ALLELE_RGDID ALLELE_SYMBOL ALLELE_NAME ALLELE_DESCRIPTION ALLELE_CREATED ALLELE_LAST_MODIFIED PARENT_GENE_RGDID PARENT_GENE_SYMBOL MAP_NAME GENE_CHR GENE_START GENE_STOP GENE_STRAND ALLELE_SYNONYMS
2290121 AbatTn(sb-T2/Bart3)2.163Mcwi 4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene 2008-02-26 2008-02-26 620948 Abat RGSC 3.4 10 7040725 7137154 - AbatTn(sb-T2/Bart3)2.163Mcwi
2290121 AbatTn(sb-T2/Bart3)2.163Mcwi 4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene 2008-02-26 2008-02-26 620948 Abat Rnor_5.0 10 5894187 6002068 - AbatTn(sb-T2/Bart3)2.163Mcwi
2290121 AbatTn(sb-T2/Bart3)2.163Mcwi 4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene 2008-02-26 2008-02-26 620948 Abat Rnor_6.0 10 7093406 7200439 - AbatTn(sb-T2/Bart3)2.163Mcwi
617212699 Abca4em1Tuckr ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr This is an Abca4 knockout mutant allele induced by CRISPR/Cas9 targeted at exon 2 to exon 8 of rat Abca4 gene. 2025-07-16 2025-07-16 1309445 Abca4 RGSC 3.4 2 218712663 218849896 +
617212699 Abca4em1Tuckr ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr This is an Abca4 knockout mutant allele induced by CRISPR/Cas9 targeted at exon 2 to exon 8 of rat Abca4 gene. 2025-07-16 2025-07-16 1309445 Abca4 Rnor_5.0 2 243682218 243818930 +
617212699 Abca4em1Tuckr ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr This is an Abca4 knockout mutant allele induced by CRISPR/Cas9 targeted at exon 2 to exon 8 of rat Abca4 gene. 2025-07-16 2025-07-16 1309445 Abca4 Rnor_6.0 2 225645539 225783288 +
12904731 Abcb11em1Sage ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage This ZFN induced allele contains 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 619930 Abcb11 Rnor_5.0 3 62091490 62092502 - BSEP Knockout;ATP binding cassette subfamily B member 11;endonuclease induced mutant 1, Sage;Abcb11em1Sage
12904731 Abcb11em1Sage ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage This ZFN induced allele contains 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 619930 Abcb11 Rnor_5.0 3 62106821 62195528 - BSEP Knockout;ATP binding cassette subfamily B member 11;endonuclease induced mutant 1, Sage;Abcb11em1Sage
12904731 Abcb11em1Sage ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage This ZFN induced allele contains 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 619930 Abcb11 Rnor_6.0 3 55480024 55587946 - BSEP Knockout;ATP binding cassette subfamily B member 11;endonuclease induced mutant 1, Sage;Abcb11em1Sage
12904058 Abcb1aem1Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 20-bp deletion within Abcba1 gene, resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 619951 Abcb1a RGSC 3.4 4 21709855 21796628 + Abcb1a tm1sage;ATP binding cassette subfamily B member 1A; endonuclease induced mutant 1, Sage;Abcb1aem1Sage;Abcb1aem1Sage
12904058 Abcb1aem1Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 20-bp deletion within Abcba1 gene, resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 619951 Abcb1a Rnor_5.0 4 22276390 22448913 - Abcb1a tm1sage;ATP binding cassette subfamily B member 1A; endonuclease induced mutant 1, Sage;Abcb1aem1Sage;Abcb1aem1Sage
12904058 Abcb1aem1Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 20-bp deletion within Abcba1 gene, resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 619951 Abcb1a Rnor_6.0 4 22339829 22517642 - Abcb1a tm1sage;ATP binding cassette subfamily B member 1A; endonuclease induced mutant 1, Sage;Abcb1aem1Sage;Abcb1aem1Sage
12907569 Abcb1aem2Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage The ZFN-induced mutant allele contains 19-bp deletion in exon7 resulting total loss of protein expression. 2017-06-07 2017-06-07 619951 Abcb1a RGSC 3.4 4 21709855 21796628 + Abcb1aem2Sage
12907569 Abcb1aem2Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage The ZFN-induced mutant allele contains 19-bp deletion in exon7 resulting total loss of protein expression. 2017-06-07 2017-06-07 619951 Abcb1a Rnor_5.0 4 22276390 22448913 - Abcb1aem2Sage
12907569 Abcb1aem2Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage The ZFN-induced mutant allele contains 19-bp deletion in exon7 resulting total loss of protein expression. 2017-06-07 2017-06-07 619951 Abcb1a Rnor_6.0 4 22339829 22517642 - Abcb1aem2Sage
12907571 Abcb1aem3Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage) The ZFN-induced mutant allele contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-06-07 2017-06-07 619951 Abcb1a RGSC 3.4 4 21709855 21796628 + Abcb1aem3Sage
12907571 Abcb1aem3Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage) The ZFN-induced mutant allele contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-06-07 2017-06-07 619951 Abcb1a Rnor_5.0 4 22276390 22448913 - Abcb1aem3Sage
12907571 Abcb1aem3Sage ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage) The ZFN-induced mutant allele contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. 2017-06-07 2017-06-07 619951 Abcb1a Rnor_6.0 4 22339829 22517642 - Abcb1aem3Sage
6893598 Abcb1bem2Mcwi ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 98-bp frameshift deletion in exon 4 that includes the splice acceptor. 2012-09-12 2012-09-12 3318 Abcb1b RGSC 3.4 4 21829489 21912239 + Abcb1bem2Mcwi
6893598 Abcb1bem2Mcwi ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 98-bp frameshift deletion in exon 4 that includes the splice acceptor. 2012-09-12 2012-09-12 3318 Abcb1b Rnor_5.0 4 22161597 22244735 - Abcb1bem2Mcwi
6893598 Abcb1bem2Mcwi ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 98-bp frameshift deletion in exon 4 that includes the splice acceptor. 2012-09-12 2012-09-12 3318 Abcb1b Rnor_6.0 4 22225123 22307577 - Abcb1bem2Mcwi
12792941 Abcc2TR ATP binding cassette subfamily C member 2;transport deficient mutant Spontaneous mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). It is a nonsense mutation caused by one bp deletion in the coding region of Abcc2. 2017-03-16 2017-03-16 2366 Abcc2 Rnor_5.0 1 270999832 271057750 + Abcc2TR-;Abcc2TR-;ATP binding cassette subfamily C member 2;transport deficient mutant ,
12792941 Abcc2TR ATP binding cassette subfamily C member 2;transport deficient mutant Spontaneous mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). It is a nonsense mutation caused by one bp deletion in the coding region of Abcc2. 2017-03-16 2017-03-16 2366 Abcc2 Rnor_6.0 1 263554426 263612556 + Abcc2TR-;Abcc2TR-;ATP binding cassette subfamily C member 2;transport deficient mutant ,
12904687 Abcc2em1Sage ATP binding cassette subfamily C member 2; ZFN induced mutant 1, Sage This allele contains biallelic 726 bp deletion within Abcc2 gene. 2017-05-17 2017-05-17 2366 Abcc2 Rnor_5.0 1 270999832 271057750 + ATP binding cassette subfamily C member 2; endonuclease induced mutant 1, Sage;Abcc2em1Sage
12904687 Abcc2em1Sage ATP binding cassette subfamily C member 2; ZFN induced mutant 1, Sage This allele contains biallelic 726 bp deletion within Abcc2 gene. 2017-05-17 2017-05-17 2366 Abcc2 Rnor_6.0 1 263554426 263612556 + ATP binding cassette subfamily C member 2; endonuclease induced mutant 1, Sage;Abcc2em1Sage
730454538 Abcc2hyb ATP binding cassette subfamily C member 2; hyperbilirubinuria a pontaneous 1 bp replacement of G by A at the nucleotide 2564 resulted in the introduction of the stop codon at amino acid 855. 2026-05-20 2026-05-20 2366 Abcc2 Rnor_5.0 1 270999832 271057750 +
730454538 Abcc2hyb ATP binding cassette subfamily C member 2; hyperbilirubinuria a pontaneous 1 bp replacement of G by A at the nucleotide 2564 resulted in the introduction of the stop codon at amino acid 855. 2026-05-20 2026-05-20 2366 Abcc2 Rnor_6.0 1 263554426 263612556 +
10413843 Abcc6em1Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li This allele was made by ZFN mutagenesis.ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 44-53 (CAGGCCTGAG). 2015-11-25 2018-09-20 620268 Abcc6 RGSC 3.4 1 96448588 96524655 - Abcc6em1Qlju
10413843 Abcc6em1Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li This allele was made by ZFN mutagenesis.ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 44-53 (CAGGCCTGAG). 2015-11-25 2018-09-20 620268 Abcc6 Rnor_5.0 1 103042723 103096453 - Abcc6em1Qlju
10413843 Abcc6em1Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li This allele was made by ZFN mutagenesis.ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 44-53 (CAGGCCTGAG). 2015-11-25 2018-09-20 620268 Abcc6 Rnor_6.0 1 101954786 102013252 - Abcc6em1Qlju
10413846 Abcc6em2Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. 2015-11-25 2016-12-08 620268 Abcc6 RGSC 3.4 1 96448588 96524655 - Abcc6em2Qlju
10413846 Abcc6em2Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. 2015-11-25 2016-12-08 620268 Abcc6 Rnor_5.0 1 103042723 103096453 - Abcc6em2Qlju
10413846 Abcc6em2Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. 2015-11-25 2016-12-08 620268 Abcc6 Rnor_6.0 1 101954786 102013252 - Abcc6em2Qlju
10413847 Abcc6em3Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 42-51 (CGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 RGSC 3.4 1 96448588 96524655 - Abcc6em3Qlju
10413847 Abcc6em3Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 42-51 (CGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 Rnor_5.0 1 103042723 103096453 - Abcc6em3Qlju
10413847 Abcc6em3Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 42-51 (CGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 Rnor_6.0 1 101954786 102013252 - Abcc6em3Qlju
10413848 Abcc6em4Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 RGSC 3.4 1 96448588 96524655 - Abcc6em4Qlju
10413848 Abcc6em4Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 Rnor_5.0 1 103042723 103096453 - Abcc6em4Qlju
10413848 Abcc6em4Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). 2015-11-25 2016-12-08 620268 Abcc6 Rnor_6.0 1 101954786 102013252 - Abcc6em4Qlju
10413849 Abcc6em5Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. 2015-11-25 2016-12-08 620268 Abcc6 RGSC 3.4 1 96448588 96524655 - Abcc6em5Qlju
10413849 Abcc6em5Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. 2015-11-25 2016-12-08 620268 Abcc6 Rnor_5.0 1 103042723 103096453 - Abcc6em5Qlju
10413849 Abcc6em5Qlju ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. 2015-11-25 2016-12-08 620268 Abcc6 Rnor_6.0 1 101954786 102013252 - Abcc6em5Qlju
127285598 Abcc8em1Cgen ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This allele carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats. 2021-06-22 2021-06-22 3786 Abcc8 RGSC 3.4 1 96622574 96703723 -
127285598 Abcc8em1Cgen ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This allele carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats. 2021-06-22 2021-06-22 3786 Abcc8 Rnor_5.0 1 103194473 103275508 -
127285598 Abcc8em1Cgen ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This allele carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats. 2021-06-22 2021-06-22 3786 Abcc8 Rnor_6.0 1 102110708 102191287 -
10054237 Abcd1em2Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon1 of the rat Abcd1 gene 2015-07-30 2016-10-19 1562128 Abcd1 RGSC 3.4 X 159614569 159635963 + Abcd1em2Mcwi
