesity			5	140925168	157584492	1 - by flanking markers	5	143051962	160953783	1 - by flanking markers	5	139267814	157212422	1 - by flanking markers	5	133916727	151006154	1 - by flanking markers	RRID:RGD_2314937	Developed by the depositor
2316631	F344.GK-(<i>D1Swe8-D1Gpam-1</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown		Adra2a|Pdcd4|Shoc2	2056|620816|1308146	1	259866528	259866737	1 - by flanking markers	1	281763458	281763667	1 - by flanking markers	1	274353782	274353991	1 - by flanking markers	1	252645447	252645657	1 - by flanking markers	RRID:RGD_2316631	This sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe
2316632	NEDH/KSim	New England Deaconess Hospital	<a href=http://www.simlab.com/>Simonsen Laboratories</a>	<a href=http://www.simlab.com/>Simonsen Laboratories</a>	inbred	Unknown																				RRID:RGD_2316632	Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman
2316633	F344.GK-(<i>D1Got251-D1Gpam-1</i>)/Swe		Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	260641680	260641846	1 - by flanking markers	1	282550224	282550389	1 - by flanking markers	1	275138749	275138914	1 - by flanking markers	1	253439653	253439819	1 - by flanking markers	RRID:RGD_2316633	This sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe
2316653	SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1;17	38394289;2374083	38394434;2374266	1 - by flanking markers;1 - by flanking markers	1	36290530	45656739	1 - by flanking markers	1	34888392	44326906	1 - by flanking markers	1	32249735	44011366	1 - by flanking markers	RRID:RGD_2316653	A sub-congenic strain derived from SS.LEW-(<i>D1Uia8-D1Rat18<i>)/Mco contributing to the introgressed LEW allele
2316654	SS.LEW-(<i>D1Mco102-D1Mco129</i>)/1Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				17	2374083	3178843	1 - by flanking markers	1	36290530	37078065	1 - by flanking markers	1	34888392	35680732	1 - by flanking markers	1	32249735	33038814	1 - by flanking markers	RRID:RGD_2316654	A sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2316655	SS.LEW-(<i>D1Mco102-D1Mco129</i>)/2Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				17	2374083	3178843	1 - by flanking markers	1	36290530	37078065	1 - by flanking markers	1	34888392	35680732	1 - by flanking markers	1	32249735	33038814	1 - by flanking markers	RRID:RGD_2316655	A sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region
2316925	SHR.BN-(<i>D3Rat159-D3Rat1</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				3	119437175	170016653	1 - by flanking markers	3	130776038	180128021	1 - by flanking markers	3	124284647	176418101	1 - by flanking markers	3	118950053	168026850	1 - by flanking markers	RRID:RGD_2316925	50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd
2316927	SHR.BN-(<i>D6Rat40-D6Rat170</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				6	1301952	46792623	1 - by flanking markers	6	1111498	56881356	1 - by flanking markers	6	1120393	48179481	1 - by flanking markers	6	16536243	45547114	1 - by flanking markers	RRID:RGD_2316927	45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd
2316928	SHR.BN-(<i>D3Rat159-D3Rat1</i>)(<i>D6Rat40-D6Rat170</i>)/Mco		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown																				RRID:RGD_2316928	this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele
2317196	DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>)		Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				8	73105403	91329867	1 - by flanking markers	8	76885501	93261060	1 - by flanking markers	8	74920991	93746162	1 - by flanking markers	8	69352596	87043114	1 - by flanking markers	RRID:RGD_2317196	Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest
2317197	DA.PVG.1AV1-(<i>D8Rat41-D8Rat24</i>)		Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				8	50354908	82247243	1 - by flanking markers	8	50240107	84140836	1 - by flanking markers	8	51633707	84569318	1 - by flanking markers	8	47627235	78138314	1 - by flanking markers	RRID:RGD_2317197	Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest
2317201	DA.PVG.1AV1-(<i>D8Rat24-D8Got145</i>)		Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				8	82246890	91329867	1 - by flanking markers	8	84140683	93261060	1 - by flanking markers	8	84569165	93746162	1 - by flanking markers	8	78138158	87043114	1 - by flanking markers	RRID:RGD_2317201	DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus
2317278	Taiep/Dun		Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin		mutant	Unknown																				RRID:RGD_2317278	These mutants were found in Sprague-Dawley rats at University of Puebla in 1989
2317590	DA.PVG.1AV1-(<i>D4Rat23-D4Rat108</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	58550170	82090355	1 - by flanking markers	4	58518376	148552304	1 - by flanking markers	4	83889402	83889539	1 - by flanking markers	4	82844048	82844186	1 - by flanking markers	RRID:RGD_2317590	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317595	DA.PVG.1AV1-(<i>D4Rat23-D4Mit12</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	58550170	104416171	1 - by flanking markers	4	58518376	163844298	1 - by flanking markers	4	99066972	99067150	1 - by flanking markers	4	103194805	103194984	1 - by flanking markers	RRID:RGD_2317595	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317596	DA.PVG.1AV1-(<i>D4Rat103-D4Mit12</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	82700691	104416171	1 - by flanking markers	4	149135946	163844298	1 - by flanking markers	4	84475257	99067150	1 - by flanking markers	4	83428419	103194984	1 - by flanking markers	RRID:RGD_2317596	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317598	DA.PVG.1AV1-(<i>D4Rat231-D4Mit12</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	88462327	104416171	1 - by flanking markers	4	154593964	163844298	