10054237 Abcd1em2Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon1 of the rat Abcd1 gene 2015-07-30 2016-10-19 1562128 Abcd1 Rnor_5.0 1 152823436 152844829 - Abcd1em2Mcwi
10054237 Abcd1em2Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon1 of the rat Abcd1 gene 2015-07-30 2016-10-19 1562128 Abcd1 Rnor_6.0 X 157073860 157095652 - Abcd1em2Mcwi
10054240 Abcd1em4Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 203-bp deletion in the Abcd1 gene 2015-07-30 2016-10-24 1562128 Abcd1 RGSC 3.4 X 159614569 159635963 + Abcd1em4Mcwi;ATP-binding cassette, subfamily D (ALD), member 1;Abcd1em2Mcwi;CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin
10054240 Abcd1em4Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 203-bp deletion in the Abcd1 gene 2015-07-30 2016-10-24 1562128 Abcd1 Rnor_5.0 1 152823436 152844829 - Abcd1em4Mcwi;ATP-binding cassette, subfamily D (ALD), member 1;Abcd1em2Mcwi;CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin
10054240 Abcd1em4Mcwi ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 203-bp deletion in the Abcd1 gene 2015-07-30 2016-10-24 1562128 Abcd1 Rnor_6.0 X 157073860 157095652 - Abcd1em4Mcwi;ATP-binding cassette, subfamily D (ALD), member 1;Abcd1em2Mcwi;CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin
12904064 Abcg2em1Sage ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 588-bp deletion within Abcg2 gene , resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 631345 Abcg2 RGSC 3.4 4 87502584 87560017 + Bcrp Knockout;Abcg2 tm1sage;ATP-binding cassette, subfamily G (WHITE), member 2; endonuclease induced mutatn 1, Sage;Abcg2em1Sage
12904064 Abcg2em1Sage ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 588-bp deletion within Abcg2 gene , resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 631345 Abcg2 Rnor_5.0 4 153587206 153712481 + Bcrp Knockout;Abcg2 tm1sage;ATP-binding cassette, subfamily G (WHITE), member 2; endonuclease induced mutatn 1, Sage;Abcg2em1Sage
12904064 Abcg2em1Sage ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage This ZFN mutant allelic contain a 588-bp deletion within Abcg2 gene , resulting knockout of protein expression via Western blot. 2017-05-16 2017-05-16 631345 Abcg2 Rnor_6.0 4 88765441 88890268 + Bcrp Knockout;Abcg2 tm1sage;ATP-binding cassette, subfamily G (WHITE), member 2; endonuclease induced mutatn 1, Sage;Abcg2em1Sage
5131905 Acad10em2Mcwi acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 2 (del 2040-2049). 2011-05-16 2011-05-16 1310159 Acad10 RGSC 3.4 12 36070275 36075844 + Acad10em2Mcwi
5131905 Acad10em2Mcwi acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 2 (del 2040-2049). 2011-05-16 2011-05-16 1310159 Acad10 Rnor_5.0 12 42285817 42328189 + Acad10em2Mcwi
5131905 Acad10em2Mcwi acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 2 (del 2040-2049). 2011-05-16 2011-05-16 1310159 Acad10 Rnor_6.0 12 40417918 40460562 + Acad10em2Mcwi
6484702 Aceem1Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace RGSC 3.4 10 95361338 95381455 + Aceem1Mcwi
6484702 Aceem1Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace Rnor_5.0 10 93922062 93965127 + Aceem1Mcwi
6484702 Aceem1Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace Rnor_6.0 10 94170766 94213831 + Aceem1Mcwi
6484704 Aceem2Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace RGSC 3.4 10 95361338 95381455 + Aceem2Mcwi
6484704 Aceem2Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace Rnor_5.0 10 93922062 93965127 + Aceem2Mcwi
6484704 Aceem2Mcwi angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 6. 2012-07-02 2012-07-02 2493 Ace Rnor_6.0 10 94170766 94213831 + Aceem2Mcwi
2314337 AcoxlTn(sb-T2/Bart3)2.342Mcwi acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene 2009-11-11 2009-11-11 1306814 Acoxl RGSC 3.4 3 115365279 115687566 + AcoxlTn(sb-T2/Bart3)2.342Mcwi
2314337 AcoxlTn(sb-T2/Bart3)2.342Mcwi acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene 2009-11-11 2009-11-11 1306814 Acoxl Rnor_5.0 3 126606586 126919666 - AcoxlTn(sb-T2/Bart3)2.342Mcwi
2314337 AcoxlTn(sb-T2/Bart3)2.342Mcwi acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene 2009-11-11 2009-11-11 1306814 Acoxl Rnor_6.0 3 120414311 120724809 + AcoxlTn(sb-T2/Bart3)2.342Mcwi
2299093 AdaTn(sb-T2/Bart3)2.237Mcwi adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene 2008-08-12 2008-08-12 2031 Ada RGSC 3.4 3 154636530 154660637 - AdaTn(sb-T2/Bart3)2.237Mcwi
2299093 AdaTn(sb-T2/Bart3)2.237Mcwi adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene 2008-08-12 2008-08-12 2031 Ada Rnor_5.0 3 166306001 166330108 - AdaTn(sb-T2/Bart3)2.237Mcwi
2299093 AdaTn(sb-T2/Bart3)2.237Mcwi adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene 2008-08-12 2008-08-12 2031 Ada Rnor_6.0 3 160115840 160139947 - AdaTn(sb-T2/Bart3)2.237Mcwi
645122462 Adamts13em1Soar ADAM metallopeptidase with thrombospondin type 1 motif, 13; CRISPR/Cas9 induced mutant 1, Soar This allele carries a delin mutation (-14+1) with net 13-bp deletion produced by CRISPR/Cas9 system in Holtzman Sprague-Dawley rats 2026-04-03 2026-04-03 1311594 Adamts13 RGSC 3.4 3 5868906 5908061 +
645122462 Adamts13em1Soar ADAM metallopeptidase with thrombospondin type 1 motif, 13; CRISPR/Cas9 induced mutant 1, Soar This allele carries a delin mutation (-14+1) with net 13-bp deletion produced by CRISPR/Cas9 system in Holtzman Sprague-Dawley rats 2026-04-03 2026-04-03 1311594 Adamts13 Rnor_5.0 3 10881333 10920130 +
645122462 Adamts13em1Soar ADAM metallopeptidase with thrombospondin type 1 motif, 13; CRISPR/Cas9 induced mutant 1, Soar This allele carries a delin mutation (-14+1) with net 13-bp deletion produced by CRISPR/Cas9 system in Holtzman Sprague-Dawley rats 2026-04-03 2026-04-03 1311594 Adamts13 Rnor_6.0 3 5519921 5558390 +
13437613 Adamts16em1Bj ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. 2017-10-10 2017-10-10 1310046 Adamts16 RGSC 3.4 17 2559771 2690663 + Adamts16em1Bj;Adamts16em1Bj
13437613 Adamts16em1Bj ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. 2017-10-10 2017-10-10 1310046 Adamts16 Rnor_5.0 1 36468949 36599799 + Adamts16em1Bj;Adamts16em1Bj
13437613 Adamts16em1Bj ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. 2017-10-10 2017-10-10 1310046 Adamts16 Rnor_6.0 1 35067268 35200530 + Adamts16em1Bj;Adamts16em1Bj
19165365 Adcy3em2Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adcy3 gene of WKY/Ncrl rat embryos. The resulting mutation is a 3-bp deletion in the exon 2 of the targeted gene. 2020-02-05 2025-06-06 71009 Adcy3 RGSC 3.4 6 27118325 27202275 +
19165365 Adcy3em2Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adcy3 gene of WKY/Ncrl rat embryos. The resulting mutation is a 3-bp deletion in the exon 2 of the targeted gene. 2020-02-05 2025-06-06 71009 Adcy3 Rnor_5.0 6 38378060 38454926 +
19165365 Adcy3em2Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adcy3 gene of WKY/Ncrl rat embryos. The resulting mutation is a 3-bp deletion in the exon 2 of the targeted gene. 2020-02-05 2025-06-06 71009 Adcy3 Rnor_6.0 6 28570941 28648848 +
616390062 Adcy3em3Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062). 2025-06-09 2025-06-09 71009 Adcy3 RGSC 3.4 6 27118325 27202275 +
616390062 Adcy3em3Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062). 2025-06-09 2025-06-09 71009 Adcy3 Rnor_5.0 6 38378060 38454926 +
616390062 Adcy3em3Mcwi adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062). 2025-06-09 2025-06-09 71009 Adcy3 Rnor_6.0 6 28570941 28648848 +
150429617 Add3em1Mcwi adducin 3; ZFN induced mutant1, Mcwi ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 RGSC 3.4 1 259347673 259455407 -
150429617 Add3em1Mcwi adducin 3; ZFN induced mutant1, Mcwi ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 Rnor_5.0 1 281267424 281375203 +
150429617 Add3em1Mcwi adducin 3; ZFN induced mutant1, Mcwi ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 Rnor_6.0 1 273854195 273961982 +
150429619 Add3em2Mcwi adducin 3; ZFN induced mutant2, Mcwi ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 RGSC 3.4 1 259347673 259455407 -
150429619 Add3em2Mcwi adducin 3; ZFN induced mutant2, Mcwi ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 Rnor_5.0 1 281267424 281375203 +
150429619 Add3em2Mcwi adducin 3; ZFN induced mutant2, Mcwi ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. 2021-09-09 2021-09-09 2043 Add3 Rnor_6.0 1 273854195 273961982 +
2290129 Adgrl3Tn(sb-T2/Bart3)2.151Mcwi adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 (formerly Lphn3) gene 2008-02-26 2008-02-26 620836 Adgrl3 RGSC 3.4 14 28385112 28854677 - Lphn3Tn(sb-T2/Bart3)2.151Mcwi;Lphn3Tn(sb-T2/Bart3)2.151Mcwi;latrophilin 3; transposon insertion 2.151, Medical College of Wisconsin
2290129 Adgrl3Tn(sb-T2/Bart3)2.151Mcwi adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 (formerly Lphn3) gene 2008-02-26 2008-02-26 620836 Adgrl3 Rnor_5.0 14 28183727 29040121 - Lphn3Tn(sb-T2/Bart3)2.151Mcwi;Lphn3Tn(sb-T2/Bart3)2.151Mcwi;latrophilin 3; transposon insertion 2.151, Medical College of Wisconsin
2290129 Adgrl3Tn(sb-T2/Bart3)2.151Mcwi adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 (formerly Lphn3) gene 2008-02-26 2008-02-26 620836 Adgrl3 Rnor_6.0 14 28362176 29226085 - Lphn3Tn(sb-T2/Bart3)2.151Mcwi;Lphn3Tn(sb-T2/Bart3)2.151Mcwi;latrophilin 3; transposon insertion 2.151, Medical College of Wisconsin
127285662 Adgrl3em1Huyc adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. 2021-06-25 2021-06-25 620836 Adgrl3 RGSC 3.4 14 28385112 28854677 -
127285662 Adgrl3em1Huyc adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. 2021-06-25 2021-06-25 620836 Adgrl3 Rnor_5.0 14 28183727 29040121 -
127285662 Adgrl3em1Huyc adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. 2021-06-25 2021-06-25 620836 Adgrl3 Rnor_6.0 14 28362176 29226085 -
1578787 Adipoqm1Mcwi adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y162C mutation is generated 2006-05-02 2006-05-02 628748 Adipoq RGSC 3.4 11 79908291 79911065 - Adipoqm1Mcwi;Acrp30m1Mcwi;adipocyte complement related protein of 30 kDa;mutation 1, Medical College of Wisconsin
1578787 Adipoqm1Mcwi adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y162C mutation is generated 2006-05-02 2006-05-02 628748 Adipoq Rnor_5.0 11 84363940 84382663 - Adipoqm1Mcwi;Acrp30m1Mcwi;adipocyte complement related protein of 30 kDa;mutation 1, Medical College of Wisconsin
1578787 Adipoqm1Mcwi adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y162C mutation is generated 2006-05-02 2006-05-02 628748 Adipoq Rnor_6.0 11 81330845 81344488 - Adipoqm1Mcwi;Acrp30m1Mcwi;adipocyte complement related protein of 30 kDa;mutation 1, Medical College of Wisconsin
1578797 Adipoqm2Mcwi adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I164N mutation is generated 2006-05-02 2006-05-02 628748 Adipoq RGSC 3.4 11 79908291 79911065 - Adipoqm2Mcwi;Acrp30m2Mcwi;adipocyte complement related protein of 30 kDa;mutation 2, Medical College of Wisconsin
1578797 Adipoqm2Mcwi adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I164N mutation is generated 2006-05-02 2006-05-02 628748 Adipoq Rnor_5.0 11 84363940 84382663 - Adipoqm2Mcwi;Acrp30m2Mcwi;adipocyte complement related protein of 30 kDa;mutation 2, Medical College of Wisconsin