1 - by flanking markers	4	89777552	99067150	1 - by flanking markers	4	88656681	103194984	1 - by flanking markers	RRID:RGD_2317598	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317599	DA.PVG.1AV1-(<i>D4Got211-D4Mit12</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	79604076	104416171	1 - by flanking markers	4	145804154	163844298	1 - by flanking markers	4	81136696	99067150	1 - by flanking markers	4	80445377	103194984	1 - by flanking markers	RRID:RGD_2317599	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317791	DA.PVG.1AV1-(<i>D4Got60-D4Kini1</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				4	80704779	81729771	1 - by flanking markers	4	147125280	148194009	1 - by flanking markers	4	83531021	83531176	1 - by flanking markers	4	82490359	82490515	1 - by flanking markers	RRID:RGD_2317791	Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini
2317812	AT.ANT-(<i>D1Uia12-D1Rat288</i>)/Rar		University of Colorado Denver, Colorado	<a href=http://www.rrrc.us/Strain/?x=728>Rat Resource and Research Center</a>	congenic	Cryopreserved Sperm (as of 2019-02-26)				1	134007903	192038535	1 - by flanking markers	1	140949643	211567839	1 - by flanking markers	1	139972085	139972231	1 - by flanking markers	1	132214399	132214546	1 - by flanking markers	RRID:RRRC_00728	F<sub>2</sub> males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested
2317813	AT.ANT-(<i>D1Rat234-D1Rat47</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	41225047	158511230	1 - by flanking markers	1	172296302	172296459	1 - by flanking markers	1	166100317	166100474	1 - by flanking markers	1	155422851	155423009	1 - by flanking markers	RRID:RGD_2317813	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317814	AT.ANT-(<i>D1Rat273-D1Rat158</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	140644473	153578547	1 - by flanking markers	1	147436666	167535765	1 - by flanking markers	1	146507930	161321256	1 - by flanking markers	1	138344856	150700247	1 - by flanking markers	RRID:RGD_2317814	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317815	AT.ANT-(<i>D1Rat35-D1Rat47</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	124748920	158511230	1 - by flanking markers	1	131958920	172296459	1 - by flanking markers	1	130917121	166100474	1 - by flanking markers	1	123479780	155423009	1 - by flanking markers	RRID:RGD_2317815	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317816	AT.ANT-(<i>D1Rat234-D1Rat158</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	41225047	153578547	1 - by flanking markers	1	167535661	167535765	1 - by flanking markers	1	161321152	161321256	1 - by flanking markers	1	150700142	150700247	1 - by flanking markers	RRID:RGD_2317816	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317817	AT.ANT-(<i>D1Rat183-D1Rat288</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	131123181	192038535	1 - by flanking markers	1	138077032	211567839	1 - by flanking markers	1	137083889	137084126	1 - by flanking markers	1	129384185	129384427	1 - by flanking markers	RRID:RGD_2317817	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT
2317818	AT.ANT-(<i>D1Rat273-D1Rat288</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	140644473	192038535	1 - by flanking markers	1	147436666	211567839	1 - by flanking markers	1	146507930	146508090	1 - by flanking markers	1	138344856	138345017	1 - by flanking markers	RRID:RGD_2317818	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT
2317819	AT.ANT-(<i>D1Rat35-D1Rat288</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	124748920	192038535	1 - by flanking markers	1	131958920	211567839	1 - by flanking markers	1	130917121	130917265	1 - by flanking markers	1	123479780	123479925	1 - by flanking markers	RRID:RGD_2317819	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT
2317820	AT.ANT-(<i>D1Rat158-D1Rat288</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	153578442	192038535	1 - by flanking markers	1	167535661	211567839	1 - by flanking markers	1	161321152	161321256	1 - by flanking markers	1	150700142	150700247	1 - by flanking markers	RRID:RGD_2317820	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT
2317822	AT.ANT-(<i>D1Rat35-D1Rat38</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	124748920	133567105	1 - by flanking markers	1	131958920	140507239	1 - by flanking markers	1	130917121	139524104	1 - by flanking markers	1	123479780	131763614	1 - by flanking markers	RRID:RGD_2317822	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317825	AT.ANT-(<i>D1Rat234-D1Rat35</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	41225047	124749065	1 - by flanking markers	1	131958920	131959064	1 - by flanking markers	1	130917121	130917265	1 - by flanking markers	1	123479780	123479925	1 - by flanking markers	RRID:RGD_2317825	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317827	AT.ANT-(<i>D1Rat234-D1Rat38</i>)/Rar		University of Colorado Denver, Colorado		congenic	Unknown				1	41225047	133567105	1 - by flanking markers	1	140507063	140507239	1 - by flanking markers	1	139523928	139524104	1 - by flanking markers	1	131763437	131763614	1 - by flanking markers	RRID:RGD_2317827	This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT
2317891	SHR-Chr 6<sup>MWF</sup>/Rkb		Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany		consomic	Unknown																				RRID:RGD_2317891	SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing
2324631	DA.E3-(<i>D4Wox49-D4Got136</i>)/Rhd		Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden.		congenic	Unknown		Clec4a3	1359528	4	159060677	160528447	1 - by flanking markers	4	222438489	223964695	1 - by flanking markers	4	155414290	156945571	1 - by flanking markers	4	155828194	157232313	1 - by flanking markers	RRID:RGD_2324631	This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.
2325143	SHR/NHsdMco	Spontaneously Hypertensive Rat	University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.		inbred	Unknown																				RRID:RGD_2325143	SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.
2325145	LEW/CrlMco	Lewis	University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.		inbred	Unknown																				RRID:RGD_2325145	These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.
2325146	MNS/NMco	Milan normotensive strain	University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.		inbred	Unknown																				RRID:RGD_2325146	These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.
2325202	SS/JrSeac	Dahl Salt-Sensitive	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1041> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1041> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo; Cryopreserved Sperm	Cardio- Hypertension																			RRID:RGD_2325202	Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP
2325206	LEW/Seac		Seac Yoshitomi, LTD Japan		inbred	Unknown																				RRID:RGD_2325206	Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan
2325209	SHRSP/Hos		Sankyo Lab Service, Japan.		inbred	Unknown																				RRID:RGD_2325209	Substrain of SHRSP purchased from Sankyo Lab Service, Japan.
2325724	PVG.LEW-(<i>D1Rat270-D1Rat68</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	130290073	193070197	1 - by flanking markers	1	136616460	212591221	1 - by flanking markers	1	135611773	205603226	1 - by flanking markers	1	128593600	188377506	1 - by flanking markers	RRID:RGD_2325724	63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1
2325754	SD-<i>Pax6<sup>Sey</sup></i>/Mce		Department of Ophthalmology, Okayama University Medical School, Okayama, Japan		mutant	Unknown		Pax6|Pax6<sup>Sey</sup>	3258|737688	3	91127605	91149178	7	3	102320059	102348223	7	3	95724051	95724052	8	3	92152512	92152513	8	RRID:RGD_2325754	Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.
2325773	WKY.LEW-(<i>D13Arb15-D13Rat58</i>)/Tja		Imperial College, London, UK		congenic	Unknown				13	71116479	96441728	1 - by flanking markers	13	78673431	103987907	1 - by flanking markers	13	73748382	98985851	1 - by flanking markers	13	68269576	92436175	1 - by flanking markers	RRID:RGD_2325773	Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl
2325774	WKY.LEW-(<i>D13Arb10-D13Arb15</i>)(<i>D16Rat88-D16Rat40</i>)/Tja		Imperial College, London, UK	<a href=http://www.rrrc.us/Strain/?x=707>Rat Resource and Research Center</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)																				RRID:RRRC_00707	WKY.LEW-(<i>D13Arb10-D13Arb15</i>) were crossed with WKY.LEW-(<i>D16Rat88-D16Rat40</i>), the F<sub>1</sub> were backcrossed to WKY.LEW-(<i>D13Arb10-D13Arb15</i>) and then the offsprings were intercrossed
2325796	SS.LEW-(<i>D3Rat52-D3Chm57</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				3	14051872	24716931	1 - by flanking markers	3	19410399	34290625	1 - by flanking markers	3	14090411	29084626	1 - by flanking markers	3	18311454	28441896	1 - by flanking markers	RRID:RGD_2325796	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat130</i>)/Ayd
2325798	SS.LEW-(<i>D10Got112-Igfbp4</i>)/Ayd		Centre Hospitalier de Universiti de Montrial, Quebec, Canada		congenic	Unknown		Igfbp4	2875	10	79857808	87834315	1 - by flanking markers	10	78816241	86759484	1 - by flanking markers	10	78970279	86962563	1 - by flanking markers	10	76246085	84007272	1 - by flanking markers	RRID:RGD_2325798	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd
2325801	SS.LEW-(<i>D16Chm36-D16Mit2</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	890512	4304517	1 - by flanking markers	16	1604056	5038806	1 - by flanking markers	16	1619835	5098704	1 - by flanking markers	16	903314	4227730	1 - by flanking markers	RRID:RGD_2325801	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Ayd
2325803	SS.LEW-(<i>D16Rat112-D16Chm60</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown				16	64718	3165043	1 - by flanking markers	16	773329	3491557	1 - by flanking markers	16	778415	3525217	1 - by flanking markers	16	110590	3080679	1 - by flanking markers	RRID:RGD_2325803	A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Ayd
4107048	SS.SR-(<I>D7Rat16-D7Rat189</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108647236	120385575	1 - by flanking markers	7	112143411	123228091	1 - by flanking markers	7	112204378	123243402	1 - by flanking markers	7	102920123	113526566	1 - by flanking markers	RRID:RGD_4107048	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
4107052	SS.SR-(<I>D7Rat16-D7Mgh5</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108647236	115820414	1 - by flanking markers	7	112143411	119125830	1 - by flanking markers	7	112204378	119131068	1 - by flanking markers	7	102920123	109483487	1 - by flanking markers	RRID:RGD_4107052	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