1578797 Adipoqm2Mcwi adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I164N mutation is generated 2006-05-02 2006-05-02 628748 Adipoq Rnor_6.0 11 81330845 81344488 - Adipoqm2Mcwi;Acrp30m2Mcwi;adipocyte complement related protein of 30 kDa;mutation 2, Medical College of Wisconsin
1579887 Adipoqm3Mcwi adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L119P mutation is generated from the codon change CTG/CCG 2006-05-24 2006-05-24 628748 Adipoq RGSC 3.4 11 79908291 79911065 - Adipoqm3Mcwi
1579887 Adipoqm3Mcwi adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L119P mutation is generated from the codon change CTG/CCG 2006-05-24 2006-05-24 628748 Adipoq Rnor_5.0 11 84363940 84382663 - Adipoqm3Mcwi
1579887 Adipoqm3Mcwi adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L119P mutation is generated from the codon change CTG/CCG 2006-05-24 2006-05-24 628748 Adipoq Rnor_6.0 11 81330845 81344488 - Adipoqm3Mcwi
5687709 Adipoqem1Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232) 2012-02-09 2012-02-09 628748 Adipoq RGSC 3.4 11 79908291 79911065 - Adipoqem1Mcwi
5687709 Adipoqem1Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232) 2012-02-09 2012-02-09 628748 Adipoq Rnor_5.0 11 84363940 84382663 - Adipoqem1Mcwi
5687709 Adipoqem1Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232) 2012-02-09 2012-02-09 628748 Adipoq Rnor_6.0 11 81330845 81344488 - Adipoqem1Mcwi
5687716 Adipoqem2Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 1 (del 226-229) 2012-02-09 2012-02-09 628748 Adipoq RGSC 3.4 11 79908291 79911065 - Adipoqem2Mcwi
5687716 Adipoqem2Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 1 (del 226-229) 2012-02-09 2012-02-09 628748 Adipoq Rnor_5.0 11 84363940 84382663 - Adipoqem2Mcwi
5687716 Adipoqem2Mcwi adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 1 (del 226-229) 2012-02-09 2012-02-09 628748 Adipoq Rnor_6.0 11 81330845 81344488 - Adipoqem2Mcwi
10054243 Adora1em3Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Adora1 gene 2015-07-30 2016-10-19 2048 Adora1 RGSC 3.4 13 47160292 47192804 - Adora1em3Mcwi;adenosine A1 receptor;Adora1em1Mcwi;CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
10054243 Adora1em3Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Adora1 gene 2015-07-30 2016-10-19 2048 Adora1 Rnor_5.0 13 56097883 56132155 - Adora1em3Mcwi;adenosine A1 receptor;Adora1em1Mcwi;CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
10054243 Adora1em3Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Adora1 gene 2015-07-30 2016-10-19 2048 Adora1 Rnor_6.0 13 51042111 51076913 - Adora1em3Mcwi;adenosine A1 receptor;Adora1em1Mcwi;CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
10054282 Adora1em4Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 34-bp deletion in the Adora1 gene 2015-08-03 2016-10-19 2048 Adora1 RGSC 3.4 13 47160292 47192804 - Adora1em4Mcwi
10054282 Adora1em4Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 34-bp deletion in the Adora1 gene 2015-08-03 2016-10-19 2048 Adora1 Rnor_5.0 13 56097883 56132155 - Adora1em4Mcwi
10054282 Adora1em4Mcwi adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 34-bp deletion in the Adora1 gene 2015-08-03 2016-10-19 2048 Adora1 Rnor_6.0 13 51042111 51076913 - Adora1em4Mcwi
1581476 Adora2am1Mcwi adenosine A2a receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C249S mutation is generated from the codon change TGT/AGT 2006-10-06 2006-10-06 2049 Adora2a RGSC 3.4 20 13815719 13834131 - Adora2am1Mcwi
1581476 Adora2am1Mcwi adenosine A2a receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C249S mutation is generated from the codon change TGT/AGT 2006-10-06 2006-10-06 2049 Adora2a Rnor_5.0 20 16449385 16466147 - Adora2am1Mcwi
1581476 Adora2am1Mcwi adenosine A2a receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C249S mutation is generated from the codon change TGT/AGT 2006-10-06 2006-10-06 2049 Adora2a Rnor_6.0 20 14265251 14282873 - Adora2am1Mcwi
1599561 Adora2am2Mcwi adenosine A2a receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q310L mutation is generated from the codon change CAG/CTG 2007-02-07 2007-02-07 2049 Adora2a RGSC 3.4 20 13815719 13834131 - Adora2am2Mcwi
1599561 Adora2am2Mcwi adenosine A2a receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q310L mutation is generated from the codon change CAG/CTG 2007-02-07 2007-02-07 2049 Adora2a Rnor_5.0 20 16449385 16466147 - Adora2am2Mcwi
1599561 Adora2am2Mcwi adenosine A2a receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q310L mutation is generated from the codon change CAG/CTG 2007-02-07 2007-02-07 2049 Adora2a Rnor_6.0 20 14265251 14282873 - Adora2am2Mcwi
1642070 Adora2am3Mcwi adenosine A2a receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E207K mutation is generated from the codon change GAG/AAG 2007-08-31 2007-08-31 2049 Adora2a RGSC 3.4 20 13815719 13834131 - Adora2am3Mcwi
1642070 Adora2am3Mcwi adenosine A2a receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E207K mutation is generated from the codon change GAG/AAG 2007-08-31 2007-08-31 2049 Adora2a Rnor_5.0 20 16449385 16466147 - Adora2am3Mcwi
1642070 Adora2am3Mcwi adenosine A2a receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E207K mutation is generated from the codon change GAG/AAG 2007-08-31 2007-08-31 2049 Adora2a Rnor_6.0 20 14265251 14282873 - Adora2am3Mcwi
10054285 Adora2aem3Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 98-bp deletion in the Adora2a gene 2015-08-03 2016-10-19 2049 Adora2a RGSC 3.4 20 13815719 13834131 - Adora2aem3Mcwi
10054285 Adora2aem3Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 98-bp deletion in the Adora2a gene 2015-08-03 2016-10-19 2049 Adora2a Rnor_5.0 20 16449385 16466147 - Adora2aem3Mcwi
10054285 Adora2aem3Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 98-bp deletion in the Adora2a gene 2015-08-03 2016-10-19 2049 Adora2a Rnor_6.0 20 14265251 14282873 - Adora2aem3Mcwi
10059571 Adora2aem5Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene 2015-08-19 2016-10-19 2049 Adora2a RGSC 3.4 20 13815719 13834131 - Adora2aem5Mcwi
10059571 Adora2aem5Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene 2015-08-19 2016-10-19 2049 Adora2a Rnor_5.0 20 16449385 16466147 - Adora2aem5Mcwi
10059571 Adora2aem5Mcwi adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene 2015-08-19 2016-10-19 2049 Adora2a Rnor_6.0 20 14265251 14282873 - Adora2aem5Mcwi
5687729 Adora2bem1Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 114-bp deletion in exon 1 (del 141-254) 2012-02-09 2012-02-09 2050 Adora2b RGSC 3.4 10 48421592 48437967 + Adora2bem1Mcwi
5687729 Adora2bem1Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 114-bp deletion in exon 1 (del 141-254) 2012-02-09 2012-02-09 2050 Adora2b Rnor_5.0 10 48358068 48374871 + Adora2bem1Mcwi
5687729 Adora2bem1Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 114-bp deletion in exon 1 (del 141-254) 2012-02-09 2012-02-09 2050 Adora2b Rnor_6.0 10 48569563 48586366 + Adora2bem1Mcwi
5687698 Adora2bem2Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 162-bp deletion in exon 1 (del 96-257) 2012-02-09 2012-02-09 2050 Adora2b RGSC 3.4 10 48421592 48437967 + Adora2bem2Mcwi
5687698 Adora2bem2Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 162-bp deletion in exon 1 (del 96-257) 2012-02-09 2012-02-09 2050 Adora2b Rnor_5.0 10 48358068 48374871 + Adora2bem2Mcwi
5687698 Adora2bem2Mcwi adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 162-bp deletion in exon 1 (del 96-257) 2012-02-09 2012-02-09 2050 Adora2b Rnor_6.0 10 48569563 48586366 + Adora2bem2Mcwi
1578792 Adra1am1Mcwi adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G393V mutation is generated 2006-05-02 2006-05-02 2055 Adra1a RGSC 3.4 15 46173429 46263198 + Adra1am1Mcwi
1578792 Adra1am1Mcwi adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G393V mutation is generated 2006-05-02 2006-05-02 2055 Adra1a Rnor_5.0 15 48197628 48297316 - Adra1am1Mcwi
1578792 Adra1am1Mcwi adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G393V mutation is generated 2006-05-02 2006-05-02 2055 Adra1a Rnor_6.0 15 43296997 43398314 + Adra1am1Mcwi
5509986 Adra2aem1Mcwi adrenergic, alpha-2A-, receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 2 (del 514-520) 2011-11-16 2011-11-16 2056 Adra2a Rnor_5.0 1 282178475 282181275 + Adra2aem1Mcwi
5509986 Adra2aem1Mcwi adrenergic, alpha-2A-, receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 2 (del 514-520) 2011-11-16 2011-11-16 2056 Adra2a Rnor_6.0 1 274766283 274769083 + Adra2aem1Mcwi
2313461 Agbl4Tn(sb-T2/Bart3)2.337Mcwi ATP/GTP binding protein-like 4; transposon insertion 2.337, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene 2009-09-28 2009-09-28 6493177 Agbl4 Rnor_5.0 5 134582789 135484937 + Agbl4Tn(sb-T2/Bart3)2.337Mcwi
2313461 Agbl4Tn(sb-T2/Bart3)2.337Mcwi ATP/GTP binding protein-like 4; transposon insertion 2.337, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene 2009-09-28 2009-09-28 6493177 Agbl4 Rnor_6.0 5 130742297 131656581 + Agbl4Tn(sb-T2/Bart3)2.337Mcwi
5508331 Agtr1aem1Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp frameshift deletion in exon 3 (del 521-523) 2011-10-13 2011-10-13 2070 Agtr1a RGSC 3.4 17 40629318 40684982 - Agtr1aem1Mcwi
5508331 Agtr1aem1Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp frameshift deletion in exon 3 (del 521-523) 2011-10-13 2011-10-13 2070 Agtr1a Rnor_5.0 17 37217810 37270540 - Agtr1aem1Mcwi
5508331 Agtr1aem1Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp frameshift deletion in exon 3 (del 521-523) 2011-10-13 2011-10-13 2070 Agtr1a Rnor_6.0 17 35907102 35958136 - Agtr1aem1Mcwi
5508318 Agtr1aem5Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 3 (del 517-535) 2011-10-13 2011-10-13 2070 Agtr1a RGSC 3.4 17 40629318 40684982 - Agtr1aem5Mcwi
5508318 Agtr1aem5Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 3 (del 517-535) 2011-10-13 2011-10-13 2070 Agtr1a Rnor_5.0 17 37217810 37270540 - Agtr1aem5Mcwi
5508318 Agtr1aem5Mcwi angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 3 (del 517-535) 2011-10-13 2011-10-13 2070 Agtr1a Rnor_6.0 17 35907102 35958136 - Agtr1aem5Mcwi
1578784 Agtr1bm1Mcwi angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); a 3bp deletion generates a mutation at TTC (del251F) 2006-05-02 2006-05-02 2071 Agtr1b RGSC 3.4 2 105503269 105602591 - Agtr1bm1Mcwi;Agtr1m1Mcwi;Angiotensin receptor, type1;mutation 1, Medical College of Wisconsin
1578784 Agtr1bm1Mcwi angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); a 3bp deletion generates a mutation at TTC (del251F) 2006-05-02 2006-05-02 2071 Agtr1b Rnor_5.0 2 124879262 124954378 - Agtr1bm1Mcwi;Agtr1m1Mcwi;Angiotensin receptor, type1;mutation 1, Medical College of Wisconsin
1578784 Agtr1bm1Mcwi angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); a 3bp deletion generates a mutation at TTC (del251F) 2006-05-02 2006-05-02 2071 Agtr1b Rnor_6.0 2 105149020 105224335 - Agtr1bm1Mcwi;Agtr1m1Mcwi;Angiotensin receptor, type1;mutation 1, Medical College of Wisconsin