4107055	SS.SR-(<I>D7Rat16-D7Rat176</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	108647236	111200952	1 - by flanking markers	7	112143411	114641749	1 - by flanking markers	7	112204378	114708307	1 - by flanking markers	7	102920123	105399458	1 - by flanking markers	RRID:RGD_4107055	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
4107057	SS.SR-(<I>D7Mco7-D7Rat81</I>)/Jr		Medical College of Ohio, Toledo, Ohio, USA		congenic	Unknown				7	112979256	129500555	1 - by flanking markers	7	116059683	131926277	1 - by flanking markers	7	132252091	132252361	1 - by flanking markers	7	122220558	122220831	1 - by flanking markers	RRID:RGD_4107057	Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment
4107063	SS.LEW-(<i>D1Uia8-D1Rat124</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown																				RRID:RGD_4107063	A sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allele
4107065	SS.LEW-(<i>D1Uia8-D1Rat213</i>)/Mco		Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio		congenic	Unknown				1	81548753	81548909	1 - by flanking markers	1	84537073	84537228	1 - by flanking markers	1	83282659	83282814	1 - by flanking markers	1	81777564	81777720	1 - by flanking markers	RRID:RGD_4107065	A sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allele
4139872	SS-<i>Nckap5<sup>em2Mcwi</sup></i>		PhysGen Knockouts		mutant	Extinct (as of 2017-01-26)		Nckap5<sup>em2Mcwi</sup>	4139862	13	38444115	39275959	7	13	47369687	48273649	7	13	42265875	43049232	7	13	37369948	38283257	7	RRID:RGD_4139872	This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6.
4139873	SS-<i>Rag1<sup>em2Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2021-11-03)		Rag1<sup>em2Mcwi</sup>	4139866	3	86780782	86791878	7	3	97866048	97877145	7	3	91212228	91212244	8	3	87922895	87922911	8	RRID:RGD_4139873	This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.
4139874	SS-<i>Ets1<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2017-01-26)		Ets1<sup>em1Mcwi</sup>	4139856	8	32481694	32545237	7	8	33798598	33921593	7	8	33851478	33851485	8	8	31045909	31168010	7	RRID:RGD_4139874	This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.
4139875	FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2017-01-26)		Sorcs1<sup>em1Mcwi</sup>	4139864	1	255767411	256279565	7	1	277404996	277912261	7	1	269965824	270473097	7	1	249207764	249207777	8	RRID:RGD_4139875	This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.
4139876	SS-<i>Mmp2<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Extinct (as of 2017-01-26)		Mmp2<sup>em1Mcwi</sup>	4139860	19	15246036	15275061	7	19	26629728	26658966	7	19	15542771	15570589	7	19	14154657	14182870	7	RRID:RGD_4139876	This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.
4139877	FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2017-01-26)		Rab38<sup>em1Mcwi</sup>	4139867	1	144783919	144864573	7	1	158385888	158466621	7	1	152072716	152153449	7	1	142182566	142262923	7	RRID:RGD_4139877	This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.
4139878	SS-<i>Mmp2<sup>em2Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2021-11-03)		Mmp2<sup>em2Mcwi</sup>	4139869	19	15246036	15275061	7	19	26646695	26646702	8	19	15542771	15570589	7	19	14154657	14182870	7	RRID:RGD_4139878	This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.
4139879	SS-<i>Nckap5<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Extinct		Nckap5<sup>em1Mcwi</sup>	4139859	13	38444115	39275959	7	13	47369687	48273649	7	13	42265875	43049232	7	13	37369948	38283257	7	RRID:RGD_4139879	This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
4139880	SS-<i>Ren<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Live Animals; Cryopreserved Sperm (as of 2017-01-26)		Ren<sup>em1Mcwi</sup>	4139863	13	46262936	46275213	7	13	55555583	55566812	7	13	50502724	50513953	7	13	44803412	44803421	8	RRID:RGD_4139880	This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.
4139881	SS-<i>Nckap5<sup>em3Mcwi</sup></i>		PhysGen Knockouts		mutant	Extinct (as of 2017-01-26)		Nckap5<sup>em3Mcwi</sup>	4139861	13	38444115	39275959	7	13	47369687	48273649	7	13	42265875	43049232	7	13	37369948	38283257	7	RRID:RGD_4139881	This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.
4139882	SS-<i>Nppa<sup>em4Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2021-11-03)		Nppa<sup>em4Mcwi</sup>	4139857	5	165074518	165075827	7	5	168466309	168467618	7	5	164808762	164808783	8	5	158429042	158430351	7	RRID:RGD_4139882	This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.
4139883	SS-<i>Nox4<sup>em2Mcwi</sup></i>		PhysGen Knockouts		mutant	Live Animals; Cryopreserved Sperm (as of 2017-01-26)		Nox4<sup>em2Mcwi</sup>	4139868	1	143415816	143603554	7	1	157106652	157285107	7	1	150861996	150862003	8	1	140900886	141078844	7	RRID:RGD_4139883	This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.
4139884	SS-<i>Rag1<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2021-11-03)		Rag1<sup>em1Mcwi</sup>	4139865	3	86780782	86791878	7	3	97866048	97877145	7	3	91212237	91212249	8	3	87922904	87922916	8	RRID:RGD_4139884	This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.