5143963 Agtrapem4Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157844-165157927) 2011-07-27 2011-07-27 1359346 Agtrap RGSC 3.4 5 165154252 165164570 - Agtrapem4Mcwi
5143963 Agtrapem4Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157844-165157927) 2011-07-27 2011-07-27 1359346 Agtrap Rnor_5.0 5 168546202 168556520 - Agtrapem4Mcwi
5143963 Agtrapem4Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157844-165157927) 2011-07-27 2011-07-27 1359346 Agtrap Rnor_6.0 5 164888069 164898387 - Agtrapem4Mcwi
5143970 Agtrapem8Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157761-165157860) 2011-07-27 2011-07-27 1359346 Agtrap RGSC 3.4 5 165154252 165164570 - Agtrapem8Mcwi
5143970 Agtrapem8Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157761-165157860) 2011-07-27 2011-07-27 1359346 Agtrap Rnor_5.0 5 168546202 168556520 - Agtrapem8Mcwi
5143970 Agtrapem8Mcwi angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157761-165157860) 2011-07-27 2011-07-27 1359346 Agtrap Rnor_6.0 5 164888069 164898387 - Agtrapem8Mcwi
401940199 Ahrem1Iexas aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas The allele was created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . 2024-01-08 2024-01-08 2074 Ahr RGSC 3.4 6 54205104 54240268 -
401940199 Ahrem1Iexas aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas The allele was created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . 2024-01-08 2024-01-08 2074 Ahr Rnor_5.0 6 64589066 64624078 -
401940199 Ahrem1Iexas aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas The allele was created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . 2024-01-08 2024-01-08 2074 Ahr Rnor_6.0 6 54963990 55001806 -
12903271 Ahrem1Sage aryl hydrocarbon receptor; ZFN induced mutant1, Sage This ZFN allele contains a 760-bp deletion in the rat Ahr gene. 2017-05-10 2017-05-10 2074 Ahr RGSC 3.4 6 54205104 54240268 - aryl hydrocarbon receptor; endonuclease induced mutant1, SAGE;Ahrem1Sage
12903271 Ahrem1Sage aryl hydrocarbon receptor; ZFN induced mutant1, Sage This ZFN allele contains a 760-bp deletion in the rat Ahr gene. 2017-05-10 2017-05-10 2074 Ahr Rnor_5.0 6 64589066 64624078 - aryl hydrocarbon receptor; endonuclease induced mutant1, SAGE;Ahrem1Sage
12903271 Ahrem1Sage aryl hydrocarbon receptor; ZFN induced mutant1, Sage This ZFN allele contains a 760-bp deletion in the rat Ahr gene. 2017-05-10 2017-05-10 2074 Ahr Rnor_6.0 6 54963990 55001806 - aryl hydrocarbon receptor; endonuclease induced mutant1, SAGE;Ahrem1Sage
13702081 Ahrem1Soar aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. 2018-07-16 2018-07-16 2074 Ahr RGSC 3.4 6 54205104 54240268 -
13702081 Ahrem1Soar aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. 2018-07-16 2018-07-16 2074 Ahr Rnor_5.0 6 64589066 64624078 -
13702081 Ahrem1Soar aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. 2018-07-16 2018-07-16 2074 Ahr Rnor_6.0 6 54963990 55001806 -
126790510 Ahrem2Sage aryl hydrocarbon receptor; ZFN induced mutant2, Sage ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene. The ZFN system was injected to embryos from outbred Sprague Dawle from Harlan and one founder contained a 29-bp deletion in the rat Ahr gene. The deletion resulted in a premature stop codon within exon 2. 2021-04-23 2021-04-23 2074 Ahr RGSC 3.4 6 54205104 54240268 -
126790510 Ahrem2Sage aryl hydrocarbon receptor; ZFN induced mutant2, Sage ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene. The ZFN system was injected to embryos from outbred Sprague Dawle from Harlan and one founder contained a 29-bp deletion in the rat Ahr gene. The deletion resulted in a premature stop codon within exon 2. 2021-04-23 2021-04-23 2074 Ahr Rnor_5.0 6 64589066 64624078 -
126790510 Ahrem2Sage aryl hydrocarbon receptor; ZFN induced mutant2, Sage ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene. The ZFN system was injected to embryos from outbred Sprague Dawle from Harlan and one founder contained a 29-bp deletion in the rat Ahr gene. The deletion resulted in a premature stop codon within exon 2. 2021-04-23 2021-04-23 2074 Ahr Rnor_6.0 6 54963990 55001806 -
152999024 Aif1tm(EGFP)Apps allograft inflammatory factor 1; target mutant 1,Apps Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. 2022-07-18 2022-07-18 61924 Aif1 RGSC 3.4 20 3714428 3716327 +
152999024 Aif1tm(EGFP)Apps allograft inflammatory factor 1; target mutant 1,Apps Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. 2022-07-18 2022-07-18 61924 Aif1 Rnor_5.0 20 7234609 7240454 -
152999024 Aif1tm(EGFP)Apps allograft inflammatory factor 1; target mutant 1,Apps Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. 2022-07-18 2022-07-18 61924 Aif1 Rnor_6.0 20 5161350 5167176 -
38599148 Aireem1Ang autoimmune regulator; ZFN induced mutant1, Ang The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 2020-09-09 2020-09-09 1311139 Aire RGSC 3.4 20 10980031 10996102 +
38599148 Aireem1Ang autoimmune regulator; ZFN induced mutant1, Ang The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 2020-09-09 2020-09-09 1311139 Aire Rnor_5.0 20 13535776 13550486 +
38599148 Aireem1Ang autoimmune regulator; ZFN induced mutant1, Ang The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 2020-09-09 2020-09-09 1311139 Aire Rnor_6.0 20 11365630 11380636 +
158013767 Akt1em1Soar AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar This Akt mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. 2023-03-16 2023-03-16 2081 Akt1 RGSC 3.4 6 137640482 137657552 -
158013767 Akt1em1Soar AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar This Akt mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. 2023-03-16 2023-03-16 2081 Akt1 Rnor_5.0 6 146225955 146247008 -
158013767 Akt1em1Soar AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar This Akt mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. 2023-03-16 2023-03-16 2081 Akt1 Rnor_6.0 6 137218398 137239970 -
5131907 Aldh2em2Mcwi aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 7-bp frameshift deletion in exon 4 (del 431-437). 2011-05-16 2011-05-16 69219 Aldh2 RGSC 3.4 12 36081778 36116445 + Aldh2em2Mcwi
5131907 Aldh2em2Mcwi aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 7-bp frameshift deletion in exon 4 (del 431-437). 2011-05-16 2011-05-16 69219 Aldh2 Rnor_5.0 12 42334057 42366049 + Aldh2em2Mcwi
5131907 Aldh2em2Mcwi aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 7-bp frameshift deletion in exon 4 (del 431-437). 2011-05-16 2011-05-16 69219 Aldh2 Rnor_6.0 12 40466418 40498813 + Aldh2em2Mcwi
5131906 Alms1em1Mcwi Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 1 (del 429-445). 2011-05-16 2011-05-16 1311590 Alms1 RGSC 3.4 4 119846037 119946085 + Alms1em1Mcwi
5131906 Alms1em1Mcwi Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 1 (del 429-445). 2011-05-16 2011-05-16 1311590 Alms1 Rnor_5.0 4 181947469 182048235 + Alms1em1Mcwi
5131906 Alms1em1Mcwi Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 1 (del 429-445). 2011-05-16 2011-05-16 1311590 Alms1 Rnor_6.0 4 117371544 117472310 + Alms1em1Mcwi
127345127 Angptl8em1Kyo angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for this allele. A 7-bp deletion mutation was identified. 2021-07-09 2021-07-09 2320121 Angptl8 RGSC 3.4 8 20948070 20950087 +
127345127 Angptl8em1Kyo angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for this allele. A 7-bp deletion mutation was identified. 2021-07-09 2021-07-09 2320121 Angptl8 Rnor_5.0 8 22910979 22913005 +
127345127 Angptl8em1Kyo angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for this allele. A 7-bp deletion mutation was identified. 2021-07-09 2021-07-09 2320121 Angptl8 Rnor_6.0 8 22855495 22858565 +
11534996 Anks6PKD ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease This allele is a spontaneous missense mutant found in a polycystic kidney diseased male Sprague Dawley rat. The mutation was a C to T transition that replaced an arginine with a tryptophan at amino acid 823 in the protein sequence. 2016-09-16 2017-07-21 3334 Anks6 RGSC 3.4 5 63633540 63674953 - Anks6 PKD(p.R823W);Anks6 PKD;Anks6 PKD
11534996 Anks6PKD ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease This allele is a spontaneous missense mutant found in a polycystic kidney diseased male Sprague Dawley rat. The mutation was a C to T transition that replaced an arginine with a tryptophan at amino acid 823 in the protein sequence. 2016-09-16 2017-07-21 3334 Anks6 Rnor_5.0 5 67163440 67204853 - Anks6 PKD(p.R823W);Anks6 PKD;Anks6 PKD
11534996 Anks6PKD ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease This allele is a spontaneous missense mutant found in a polycystic kidney diseased male Sprague Dawley rat. The mutation was a C to T transition that replaced an arginine with a tryptophan at amino acid 823 in the protein sequence. 2016-09-16 2017-07-21 3334 Anks6 Rnor_6.0 5 62642974 62684387 - Anks6 PKD(p.R823W);Anks6 PKD;Anks6 PKD
2303975 Ano3Tn(sb-T2/Bart3)2.307Mcwi anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene 2009-03-03 2009-03-03 1308873 Ano3 RGSC 3.4 3 96123925 96237157 - transmembrane protein 16C;Tmem16cTn(sb-T2/Bart3)2.307Mcwi;transposon insertion 2.307, Medical College of Wisconsin;Ano3Tn(sb-T2/Bart3)2.307Mcwi
2303975 Ano3Tn(sb-T2/Bart3)2.307Mcwi anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene 2009-03-03 2009-03-03 1308873 Ano3 Rnor_5.0 3 108441370 108751911 - transmembrane protein 16C;Tmem16cTn(sb-T2/Bart3)2.307Mcwi;transposon insertion 2.307, Medical College of Wisconsin;Ano3Tn(sb-T2/Bart3)2.307Mcwi
2303975 Ano3Tn(sb-T2/Bart3)2.307Mcwi anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene 2009-03-03 2009-03-03 1308873 Ano3 Rnor_6.0 3 101843516 102203368 - transmembrane protein 16C;Tmem16cTn(sb-T2/Bart3)2.307Mcwi;transposon insertion 2.307, Medical College of Wisconsin;Ano3Tn(sb-T2/Bart3)2.307Mcwi
1554322 ApcPirc APC, WNT signaling pathway regulator; polyposis in the rat colon Pirc allele of the adenomatous polyposis coli gene; associated with Pirc-polyposis in colon. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam). 2005-10-19 2005-10-19 2123 Apc RGSC 3.4 18 26732147 26790383 + apcam1137;ApcPirc;adenomatous polyposis coli;APC, WNT signaling pathway regulator
1554322 ApcPirc APC, WNT signaling pathway regulator; polyposis in the rat colon Pirc allele of the adenomatous polyposis coli gene; associated with Pirc-polyposis in colon. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam). 2005-10-19 2005-10-19 2123 Apc Rnor_5.0 18 26725560 26820837 + apcam1137;ApcPirc;adenomatous polyposis coli;APC, WNT signaling pathway regulator
1554322 ApcPirc APC, WNT signaling pathway regulator; polyposis in the rat colon Pirc allele of the adenomatous polyposis coli gene; associated with Pirc-polyposis in colon. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam). 2005-10-19 2005-10-19 2123 Apc Rnor_6.0 18 27011710 27106323 + apcam1137;ApcPirc;adenomatous polyposis coli;APC, WNT signaling pathway regulator
12792252 Apcm1Kyo APC, WNT signaling pathway regulator; mutant 1, Kyo A nonsense mutant, c. 7621C > A (p.S2523X) was induced by ethylnitrosourea mutagenesis (ENU). The truncated APC was deduced to lack part of the basic domain, an EB1-binding domain, and a PDZ domain, but retained an intact beta-catenin binding region. 2017-03-14 2017-03-14 2123 Apc RGSC 3.4 18 26732147 26790383 + ApcKAD;APC, WNT signaling pathway regulator;mutant 1;Apcm1;Apcm1Kyo
12792252 Apcm1Kyo APC, WNT signaling pathway regulator; mutant 1, Kyo A nonsense mutant, c. 7621C > A (p.S2523X) was induced by ethylnitrosourea mutagenesis (ENU). The truncated APC was deduced to lack part of the basic domain, an EB1-binding domain, and a PDZ domain, but retained an intact beta-catenin binding region. 2017-03-14 2017-03-14 2123 Apc Rnor_5.0 18 26725560 26820837 + ApcKAD;APC, WNT signaling pathway regulator;mutant 1;Apcm1;Apcm1Kyo
12792252 Apcm1Kyo APC, WNT signaling pathway regulator; mutant 1, Kyo A nonsense mutant, c. 7621C > A (p.S2523X) was induced by ethylnitrosourea mutagenesis (ENU). The truncated APC was deduced to lack part of the basic domain, an EB1-binding domain, and a PDZ domain, but retained an intact beta-catenin binding region. 2017-03-14 2017-03-14 2123 Apc Rnor_6.0 18 27011710 27106323 + ApcKAD;APC, WNT signaling pathway regulator;mutant 1;Apcm1;Apcm1Kyo
150429966 Apoa4em1Bcgen apolipoprotein A4; TALEN induced mutant 1, Bcgn TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. 2021-10-07 2021-10-07 2132 Apoa4 RGSC 3.4 8 49233142 49233431 +
150429966 Apoa4em1Bcgen apolipoprotein A4; TALEN induced mutant 1, Bcgn TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. 2021-10-07 2021-10-07 2132 Apoa4 Rnor_5.0 8 49163055 49165333 +
150429966 Apoa4em1Bcgen apolipoprotein A4; TALEN induced mutant 1, Bcgn TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. 2021-10-07 2021-10-07 2132 Apoa4 Rnor_6.0 8 50536983 50539371 +
150520190 Apoeem1Ejt apolipoprotein E; TALEN induced mutant 1, Ejt The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs) 2021-11-04 2021-11-04 2138 Apoe RGSC 3.4 1 79003634 79006387 -
150520190 Apoeem1Ejt apolipoprotein E; TALEN induced mutant 1, Ejt The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs) 2021-11-04 2021-11-04 2138 Apoe Rnor_5.0 1 81878372 81882298 -
150520190 Apoeem1Ejt apolipoprotein E; TALEN induced mutant 1, Ejt The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs) 2021-11-04 2021-11-04 2138 Apoe Rnor_6.0 1 80612894 80616820 -
12880022 Apoeem1Sage apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The mutant allele was created by targeting the exon 3 of rat Apoe. This mutant allele has a 16-bp deletion in the gene and resulted in loss of Apoe protein in homozygotes. 2017-05-01 2017-05-01 2138 Apoe RGSC 3.4 1 79003634 79006387 - apolipoprotein E; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Apoeem1Sage
12880022 Apoeem1Sage apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The mutant allele was created by targeting the exon 3 of rat Apoe. This mutant allele has a 16-bp deletion in the gene and resulted in loss of Apoe protein in homozygotes. 2017-05-01 2017-05-01 2138 Apoe Rnor_5.0 1 81878372 81882298 - apolipoprotein E; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Apoeem1Sage
12880022 Apoeem1Sage apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The mutant allele was created by targeting the exon 3 of rat Apoe. This mutant allele has a 16-bp deletion in the gene and resulted in loss of Apoe protein in homozygotes. 2017-05-01 2017-05-01 2138 Apoe Rnor_6.0 1 80612894 80616820 - apolipoprotein E; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Apoeem1Sage
5131918 Apoeem7Mcwi apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 15-bp frameshift deletion in exon 2 (del 161-175). 2011-05-16 2011-05-16 2138 Apoe RGSC 3.4 1 79003634 79006387 - Apoeem7Mcwi
5131918 Apoeem7Mcwi apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 15-bp frameshift deletion in exon 2 (del 161-175). 2011-05-16 2011-05-16 2138 Apoe Rnor_5.0 1 81878372 81882298 - Apoeem7Mcwi
5131918 Apoeem7Mcwi apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 15-bp frameshift deletion in exon 2 (del 161-175). 2011-05-16 2011-05-16 2138 Apoe Rnor_6.0 1 80612894 80616820 - Apoeem7Mcwi
5131915 Apoeem8Mcwi apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 24-bp frameshift deletion in exon 2 (del 148-171). 2011-05-16 2011-05-16 2138 Apoe RGSC 3.4 1 79003634 79006387 - Apoeem8Mcwi
5131915 Apoeem8Mcwi apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 24-bp frameshift deletion in exon 2 (del 148-171). 2011-05-16 2011-05-16 2138 Apoe Rnor_5.0 1 81878372 81882298 - Apoeem8Mcwi
5131915 Apoeem8Mcwi apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 24-bp frameshift deletion in exon 2 (del 148-171). 2011-05-16 2011-05-16 2138 Apoe Rnor_6.0 1 80612894 80616820 - Apoeem8Mcwi
7364878 Apoeem9Mcwi apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 (del 81879590-81879690). 2013-10-07 2013-10-07 2138 Apoe RGSC 3.4 1 79003634 79006387 - Apoeem9Mcwi
7364878 Apoeem9Mcwi apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 (del 81879590-81879690). 2013-10-07 2013-10-07 2138 Apoe Rnor_5.0 1 81878372 81882298 - Apoeem9Mcwi
7364878 Apoeem9Mcwi apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 (del 81879590-81879690). 2013-10-07 2013-10-07 2138 Apoe Rnor_6.0 1 80612894 80616820 - Apoeem9Mcwi
12880027 Appem1Sage amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs Homozygous knockout rats exhibit complete loss of protein 2017-05-01 2017-05-01 2139 App RGSC 3.4 11 24457855 24693851 - Appem1Sage
12880027 Appem1Sage amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs Homozygous knockout rats exhibit complete loss of protein 2017-05-01 2017-05-01 2139 App Rnor_5.0 11 28048897 28265250 - Appem1Sage
12880027 Appem1Sage amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs Homozygous knockout rats exhibit complete loss of protein 2017-05-01 2017-05-01 2139 App Rnor_6.0 11 24425013 24641872 - Appem1Sage
127284884 Aqp4em1Hrt aquaporin 4; TALEN induced mutant 1, Hrt The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate this Aqp4 deletion allele. TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. This allele was identified with 3-bp deletion. 2021-06-15 2021-06-15 2143 Aqp4 RGSC 3.4 18 6626313 6642766 -
127284884 Aqp4em1Hrt aquaporin 4; TALEN induced mutant 1, Hrt The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate this Aqp4 deletion allele. TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. This allele was identified with 3-bp deletion. 2021-06-15 2021-06-15 2143 Aqp4 Rnor_5.0 18 6720759 6737703 -
127284884 Aqp4em1Hrt aquaporin 4; TALEN induced mutant 1, Hrt The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate this Aqp4 deletion allele. TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. This allele was identified with 3-bp deletion. 2021-06-15 2021-06-15 2143 Aqp4 Rnor_6.0 18 6766009 6782757 -
10054289 Arhgef11em4Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 RGSC 3.4 2 179676236 179796785 + Arhgef11em4Mcwi
10054289 Arhgef11em4Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 Rnor_5.0 2 206384799 206507431 + Arhgef11em4Mcwi
10054289 Arhgef11em4Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 Rnor_6.0 2 186979850 187102523 + Arhgef11em4Mcwi
10054293 Arhgef11em5Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 RGSC 3.4 2 179676236 179796785 + Arhgef11em5Mcwi
10054293 Arhgef11em5Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 Rnor_5.0 2 206384799 206507431 + Arhgef11em5Mcwi
10054293 Arhgef11em5Mcwi Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp deletion in the Arhgef11 gene 2015-08-03 2016-10-19 619705 Arhgef11 Rnor_6.0 2 186979850 187102523 + Arhgef11em5Mcwi
14394519 Arid1bem1Mcwi AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. 2019-03-26 2019-03-26 708504 Arid1b RGSC 3.4 1 40012872 40324266 +
14394519 Arid1bem1Mcwi AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. 2019-03-26 2019-03-26 708504 Arid1b Rnor_5.0 1 47197399 47550032 +
14394519 Arid1bem1Mcwi AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. 2019-03-26 2019-03-26 708504 Arid1b Rnor_6.0 1 45923119 46232301 +
12792967 ArsbMPR arylsulfatase B; MPR mutant This allele is a spontaneously insertion (507insC) mutant found in the Ishibashi hairless rat strain. This insertion caused a frame shift mutation and premature termination at codon at 258. 2017-03-17 2017-03-17 2158 Arsb RGSC 3.4 2 24067560 24223821 + ArsbMPP;Arsbabd;ArsbMPR
12792967 ArsbMPR arylsulfatase B; MPR mutant This allele is a spontaneously insertion (507insC) mutant found in the Ishibashi hairless rat strain. This insertion caused a frame shift mutation and premature termination at codon at 258. 2017-03-17 2017-03-17 2158 Arsb Rnor_5.0 2 42559079 42717753 + ArsbMPP;Arsbabd;ArsbMPR
12792967 ArsbMPR arylsulfatase B; MPR mutant This allele is a spontaneously insertion (507insC) mutant found in the Ishibashi hairless rat strain. This insertion caused a frame shift mutation and premature termination at codon at 258. 2017-03-17 2017-03-17 2158 Arsb Rnor_6.0 2 23385154 23543028 + ArsbMPP;Arsbabd;ArsbMPR
12790597 Asic3em6Mcwi acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene 2017-02-17 2017-02-17 708578 Asic3 RGSC 3.4 4 6125614 6129660 - Asic3em6Mcwi
12790597 Asic3em6Mcwi acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene 2017-02-17 2017-02-17 708578 Asic3 Rnor_5.0 4 7300219 7304265 - Asic3em6Mcwi
12790597 Asic3em6Mcwi acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene 2017-02-17 2017-02-17 708578 Asic3 Rnor_6.0 4 7287868 7293295 - Asic3em6Mcwi
5144099 Asipem1Mcwi agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 172-176) 2011-07-29 2011-07-29 2003 Asip RGSC 3.4 3 145445175 145536831 + Asipem1Mcwi
5144099 Asipem1Mcwi agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 172-176) 2011-07-29 2011-07-29 2003 Asip Rnor_5.0 3 156860395 156949277 + Asipem1Mcwi
5144099 Asipem1Mcwi agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 172-176) 2011-07-29 2011-07-29 2003 Asip Rnor_6.0 3 150492010 150579870 + Asipem1Mcwi
12738467 Asipm1 agouti signaling protein, mutant1 This allele is a Spontaneous mutation of agouti (Asip) gene with resultant black coat color. 2017-02-06 2017-02-06 2003 Asip RGSC 3.4 3 145445175 145536831 + Asipm1
12738467 Asipm1 agouti signaling protein, mutant1 This allele is a Spontaneous mutation of agouti (Asip) gene with resultant black coat color. 2017-02-06 2017-02-06 2003 Asip Rnor_5.0 3 156860395 156949277 + Asipm1
12738467 Asipm1 agouti signaling protein, mutant1 This allele is a Spontaneous mutation of agouti (Asip) gene with resultant black coat color. 2017-02-06 2017-02-06 2003 Asip Rnor_6.0 3 150492010 150579870 + Asipm1
11564344 Aspaem31Kyo aspartoacylase;TALEN induced mutant 31,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa RGSC 3.4 10 60178509 60199207 - Aspaem31Kyo
11564344 Aspaem31Kyo aspartoacylase;TALEN induced mutant 31,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa Rnor_5.0 10 59578788 59627450 - Aspaem31Kyo
11564344 Aspaem31Kyo aspartoacylase;TALEN induced mutant 31,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa Rnor_6.0 10 59839693 59888244 - Aspaem31Kyo