4139885	SS-<i>Sh2b3<sup>em1Mcwi</sup></i>		PhysGen Knockouts		mutant	Cryopreserved Sperm (as of 2021-11-03)		Sh2b3<sup>em1Mcwi</sup>	4139858	12	35954679	35958446	7	12	42132947	42136714	7	12	40262913	40262918	8	12	34750772	34750777	8	RRID:RGD_4139885	This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
4139889	BHD/Dspe	Birt-Hogg-Dube rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=927> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=927> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo (as of 2018-06-06)		Flcn	735088																	RRID:RGD_4139889	A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd.
4139890	TT/Sgn		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=928> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=928> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Sperm		Fkbp6	1308926	12	22474002	22544784	7	12	26363264	26435311	7	12	24365941	24438088	7	12	21318251	21390350	7	RRID:RGD_4139890	Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats.
4139891	F344-Chr 3<sup>SDT</sup>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=896> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=896> National BioResource Project for the Rat in Japan</a>	consomic	Cryopreserved Embryo	Diabetes Obesity																			RRID:RGD_4139891	This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background.
4139892	ALD/Hyo	acid lipase deficiency rat	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=926> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=926> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo	Metabolism	Lipa<sup>m1Hyo</sup>	150519893																	RRID:RGD_4139892	In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far.
4140402	W-Tg(Gh1as)Nibs		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=956> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=956> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm																				RRID:RGD_4140402	The construct which contains of rat growth hormone (<i>Gh1</i>) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat <i>Gh1</i> cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science.
4140403	SD-Tg(Eno2-ATXN3*64Q)29Kakiz		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=949> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=949> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Neurobiology																			RRID:RGD_4140403	Background strain is Slc:SD.
4140404	ODS-<i>Gulo<sup>od/od</sup>/ShiJcl	Osteogenic disorder Shionagi rat	<a href =https://www.clea-japan.com/en/products/other_disease/item_a0250> CLEA Japan, Inc</a>	<a href =https://www.clea-japan.com/en/products/other_disease/item_a0250> CLEA Japan, Inc</a>	inbred	Live Animals (as of 2021-04-29)		Gulo<sup>od</sup>	126848761																	RRID:RGD_4140404	Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.
4140405	LEXF6A/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=960> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=960> National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo																				RRID:RGD_4140405	The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.
4140406	SHRSP.WKY-(<i>D1Wox29-D1Arb21</i>)/IzmDmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=964> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=964> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo				1	124614679	187092492	1 - by flanking markers	1	131822204	206277202	1 - by flanking markers	1	130779148	199254774	1 - by flanking markers	1	123350408	182418476	1 - by flanking markers	RRID:RGD_4140406	To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.
4140407	SDT.BN-<i>Gluco13</i>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=958> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=958> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity																			RRID:RGD_4140407	The <i>Gluco13</i> (<i>Gisdt1</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-<i>Gluco14</i>/Nyo (NBRP No. 0602).
4140408	LEXF8C/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=959> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=959> National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo																				RRID:RGD_4140408	The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.
4140409	COP-Chr 16<sup>DA</sup>/McoRrrc		University of Toledo College of Medicine, Toledo, Ohio		consomic	Unknown																				RRID:RGD_4140409	Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background
4140410	SD-Tg(Eno2-ATXN3*64Q)16Kakiz		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=950> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=950> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Neurobiology																			RRID:RGD_4140410	Background strain is Slc:SD.
4140411	SDT.BN-<i>Gluco14</i>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=957> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=957> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity																			RRID:RGD_4140411	The <i>Gluco14</i> (<i>Gisdt2</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN-<i> Gluco13</i>/Nyo (NBRP No. 0601).
4140412	LEXF1D/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=961> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=961> National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo																				RRID:RGD_4140412	The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.
4140413	LEXF1B/Stm		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=962> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=962> National BioResource Project for the Rat in Japan</a>	recombinant_inbred	Cryopreserved Embryo																				RRID:RGD_4140413	The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.
4140414	WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)/IzmDmcr		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=965> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=965> National BioResource Project for the Rat in Japan</a>	congenic	Unknown				1	124614679	187092492	1 - by flanking markers	1	131822204	206277202	1 - by flanking markers	1	130779148	199254774	1 - by flanking markers	1	123350408	182418476	1 - by flanking markers	RRID:RGD_4140414	To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.
4140415	TRMRC/Kyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=963> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=963> National BioResource Project for the Rat in Japan</a>	coisogenic	Live Animals; Cryopreserved Sperm																				RRID:RGD_4140415	The coisogenic control strain for the TRMR strain (NBRP No.0016).
4140416	SD-Tg(Eno2-Vcp)16Kakiz		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=948> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=948> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Sperm	Neurobiology																			RRID:RGD_4140416	This transgenic strain was generated by microinjection into Slc:SD fertilized eggs.