11564348 Aspaem34Kyo aspartoacylase;TALEN induced mutant 34,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa RGSC 3.4 10 60178509 60199207 - Aspaem34Kyo
11564348 Aspaem34Kyo aspartoacylase;TALEN induced mutant 34,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa Rnor_5.0 10 59578788 59627450 - Aspaem34Kyo
11564348 Aspaem34Kyo aspartoacylase;TALEN induced mutant 34,Kyo TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. 2016-11-16 2016-11-16 621693 Aspa Rnor_6.0 10 59839693 59888244 - Aspaem34Kyo
149735571 Atg16l1em8Rrrc autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. 2021-07-23 2021-07-23 1310631 Atg16l1 RGSC 3.4 9 86712122 86747370 +
149735571 Atg16l1em8Rrrc autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. 2021-07-23 2021-07-23 1310631 Atg16l1 Rnor_5.0 9 94599174 94634551 +
149735571 Atg16l1em8Rrrc autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. 2021-07-23 2021-07-23 1310631 Atg16l1 Rnor_6.0 9 94879876 94915231 +
12879401 Atmem1Kyo ATM serine/threonine kinase; ZFN induced mutant 1, Kyo This mutant allele was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). 2017-04-18 2017-04-18 1593265 Atm RGSC 3.4 8 56894746 56996565 - Atmm1Kyo;Atmem1Kyo
12879401 Atmem1Kyo ATM serine/threonine kinase; ZFN induced mutant 1, Kyo This mutant allele was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). 2017-04-18 2017-04-18 1593265 Atm Rnor_5.0 8 56598503 56703115 - Atmm1Kyo;Atmem1Kyo
12879401 Atmem1Kyo ATM serine/threonine kinase; ZFN induced mutant 1, Kyo This mutant allele was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). 2017-04-18 2017-04-18 1593265 Atm Rnor_6.0 8 58015938 58119973 - Atmm1Kyo;Atmem1Kyo
12879395 Atmm1Kyo ATM serine/threonine kinase; ENU induced mutant 1, Kyo This allele is an rat Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P)) and was established by ENU mutagenesis using F344/NSlc strain. 2017-04-18 2017-04-18 1593265 Atm RGSC 3.4 8 56894746 56996565 - Atmm1Kyo
12879395 Atmm1Kyo ATM serine/threonine kinase; ENU induced mutant 1, Kyo This allele is an rat Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P)) and was established by ENU mutagenesis using F344/NSlc strain. 2017-04-18 2017-04-18 1593265 Atm Rnor_5.0 8 56598503 56703115 - Atmm1Kyo
12879395 Atmm1Kyo ATM serine/threonine kinase; ENU induced mutant 1, Kyo This allele is an rat Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P)) and was established by ENU mutagenesis using F344/NSlc strain. 2017-04-18 2017-04-18 1593265 Atm Rnor_6.0 8 58015938 58119973 - Atmm1Kyo
6484707 Atp2b1em2Mcwi ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. 2012-07-02 2012-07-02 621303 Atp2b1 RGSC 3.4 7 36493661 36600280 + Atp2b1em2Mcwi
6484707 Atp2b1em2Mcwi ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. 2012-07-02 2012-07-02 621303 Atp2b1 Rnor_5.0 7 41153926 41262537 + Atp2b1em2Mcwi
6484707 Atp2b1em2Mcwi ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. 2012-07-02 2012-07-02 621303 Atp2b1 Rnor_6.0 7 41114606 41223138 + Atp2b1em2Mcwi
11532742 Atp7bhts ATPase copper transporting beta; hepatitis This allele is a spontaneously deletion mutant found in LEC rats. The deletion removes at least 900 bp of the coding region at the 3' end, includes the crucial ATP binding domain and extends downstream of the gene. 2016-09-06 2017-07-21 2180 Atp7b RGSC 3.4 16 74607988 74680080 + Atphts;Atp7bhts;ATPase copper transporting beta, hepatitis
11532742 Atp7bhts ATPase copper transporting beta; hepatitis This allele is a spontaneously deletion mutant found in LEC rats. The deletion removes at least 900 bp of the coding region at the 3' end, includes the crucial ATP binding domain and extends downstream of the gene. 2016-09-06 2017-07-21 2180 Atp7b Rnor_5.0 16 74495179 74575822 + Atphts;Atp7bhts;ATPase copper transporting beta, hepatitis
11532742 Atp7bhts ATPase copper transporting beta; hepatitis This allele is a spontaneously deletion mutant found in LEC rats. The deletion removes at least 900 bp of the coding region at the 3' end, includes the crucial ATP binding domain and extends downstream of the gene. 2016-09-06 2017-07-21 2180 Atp7b Rnor_6.0 16 74865516 74944935 + Atphts;Atp7bhts;ATPase copper transporting beta, hepatitis
40902835 Atrnmv attractin; myelin vacuolation mutant This allele is a spontaneous tremor mutant identified in an outbred colony of Sprague-Dawley rats. A genomic deletion of rat Atrn gene, including exon 1 was identified in the MV/Opu rats (RGD:1559043)' This is a null mutation where no Atrn transcript was detected. 2020-12-14 2020-12-14 69063 Atrn RGSC 3.4 3 118539268 118701177 +
40902835 Atrnmv attractin; myelin vacuolation mutant This allele is a spontaneous tremor mutant identified in an outbred colony of Sprague-Dawley rats. A genomic deletion of rat Atrn gene, including exon 1 was identified in the MV/Opu rats (RGD:1559043)' This is a null mutation where no Atrn transcript was detected. 2020-12-14 2020-12-14 69063 Atrn Rnor_5.0 3 129934303 130067267 +
40902835 Atrnmv attractin; myelin vacuolation mutant This allele is a spontaneous tremor mutant identified in an outbred colony of Sprague-Dawley rats. A genomic deletion of rat Atrn gene, including exon 1 was identified in the MV/Opu rats (RGD:1559043)' This is a null mutation where no Atrn transcript was detected. 2020-12-14 2020-12-14 69063 Atrn Rnor_6.0 3 123434409 123567922 +
40902832 Atrnzi attractin;zitter mutant An 8-bp deletion at the splice donor site of intron 12 was identified in ZI/Kyo rats, which was expected to result in aberrant and unstable transcripts. 2020-12-14 2020-12-14 69063 Atrn RGSC 3.4 3 118539268 118701177 +
40902832 Atrnzi attractin;zitter mutant An 8-bp deletion at the splice donor site of intron 12 was identified in ZI/Kyo rats, which was expected to result in aberrant and unstable transcripts. 2020-12-14 2020-12-14 69063 Atrn Rnor_5.0 3 129934303 130067267 +
40902832 Atrnzi attractin;zitter mutant An 8-bp deletion at the splice donor site of intron 12 was identified in ZI/Kyo rats, which was expected to result in aberrant and unstable transcripts. 2020-12-14 2020-12-14 69063 Atrn Rnor_6.0 3 123434409 123567922 +
2314338 Auts2Tn(sb-T2/Bart3)2.344Mcwi autism susceptibility candidate 2; transposon insertion 2.344, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. 2009-11-11 2009-11-11 1309972 Auts2l1 RGSC 3.4 12 25518248 25541023 + Auts2Tn(sb-T2/Bart3)2.344Mcwi
13627261 Avpdi arginine vasopressin; diabetes insipidus mutant This spontaneous deletion was identified in Brattleboro rats. It consists of a single nucleotide deletion (c.delG316) in exon 2 of the vasopressin gene which results in an altered vasopressin precursor. 2018-06-12 2018-06-12 2184 Avp RGSC 3.4 3 118205007 118206985 -
13627261 Avpdi arginine vasopressin; diabetes insipidus mutant This spontaneous deletion was identified in Brattleboro rats. It consists of a single nucleotide deletion (c.delG316) in exon 2 of the vasopressin gene which results in an altered vasopressin precursor. 2018-06-12 2018-06-12 2184 Avp Rnor_5.0 3 129615610 129627147 -
13627261 Avpdi arginine vasopressin; diabetes insipidus mutant This spontaneous deletion was identified in Brattleboro rats. It consists of a single nucleotide deletion (c.delG316) in exon 2 of the vasopressin gene which results in an altered vasopressin precursor. 2018-06-12 2018-06-12 2184 Avp Rnor_6.0 3 123117482 123119460 -
13793377 Avpr2em4Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 RGSC 3.4 X 159821860 159823488 +
13793377 Avpr2em4Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 Rnor_5.0 1 152637074 152640726 -
13793377 Avpr2em4Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 Rnor_6.0 X 156889006 156892707 -
13793379 Avpr2em5Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 RGSC 3.4 X 159821860 159823488 +
13793379 Avpr2em5Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 Rnor_5.0 1 152637074 152640726 -
13793379 Avpr2em5Mcwi arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. 2018-10-03 2018-10-03 2186 Avpr2 Rnor_6.0 X 156889006 156892707 -
12790600 Axlem1Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl RGSC 3.4 1 80964751 80994300 - Axlem1Mcwi
12790600 Axlem1Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl Rnor_5.0 1 83812118 83840542 - Axlem1Mcwi
12790600 Axlem1Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl Rnor_6.0 1 82550892 82580761 - Axlem1Mcwi
12790605 Axlem2Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl RGSC 3.4 1 80964751 80994300 - Axlem2Mcwi
12790605 Axlem2Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl Rnor_5.0 1 83812118 83840542 - Axlem2Mcwi
12790605 Axlem2Mcwi Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene 2017-02-17 2017-02-17 620028 Axl Rnor_6.0 1 82550892 82580761 - Axlem2Mcwi
13782148 Bace1em1Sage This mutant allele was generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 2018-08-23 2018-08-23 2191 Bace1 RGSC 3.4 8 48817824 48839681 +
13782148 Bace1em1Sage This mutant allele was generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 2018-08-23 2018-08-23 2191 Bace1 Rnor_5.0 8 48766005 48788272 +
13782148 Bace1em1Sage This mutant allele was generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 2018-08-23 2018-08-23 2191 Bace1 Rnor_6.0 8 50140092 50162388 +
2302640 BbxTn(sb-T2/Bart3)2.291Mcwi bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. 2009-01-06 2009-01-06 1309769 Bbx RGSC 3.4 11 51655446 51799132 + BbxTn(sb-T2/Bart3)2.291Mcwi
2302640 BbxTn(sb-T2/Bart3)2.291Mcwi bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. 2009-01-06 2009-01-06 1309769 Bbx Rnor_5.0 11 56153038 56397255 + BbxTn(sb-T2/Bart3)2.291Mcwi
2302640 BbxTn(sb-T2/Bart3)2.291Mcwi bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. 2009-01-06 2009-01-06 1309769 Bbx Rnor_6.0 11 52983286 53228557 + BbxTn(sb-T2/Bart3)2.291Mcwi
5508329 Bcas3em4Mcwi breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654) 2011-10-13 2011-10-13 1560788 Bcas3 RGSC 3.4 10 73617547 74078190 + Bcas3em4Mcwi
5508329 Bcas3em4Mcwi breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654) 2011-10-13 2011-10-13 1560788 Bcas3 Rnor_5.0 10 72660671 73177317 + Bcas3em4Mcwi
5508329 Bcas3em4Mcwi breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654) 2011-10-13 2011-10-13 1560788 Bcas3 Rnor_6.0 10 72756548 73271851 + Bcas3em4Mcwi
5508329 Bcas3em4Mcwi breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654) 2011-10-13 2011-10-13 1560788 Bcas3 Rnor_6.0 10 72951303 73015309 + Bcas3em4Mcwi
6484708 Bcat1em2Mcwi branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5 2012-07-02 2012-07-02 2195 Bcat1 RGSC 3.4 4 182641517 182692917 - Bcat1em2Mcwi
6484708 Bcat1em2Mcwi branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5 2012-07-02 2012-07-02 2195 Bcat1 Rnor_5.0 4 243444839 243460481 - Bcat1em2Mcwi
6484708 Bcat1em2Mcwi branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5 2012-07-02 2012-07-02 2195 Bcat1 Rnor_5.0 4 243463299 243491574 - Bcat1em2Mcwi
6484708 Bcat1em2Mcwi branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5 2012-07-02 2012-07-02 2195 Bcat1 Rnor_6.0 4 179259305 179340021 - Bcat1em2Mcwi
1579889 Bdkrb2m1Mcwi bradykinin receptor B2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I214T mutation is generated 2006-05-24 2006-05-24 2201 Bdkrb2 RGSC 3.4 6 129744781 129748851 + Bdkrb2m1Mcwi
1579889 Bdkrb2m1Mcwi bradykinin receptor B2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I214T mutation is generated 2006-05-24 2006-05-24 2201 Bdkrb2 Rnor_5.0 6 138615812 138622272 + Bdkrb2m1Mcwi
1579889 Bdkrb2m1Mcwi bradykinin receptor B2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I214T mutation is generated 2006-05-24 2006-05-24 2201 Bdkrb2 Rnor_6.0 6 129399468 129429676 + Bdkrb2m1Mcwi
1599568 Bdkrb2m2Mcwi bradykinin receptor B2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E178V mutation is generated from the codon change GAA/GTA 2007-02-07 2007-02-07 2201 Bdkrb2 RGSC 3.4 6 129744781 129748851 + Bdkrb2m2Mcwi
1599568 Bdkrb2m2Mcwi bradykinin receptor B2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E178V mutation is generated from the codon change GAA/GTA 2007-02-07 2007-02-07 2201 Bdkrb2 Rnor_5.0 6 138615812 138622272 + Bdkrb2m2Mcwi
1599568 Bdkrb2m2Mcwi bradykinin receptor B2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E178V mutation is generated from the codon change GAA/GTA 2007-02-07 2007-02-07 2201 Bdkrb2 Rnor_6.0 6 129399468 129429676 + Bdkrb2m2Mcwi
12902622 Bdnfem1Sage brain-derived neurotrophic factor; ZFN induced mutant 1, Sage This is a ZFN induced knockout allele. Homozygous knockout rats exhibit complete loss of BDNF protein and have a lifespan of 2-3 days. 2017-05-09 2017-05-09 2202 Bdnf Rnor_5.0 3 107371329 107421908 + brain-derived neurotrophic factor; endonuclease induced mutant 1, SAGE;Bdnfem1Sage
12902622 Bdnfem1Sage brain-derived neurotrophic factor; ZFN induced mutant 1, Sage This is a ZFN induced knockout allele. Homozygous knockout rats exhibit complete loss of BDNF protein and have a lifespan of 2-3 days. 2017-05-09 2017-05-09 2202 Bdnf Rnor_6.0 3 100768637 100819216 + brain-derived neurotrophic factor; endonuclease induced mutant 1, SAGE;Bdnfem1Sage
1578788 Birc3m1Mcwi baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); W76G mutation is generated 2006-05-02 2006-05-02 621282 Birc3 RGSC 3.4 8 4682202 4696856 - Birc3m1Mcwi
1578788 Birc3m1Mcwi baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); W76G mutation is generated 2006-05-02 2006-05-02 621282 Birc3 Rnor_5.0 8 6047454 6075236 - Birc3m1Mcwi
1578788 Birc3m1Mcwi baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); W76G mutation is generated 2006-05-02 2006-05-02 621282 Birc3 Rnor_6.0 8 6048590 6076828 - Birc3m1Mcwi
1642178 Birc3m2Mcwi baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K170E mutation is generated from the codon change AAG/GAG 2007-09-06 2007-09-06 621282 Birc3 RGSC 3.4 8 4682202 4696856 - Birc3m2Mcwi
1642178 Birc3m2Mcwi baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K170E mutation is generated from the codon change AAG/GAG 2007-09-06 2007-09-06 621282 Birc3 Rnor_5.0 8 6047454 6075236 - Birc3m2Mcwi
1642178 Birc3m2Mcwi baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K170E mutation is generated from the codon change AAG/GAG 2007-09-06 2007-09-06 621282 Birc3 Rnor_6.0 8 6048590 6076828 - Birc3m2Mcwi
155598603 Bmal1em1Mcwi basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. 2022-10-18 2022-10-18 62003 Bmal1 RGSC 3.4 1 171062181 171162426 +
155598603 Bmal1em1Mcwi basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. 2022-10-18 2022-10-18 62003 Bmal1 Rnor_5.0 1 185007527 185105413 +
155598603 Bmal1em1Mcwi basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. 2022-10-18 2022-10-18 62003 Bmal1 Rnor_6.0 1 178039002 178137469 +
38501087 Bmpr2em1Ang bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates. 2020-08-17 2020-08-17 71082 Bmpr2 RGSC 3.4 9 58327587 58436057 +
38501087 Bmpr2em1Ang bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates. 2020-08-17 2020-08-17 71082 Bmpr2 Rnor_5.0 9 66371542 66486121 +
38501087 Bmpr2em1Ang bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates. 2020-08-17 2020-08-17 71082 Bmpr2 Rnor_6.0 9 66568074 66683019 +
14981587 Bmpr2em1Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage This ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. 2019-10-08 2019-10-08 71082 Bmpr2 RGSC 3.4 9 58327587 58436057 + Bmpr2em1Sage+/-
14981587 Bmpr2em1Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage This ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. 2019-10-08 2019-10-08 71082 Bmpr2 Rnor_5.0 9 66371542 66486121 + Bmpr2em1Sage+/-
14981587 Bmpr2em1Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage This ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. 2019-10-08 2019-10-08 71082 Bmpr2 Rnor_6.0 9 66568074 66683019 + Bmpr2em1Sage+/-
14981589 Bmpr2em2Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage This ZFN mutant rats was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. 2019-10-08 2019-10-08 71082 Bmpr2 RGSC 3.4 9 58327587 58436057 +
14981589 Bmpr2em2Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage This ZFN mutant rats was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. 2019-10-08 2019-10-08 71082 Bmpr2 Rnor_5.0 9 66371542 66486121 +
14981589 Bmpr2em2Sage bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage This ZFN mutant rats was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. 2019-10-08 2019-10-08 71082 Bmpr2 Rnor_6.0 9 66568074 66683019 +
728298 Brca1m1Uwm BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon 2003-11-13 2004-12-14 2218 Brca1 RGSC 3.4 10 90513630 90572676 - Brca1m1Uwm;Brca1m1Uwm
728298 Brca1m1Uwm BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon 2003-11-13 2004-12-14 2218 Brca1 Rnor_5.0 10 89192653 89252760 - Brca1m1Uwm;Brca1m1Uwm
728298 Brca1m1Uwm BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon 2003-11-13 2004-12-14 2218 Brca1 Rnor_6.0 10 89394821 89455093 - Brca1m1Uwm;Brca1m1Uwm
155631262 Brca1em1Kyo BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo CRISPR/Cas9 system was used to generate c.188T>A (p.L63X) mutation on exon 4 of rat Brca1. 2022-10-27 2022-10-27 2218 Brca1 RGSC 3.4 10 90513630 90572676 -
155631262 Brca1em1Kyo BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo CRISPR/Cas9 system was used to generate c.188T>A (p.L63X) mutation on exon 4 of rat Brca1. 2022-10-27 2022-10-27 2218 Brca1 Rnor_5.0 10 89192653 89252760 -
155631262 Brca1em1Kyo BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo CRISPR/Cas9 system was used to generate c.188T>A (p.L63X) mutation on exon 4 of rat Brca1. 2022-10-27 2022-10-27 2218 Brca1 Rnor_6.0 10 89394821 89455093 -
728326 Brca2m1Uwm BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon) 2003-11-13 2004-12-14 2219 Brca2 RGSC 3.4 12 4282952 4323693 - Brca2m1Uwm;Brca2m1Uwm
728326 Brca2m1Uwm BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon) 2003-11-13 2004-12-14 2219 Brca2 Rnor_5.0 12 490733 535090 + Brca2m1Uwm;Brca2m1Uwm
728326 Brca2m1Uwm BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon) 2003-11-13 2004-12-14 2219 Brca2 Rnor_6.0 12 503660 544754 + Brca2m1Uwm;Brca2m1Uwm
2290071 Brinp3Tn(sb-T2/Bart3)2.189Mcwi BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. 2008-02-26 2008-02-26 708421 Brinp3 RGSC 3.4 13 60584348 61024196 + Fam5cTn(sb-T2/Bart3)2.189Mcwi;Brinp3Tn(sb-T2/Bart3)2.189Mcwi
2290071 Brinp3Tn(sb-T2/Bart3)2.189Mcwi BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. 2008-02-26 2008-02-26 708421 Brinp3 Rnor_5.0 13 68507826 68938032 + Fam5cTn(sb-T2/Bart3)2.189Mcwi;Brinp3Tn(sb-T2/Bart3)2.189Mcwi
2290071 Brinp3Tn(sb-T2/Bart3)2.189Mcwi BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. 2008-02-26 2008-02-26 708421 Brinp3 Rnor_6.0 13 63526486 63959390 + Fam5cTn(sb-T2/Bart3)2.189Mcwi;Brinp3Tn(sb-T2/Bart3)2.189Mcwi
13838727 Bscl2m1Kyo BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo This ENU induced Bscl2 mutation was T to A transition at nucleotide 239 in the third exon of Bscl2 gene, resulted in a substitution of leucine at codon 20 by the stop codon (L20X), which is upstream of the first transmembrane domain. 2019-01-09 2019-01-09 1308135 Bscl2 RGSC 3.4 1 211509675 211518963 + Bscl2sko
13838727 Bscl2m1Kyo BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo This ENU induced Bscl2 mutation was T to A transition at nucleotide 239 in the third exon of Bscl2 gene, resulted in a substitution of leucine at codon 20 by the stop codon (L20X), which is upstream of the first transmembrane domain. 2019-01-09 2019-01-09 1308135 Bscl2 Rnor_5.0 1 231972073 231983764 + Bscl2sko
13838727 Bscl2m1Kyo BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo This ENU induced Bscl2 mutation was T to A transition at nucleotide 239 in the third exon of Bscl2 gene, resulted in a substitution of leucine at codon 20 by the stop codon (L20X), which is upstream of the first transmembrane domain. 2019-01-09 2019-01-09 1308135 Bscl2 Rnor_6.0 1 225035956 225046137 + Bscl2sko
10450488 Bsnem1Ionsz bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn 2016-01-14 2016-01-14 2223 Bsn RGSC 3.4 8 113364208 113455766 - Bsnem1Ionsz
10450488 Bsnem1Ionsz bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn 2016-01-14 2016-01-14 2223 Bsn Rnor_5.0 8 116227802 116319071 - Bsnem1Ionsz
10450488 Bsnem1Ionsz bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn 2016-01-14 2016-01-14 2223 Bsn Rnor_6.0 8 116873721 116965396 - Bsnem1Ionsz
10054297 Btg2em11Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Btg2 gene 2015-08-03 2016-10-03 2225 Btg2 RGSC 3.4 13 47026986 47030745 - Btg2em11Mcwi
10054297 Btg2em11Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Btg2 gene 2015-08-03 2016-10-03 2225 Btg2 Rnor_5.0 13 55966299 55970058 - Btg2em11Mcwi
10054297 Btg2em11Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Btg2 gene 2015-08-03 2016-10-03 2225 Btg2 Rnor_6.0 13 50913185 50916944 - Btg2em11Mcwi
10054302 Btg2em13Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the Btg2 gene 2015-08-04 2016-10-03 2225 Btg2 RGSC 3.4 13 47026986 47030745 - Btg2em13Mcwi
10054302 Btg2em13Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the Btg2 gene 2015-08-04 2016-10-03 2225 Btg2 Rnor_5.0 13 55966299 55970058 - Btg2em13Mcwi
10054302 Btg2em13Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the Btg2 gene 2015-08-04 2016-10-03 2225 Btg2 Rnor_6.0 13 50913185 50916944 - Btg2em13Mcwi
12798564 Btg2em21Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene 2017-03-27 2017-03-27 2225 Btg2 RGSC 3.4 13 47026986 47030745 - Btg2em21Mcwi
12798564 Btg2em21Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene 2017-03-27 2017-03-27 2225 Btg2 Rnor_5.0 13 55966299 55970058 - Btg2em21Mcwi
12798564 Btg2em21Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene 2017-03-27 2017-03-27 2225 Btg2 Rnor_6.0 13 50913185 50916944 - Btg2em21Mcwi
12798565 Btg2em24Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene. 2017-03-27 2017-03-27 2225 Btg2 RGSC 3.4 13 47026986 47030745 - Btg2em24Mcwi
12798565 Btg2em24Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene. 2017-03-27 2017-03-27 2225 Btg2 Rnor_5.0 13 55966299 55970058 - Btg2em24Mcwi