4140469	F344-<i>Kmch</i>/NSlc	Komachi	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=726> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=726> National BioResource Project for the Rat in Japan</a>	mutant	Unknown																				RRID:RGD_4140469	from NBRP
4142540	SHR.WKY-(<i>D4Rat10-D4Rat15</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=941> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=941> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			4	26280781	47890193	1 - by flanking markers	4	26659360	48448808	1 - by flanking markers	4	26753655	48656399	1 - by flanking markers	4	29593287	50119996	1 - by flanking markers	RRID:RGD_4142540	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142541	W-Tg(Tek-GFP)1Soh		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=943> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=943> National BioResource Project for the Rat in Japan</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm																				RRID:RGD_4142541	This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion.
4142542	BN.SDT-<i>Gluco14</i>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=945> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=945> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity																			RRID:RGD_4142542	The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo.
4142543	BN.SDT-<i>Gluco13</i>/Nyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=944> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=944> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Embryo; Cryopreserved Sperm	Diabetes Obesity																			RRID:RGD_4142543	The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo.
4142544	WKY/Kiha		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=930> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=930> National BioResource Project for the Rat in Japan</a>	inbred	Cryopreserved Embryo (as of 2024-09-24)																				RRID:RGD_4142544	A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University.
4142545	SHR.WKY-(<i>D3Rat108-D3Rat166</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=937> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=937> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			3	59676608	101359980	1 - by flanking markers	3	70419858	113470358	1 - by flanking markers	3	63849481	106900596	1 - by flanking markers	3	61934079	102200699	1 - by flanking markers	RRID:RGD_4142545	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142546	AMI/Tj		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=929> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=929> National BioResource Project for the Rat in Japan</a>	mutant	Cryopreserved Embryo	Dentistry																			RRID:RGD_4142546	Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003.
4142547	SHR.WKY-(<i>D4Wox27-D4Rat11</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=940> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=940> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			4	460493	33407710	1 - by flanking markers	4	3096322	34240072	1 - by flanking markers	4	3044017	34379894	1 - by flanking markers	4	5218294	36405277	1 - by flanking markers	RRID:RGD_4142547	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142548	SHR.WKY-(<i>D4Wox27-D4Rat10</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=939> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=939> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			4	460493	26280949	1 - by flanking markers	4	3096322	26659527	1 - by flanking markers	4	3044017	26753822	1 - by flanking markers	4	5218294	29593455	1 - by flanking markers	RRID:RGD_4142548	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142549	SHR.WKY-(<i>D4Wox27-D4Rat4</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=938> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=938> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			4	460493	3237361	1 - by flanking markers	4	3096322	4400584	1 - by flanking markers	4	3044017	4364885	1 - by flanking markers	4	5218294	7935781	1 - by flanking markers	RRID:RGD_4142549	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142550	SHR.WKY-(<i>D4Rat101-D4Rat15</i>)/IzmTkyo		<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=942> National BioResource Project for the Rat in Japan</a>	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=942> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio Hypertension			4	46605924	47890193	1 - by flanking markers	4	46704280	48448808	1 - by flanking markers	4	46898276	48656399	1 - by flanking markers	4	49131906	50119996	1 - by flanking markers	RRID:RGD_4142550	This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.
4142799	LEW.SS-(<i>D2Uia5-D2Rat143</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				2	13909383	106236206	1 - by flanking markers	2	13186164	125885146	1 - by flanking markers	2	13328947	106156987	1 - by flanking markers	2	15575840	103519040	1 - by flanking markers	RRID:RGD_4142799	LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain
4142800	LEW.SS-(<i>D18Chm31-D18Mit8</i>)/Ayd		Research Centre-CHUM, Montreal, Quebec, Canada		congenic	Unknown				18	2848113	62229060	1 - by flanking markers	18	2761846	61177004	1 - by flanking markers	18	2745212	61985812	1 - by flanking markers	18	59796478	59796643	1 - by flanking markers	RRID:RGD_4142800	LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain
4143165	SD-Tg(Aqp5-GFP)ZboroRrrc	Aqp5EGFP	<a href=http://www.rrrc.us/Strain/?x=427>Rat Resource and Research Center</a>	<a href=http://www.rrrc.us/Strain/?x=427>Rat Resource and Research Center</a>	transgenic	Cryopreserved Embryo; Cryopreserved Sperm		Aqp5	2144																	RRID:RRRC_00427	This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained.
4143456	BN.GK-(<i>D2Wox30-D2Wox68</i>)/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown																				RRID:RGD_4143456	This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
4143457	BN.GK-(<i>D2Rat40-D2Wox35</i>)/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				2	163154227	163154358	1 - by flanking markers	2	189197858	189197988	1 - by flanking markers	2	169852670	244719662	1 - by flanking markers	2	157142078	157142209	1 - by flanking markers	RRID:RGD_4143457	This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
4143458	BN.GK-(<i>D2Wox49-D2Rat70</i>)/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				2	191000085	254933362	1 - by flanking markers	2	217822782	281850471	1 - by flanking markers	2	198335799	263179188	1 - by flanking markers	2	183756199	245889826	1 - by flanking markers	RRID:RGD_4143458	This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
4143459	BN.GK-(<i>D2Rat40-D2Got149</i>)/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		congenic	Unknown				2	163154227	222343164	1 - by flanking markers	2	189197858	248391122	1 - by flanking markers	2	169852670	229036415	1 - by flanking markers	2	157142078	213653017	1 - by flanking markers	RRID:RGD_4143459	This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.
4145088	SS.BN-(<i>D6Rat119-D6Arb3</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				6	111239053	138260635	1 - by flanking markers	6	120420333	147057860	1 - by flanking markers	6	111134524	138065254	1 - by flanking markers	6	106752656	132339866	1 - by flanking markers	RRID:RGD_4145088	SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
4145089	SS.BN-(<i>D6Rat149-D6Rat18</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				6	7161389	93374504	1 - by flanking markers	6	6959479	103168177	1 - by flanking markers	6	7009971	93706327	1 - by flanking markers	6	10894415	89763029	1 - by flanking markers	RRID:RGD_4145089	SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
4145090	SS.BN-(<i>D6Rat149-D6Got171</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				6	7161389	123782965	1 - by flanking markers	6	6959479	132827005	1 - by flanking markers	6	7009971	123598338	1 - by flanking markers	6	10894415	118863044	1 - by flanking markers	RRID:RGD_4145090	SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain
4145091	SS.BN-(<i>D6Rat149-D6Arb3</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown				6	7161389	138260635	1 - by flanking markers	6	6959479	147057860	1 - by flanking markers	6	7009971	138065254	1 - by flanking markers	6	10894415	132339866	1 - by flanking markers	RRID:RGD_4145091	SS/JrHsdMcwi were crossed with SS-6<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain
4145374	ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Rat98-D14Hmgc18</i>)/Mcwi		Medical College of Wisconsin, Milwaukee, Wisconsin		congenic	Unknown																				RRID:RGD_4145374	Congenic strain developed by crossing ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/Eur (Rf-1a) males to ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi (Rf-1a+4) double congenic females
4889411	SHRSP.WKY-(<i>D1Smu13-D1Wox33</i>)/Izm		Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1079> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio- Hypertension			1;2	160754901;198300754	160755065;198300855	1 - by flanking markers;1 - by flanking markers	2;1	224991853;173074640	224991955;174300801	1 - by flanking markers;1 - by flanking markers	1	166884926	166885141	1 - by flanking markers	1	156170341	156170557	1 - by flanking markers	RRID:RGD_4889411	About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain
4889414	WKY.SHRSP-(<i>D1Rat171-D1Wox33</i>)/Izm		Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1081> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Cardio-Hypertension			1;2	158964262;198300754	160755065;198300855	1 - by flanking markers;1 - by flanking markers	1;2	172767534;224991853	174300801;224991955	1 - by flanking markers;1 - by flanking markers	1	166577232	166577467	1 - by flanking markers	1	155866514	155866750	1 - by flanking markers	RRID:RGD_4889414	About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(<i>D1Smu13-D1Smu11</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain
4889450	DA.PVG.1AV1-(<i>D1Rat248-D1Rat10</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden		congenic	Unknown				1	6253932	25271177	1 - by flanking markers	1	7306802	86917075	1 - by flanking markers	1	5655772	85706974	1 - by flanking markers	1	5925877	24697545	1 - by flanking markers	RRID:RGD_4889450	DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb)
4889464	GK/Ox		The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK		inbred	Unknown																				RRID:RGD_4889464	Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK
4889499	CDS-Chr 4<sup>CDR</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889499	Homozygous male CDS/Ygl were bred with CDR/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed
4889817	SBN-Chr 1<sup>SBH</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889817	Homozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed
4889820	SBH-Chr 1<sup>SBN</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889820	Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed
4889822	SBN-Chr 17<sup>SBH</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889822	Homozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed
4889875	SBH-Chr 2<sup>SBN</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889875	Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed
4889877	SBH-Chr 20<sup>SBN</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889877	Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed
4889879	SBH-Chr X<sup>SBN</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889879	Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed
4889882	SBH-Chr 17<sup>SBN</sup>/Ygl		Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel		consomic	Unknown																				RRID:RGD_4889882	Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed
4889890	DA.PVG.1AV1-(<i>D17Rat8-D17Rat37</i>)/Kini		Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden	<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1096> National BioResource Project for the Rat in Japan</a>	congenic	Cryopreserved Sperm	Immunology			17	27618789	75802944	1 - by flanking markers	17	25486196	69844594	1 - by flanking markers	17	23522321	68114865	1 - by flanking markers	17	21782841	64759263	1 - by flanking markers	RRID:RGD_4889890	DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37
4891048	SS.LEW-(<i>D7Rat73-D7Rat128</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown		Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3	2185|2453|2454|3809|3904|620616|621264|621525|628723|727886	7	57326196	121524220	1 - by flanking markers	7	61044919	124236725	1 - by flanking markers	7	61047589	124246733	1 - by flanking markers	7	53612714	114528048	1 - by flanking markers	RRID:RGD_4891048	SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
4891051	LEW.SS-(<i>D7Rat73-D7Rat128</i>)/Ayd		Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada		congenic	Unknown		Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3	2185|2453|2454|3809|3904|620616|621264|621525|628723|727886	7	57326196	121524220	1 - by flanking markers	7	61044919	124236725	1 - by flanking markers	7	61047589	124246733	1 - by flanking markers	7	53612714	114528048	1 - by flanking markers	RRID:RGD_4891051	LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain
4891103	WMI/EerRrrc	WKY most immobile	Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois	<a href=http://www.rrrc.us/Strain/?x=973>Rat Resource and Research Center</a>	inbred	Unknown																				RRID:RRRC_00973	3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.
4891107	WLI/EerRrrc	WKY least immobile	Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois	<a href=http://www.rrrc.us/Strain/?x=967>Rat Resource and Research Center</a>	inbred	Unknown																				RRID:RRRC_00967	3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.
4891165	Wig/Ymas	wiggling	Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan		congenic	Unknown																				RRID:RGD_4891165	These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain
4891380	SS.SR-(<i>D9Mco95-D9Mco98</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown								9	80867159	80946065	1 - by flanking markers	9	81100315	81180041	1 - by flanking markers	9	75403227	75482161	1 - by flanking markers	RRID:RGD_4891380	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891383	SS.SR-(<i>D9Mco98-Resp18</i>)/1Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74551809	74558151	1 - by flanking markers	9	80945872	82246695	1 - by flanking markers	9	81179848	82477136	1 - by flanking markers	9	75481963	76771824	1 - by flanking markers	RRID:RGD_4891383	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891386	SS.SR-(<i>D9Mco98-Resp18</i>)/2Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74551809	74558151	1 - by flanking markers	9	80945872	82246695	1 - by flanking markers	9	81179848	82477136	1 - by flanking markers	9	75481963	76771824	1 - by flanking markers	RRID:RGD_4891386	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891388	SS.SR-(<i>D9Mco95-D9Mco100</i>)/1Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown								9	80867159	81453493	1 - by flanking markers	9	81100315	81688944	1 - by flanking markers	9	75403227	75990271	1 - by flanking markers	RRID:RGD_4891388	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891390	SS.SR-(<i>D9Mco95-D9Mco100</i>)/2Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown								9	80867159	81453493	1 - by flanking markers	9	81100315	81688944	1 - by flanking markers	9	75403227	75990271	1 - by flanking markers	RRID:RGD_4891390	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891392	SS.SR-(<i>D9Mco95-D9Mco102</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown								9	80867159	81641213	1 - by flanking markers	9	81100315	81878831	1 - by flanking markers	9	75403227	76175576	1 - by flanking markers	RRID:RGD_4891392	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891394	SS.SR-(<i>D9Mco101-Resp18</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74551809	74558151	1 - by flanking markers	9	81611825	82246695	1 - by flanking markers	9	81847677	82477136	1 - by flanking markers	9	76145766	76771824	1 - by flanking markers	RRID:RGD_4891394	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891396	SS.SR-(<i>D9Mco72-Resp18</i>)/Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	44842118	74558151	1 - by flanking markers	9	52352690	82246695	1 - by flanking markers	9	52686874	82477136	1 - by flanking markers	9	47902208	76771824	1 - by flanking markers	RRID:RGD_4891396	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891400	SS.SR-(<i>D9Mco14-Resp18</i>)/1Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74436883	74558151	1 - by flanking markers	9	82125291	82246695	1 - by flanking markers	9	82356030	82477136	1 - by flanking markers	9	76650629	76771824	1 - by flanking markers	RRID:RGD_4891400	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891402	SS.SR-(<i>D9Mco14-Resp18</i>)/2Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74436883	74558151	1 - by flanking markers	9	82125291	82246695	1 - by flanking markers	9	82356030	82477136	1 - by flanking markers	9	76650629	76771824	1 - by flanking markers	RRID:RGD_4891402	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4891404	SS.SR-(<i>D9Mco14-Resp18</i>)/3Mco		Medical College of Ohio, Toledo, Ohio		congenic	Unknown		Resp18	3555	9	74436883	74558151	1 - by flanking markers	9	82125291	82246695	1 - by flanking markers	9	82356030	82477136	1 - by flanking markers	9	76650629	76771824	1 - by flanking markers	RRID:RGD_4891404	SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region
4892563	WF.WKY-(<i>D5Rat26-D5Uwm42</i>)/Uwm		University of Wisconsin-Madison		congenic	Unknown				5	119332868	153554465	1 - by flanking markers	5	121495621	156871691	1 - by flanking markers	5	117554114	153097789	1 - by flanking markers	5	113558156	146996127	1 - by flanking markers	RRID:RGD_4892563	WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region.
5130721	HXB1/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5130721	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131094	BN-<i>Lx</i>/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		mutant	Unknown																				RRID:RGD_5131094	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131095	BXH13/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131095	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131097	BXH12/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131097	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131099	BXH11/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131099	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131101	BXH10/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131101	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131104	BXH9/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131104	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131106	BXH8/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131106	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131108	BXH6/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131108	Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131110	BXH5/CubPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131110	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131113	HXB31/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131113	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131115	HXB29/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131115	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131118	HXB27/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131118	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131120	HXB26/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131120	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131122	HXB25/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131122	Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
5131124	HXB23/IpcvPrin		Dept. of Pharmacology, University of California, San Diego, La Jolla, California		recombinant_inbred	Unknown																				RRID:RGD_5131124	Embryo-rederived from breeder stock provided by P