12798565 Btg2em24Mcwi BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene. 2017-03-27 2017-03-27 2225 Btg2 Rnor_6.0 13 50913185 50916944 - Btg2em24Mcwi
10054305 Btg2em7Mcwi BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. 2015-08-04 2016-10-03 2225 Btg2 RGSC 3.4 13 47026986 47030745 - Btg2em7Mcwi;BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin
10054305 Btg2em7Mcwi BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. 2015-08-04 2016-10-03 2225 Btg2 Rnor_5.0 13 55966299 55970058 - Btg2em7Mcwi;BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin
10054305 Btg2em7Mcwi BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. 2015-08-04 2016-10-03 2225 Btg2 Rnor_6.0 13 50913185 50916944 - Btg2em7Mcwi;BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin
630350568 C17h6orf52em1Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 1, Aek The CRISPR/Cas9 system was used to introduce a T insertion in exon 1 of C17h6orf52 gene causing a frameshift and predicated early truncation of the translated protein in an embryo from LH/MavRrrcAek (RGD:10755352) through electroporation. 2026-01-16 2026-01-16 1562963 C17h6orf52 RGSC 3.4 17 29733271 29746771 +
630350568 C17h6orf52em1Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 1, Aek The CRISPR/Cas9 system was used to introduce a T insertion in exon 1 of C17h6orf52 gene causing a frameshift and predicated early truncation of the translated protein in an embryo from LH/MavRrrcAek (RGD:10755352) through electroporation. 2026-01-16 2026-01-16 1562963 C17h6orf52 Rnor_5.0 17 23581681 23595498 +
630350568 C17h6orf52em1Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 1, Aek The CRISPR/Cas9 system was used to introduce a T insertion in exon 1 of C17h6orf52 gene causing a frameshift and predicated early truncation of the translated protein in an embryo from LH/MavRrrcAek (RGD:10755352) through electroporation. 2026-01-16 2026-01-16 1562963 C17h6orf52 Rnor_6.0 17 21600326 21615888 +
630350562 C17h6orf52em2Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Aek The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. A 13,593 bp-deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. 2026-01-15 2026-01-15 1562963 C17h6orf52 RGSC 3.4 17 29733271 29746771 +
630350562 C17h6orf52em2Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Aek The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. A 13,593 bp-deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. 2026-01-15 2026-01-15 1562963 C17h6orf52 Rnor_5.0 17 23581681 23595498 +
630350562 C17h6orf52em2Aek similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Aek The CRISPR/Cas9 system was used to delete the entire C17h6orf52 gene from LH/MavRrrcAek embryos. A 13,593 bp-deletion ranges on chromosome 17 from 23968511 to 23982103 in GRCr8 per NCBI blast - see attachment for sequence annotation. 2026-01-15 2026-01-15 1562963 C17h6orf52 Rnor_6.0 17 21600326 21615888 +
13800878 C17h6orf52em2Mcwi similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 editing excised one C nucleotide from position Chr17:23,767,016 and inserted eleven nucleotides resulting in a net insertion of 10 nucleotides in exon 2 of rat C17h6orf52. 2018-10-18 2018-10-18 1562963 C17h6orf52 RGSC 3.4 17 29733271 29746771 +
13800878 C17h6orf52em2Mcwi similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 editing excised one C nucleotide from position Chr17:23,767,016 and inserted eleven nucleotides resulting in a net insertion of 10 nucleotides in exon 2 of rat C17h6orf52. 2018-10-18 2018-10-18 1562963 C17h6orf52 Rnor_5.0 17 23581681 23595498 +
13800878 C17h6orf52em2Mcwi similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 editing excised one C nucleotide from position Chr17:23,767,016 and inserted eleven nucleotides resulting in a net insertion of 10 nucleotides in exon 2 of rat C17h6orf52. 2018-10-18 2018-10-18 1562963 C17h6orf52 Rnor_6.0 17 21600326 21615888 +
408364987 C1ql3em1Lian complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. 2024-11-08 2024-11-08 1591795 C1ql3 RGSC 3.4 17 87275167 87285484 -
408364987 C1ql3em1Lian complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. 2024-11-08 2024-11-08 1591795 C1ql3 Rnor_5.0 17 81939086 81945581 -
408364987 C1ql3em1Lian complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. 2024-11-08 2024-11-08 1591795 C1ql3 Rnor_6.0 17 80314186 80320681 -
149735372 C3em1Kyo complement C3; ZFN induced mutant 1, Kyo ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The pups were identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). 2021-07-20 2021-07-20 2232 C3 Rnor_5.0 9 8728465 8754412 +
149735372 C3em1Kyo complement C3; ZFN induced mutant 1, Kyo ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The pups were identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). 2021-07-20 2021-07-20 2232 C3 Rnor_6.0 9 9721137 9747084 +
19165134 C3em1Linf complement C3; CRISPR/Cas9 system induced mutant 1, Linf This knock out mutation was induced by injecting two single-guide RNA (sgRNA) targets and protospacer adjacent motifs (PAM) in rat C3 exon 2, to rat zygotes. The result mutation was an insertion of a premature stop codon and no protein was produced in the mutants. 2020-01-31 2020-01-31 2232 C3 Rnor_5.0 9 8728465 8754412 +
19165134 C3em1Linf complement C3; CRISPR/Cas9 system induced mutant 1, Linf This knock out mutation was induced by injecting two single-guide RNA (sgRNA) targets and protospacer adjacent motifs (PAM) in rat C3 exon 2, to rat zygotes. The result mutation was an insertion of a premature stop codon and no protein was produced in the mutants. 2020-01-31 2020-01-31 2232 C3 Rnor_6.0 9 9721137 9747084 +
645122556 C5em1Caob complement C5; CRISPR/Cas9 induced mutant1, Caob This allele was created by CRISPR-Cas9 technology resulting a 334-bp deletion in exon 3 of rat C5 gene. 2026-04-09 2026-04-09 2237 C5 RGSC 3.4 3 14011115 14102744 -
645122556 C5em1Caob complement C5; CRISPR/Cas9 induced mutant1, Caob This allele was created by CRISPR-Cas9 technology resulting a 334-bp deletion in exon 3 of rat C5 gene. 2026-04-09 2026-04-09 2237 C5 Rnor_5.0 3 19525468 19547636 -
645122556 C5em1Caob complement C5; CRISPR/Cas9 induced mutant1, Caob This allele was created by CRISPR-Cas9 technology resulting a 334-bp deletion in exon 3 of rat C5 gene. 2026-04-09 2026-04-09 2237 C5 Rnor_5.0 3 19369981 19432948 -
645122556 C5em1Caob complement C5; CRISPR/Cas9 induced mutant1, Caob This allele was created by CRISPR-Cas9 technology resulting a 334-bp deletion in exon 3 of rat C5 gene. 2026-04-09 2026-04-09 2237 C5 Rnor_6.0 3 14049993 14113931 -
645122556 C5em1Caob complement C5; CRISPR/Cas9 induced mutant1, Caob This allele was created by CRISPR-Cas9 technology resulting a 334-bp deletion in exon 3 of rat C5 gene. 2026-04-09 2026-04-09 2237 C5 Rnor_6.0 3 14206466 14229141 -
12880382 Cacna1agry calcium voltage-gated channel subunit alpha1 A; groggy mutant Groggy (gry) mutation was found in wistar rats and identified as 752T>A(M251K)in the rat Cacna1a gene. 2017-05-04 2017-05-04 2244 Cacna1a RGSC 3.4 19 25188170 25424495 - Cacna1agry
12880382 Cacna1agry calcium voltage-gated channel subunit alpha1 A; groggy mutant Groggy (gry) mutation was found in wistar rats and identified as 752T>A(M251K)in the rat Cacna1a gene. 2017-05-04 2017-05-04 2244 Cacna1a Rnor_5.0 19 36502533 36727039 + Cacna1agry
12880382 Cacna1agry calcium voltage-gated channel subunit alpha1 A; groggy mutant Groggy (gry) mutation was found in wistar rats and identified as 752T>A(M251K)in the rat Cacna1a gene. 2017-05-04 2017-05-04 2244 Cacna1a Rnor_6.0 19 25453236 25749550 + Cacna1agry
11568704 Cacna1cem1Sage calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Cacna1c into Sprague Dawley embryos. This allele contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6. 2016-12-13 2016-12-13 2245 Cacna1c RGSC 3.4 4 154895691 155517389 - Cacna1ctm1Sage;Cacna1cem1Sage
11568704 Cacna1cem1Sage calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Cacna1c into Sprague Dawley embryos. This allele contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6. 2016-12-13 2016-12-13 2245 Cacna1c Rnor_5.0 4 216562477 217184927 - Cacna1ctm1Sage;Cacna1cem1Sage
11568704 Cacna1cem1Sage calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Cacna1c into Sprague Dawley embryos. This allele contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6. 2016-12-13 2016-12-13 2245 Cacna1c Rnor_6.0 4 150635808 151270790 - Cacna1ctm1Sage;Cacna1cem1Sage
13782372 Cacna1f csnb calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. 2018-09-07 2018-09-07 621535 Cacna1f RGSC 3.4 X 26908850 26937165 -
13782372 Cacna1f csnb calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. 2018-09-07 2018-09-07 621535 Cacna1f Rnor_5.0 X 16504174 16532670 -
13782372 Cacna1f csnb calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. 2018-09-07 2018-09-07 621535 Cacna1f Rnor_6.0 X 15712709 15741135 -
1642168 Cacna1gm1Mcwi calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S490T mutation is generated from the codon change TCT/ACT 2007-09-06 2007-09-06 68942 Cacna1g RGSC 3.4 10 83043636 83112886 - Cacna1gm1Mcwi
1642168 Cacna1gm1Mcwi calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S490T mutation is generated from the codon change TCT/ACT 2007-09-06 2007-09-06 68942 Cacna1g Rnor_5.0 10 81950594 82017885 - Cacna1gm1Mcwi
1642168 Cacna1gm1Mcwi calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S490T mutation is generated from the codon change TCT/ACT 2007-09-06 2007-09-06 68942 Cacna1g Rnor_6.0 10 82129071 82197828 - Cacna1gm1Mcwi
6484703 Cacna1hem2Mcwi calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 11. 2012-07-02 2012-07-02 68943 Cacna1h RGSC 3.4 10 14621372 14679051 - Cacna1hem2Mcwi
6484703 Cacna1hem2Mcwi calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 11. 2012-07-02 2012-07-02 68943 Cacna1h Rnor_5.0 10 14547456 14605627 - Cacna1hem2Mcwi
6484703 Cacna1hem2Mcwi calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 11. 2012-07-02 2012-07-02 68943 Cacna1h Rnor_6.0 10 14730932 14789201 - Cacna1hem2Mcwi
2299116 Cadm1Tn(sb-T2/Bart3)2.229Mcwi cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. 2008-08-12 2008-08-12 1310999 Cadm1 RGSC 3.4 8 50765645 51108962 + Cadm1Tn(sb-T2/Bart3)2.229Mcwi
2299116 Cadm1Tn(sb-T2/Bart3)2.229Mcwi cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. 2008-08-12 2008-08-12 1310999 Cadm1 Rnor_5.0 8 50460752 50796128 + Cadm1Tn(sb-T2/Bart3)2.229Mcwi
2299116 Cadm1Tn(sb-T2/Bart3)2.229Mcwi cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. 2008-08-12 2008-08-12 1310999 Cadm1 Rnor_6.0 8 51858906 52200591 + Cadm1Tn(sb-T2/Bart3)2.229Mcwi
2290088 Cadm2Tn(sb-T2/Bart3)2.180Mcwi immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. 2008-02-26 2008-02-26 1305678 Cadm2 RGSC 3.4 11 4273771 5330393 - Igsf4dTn(sb-T2/Bart3)2.180Mcwi;Cadm2Tn(sb-T2/Bart3)2.180Mcwi
2290088 Cadm2Tn(sb-T2/Bart3)2.180Mcwi immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. 2008-02-26 2008-02-26 1305678 Cadm2 Rnor_5.0 11 7871257 8090100 - Igsf4dTn(sb-T2/Bart3)2.180Mcwi;Cadm2Tn(sb-T2/Bart3)2.180Mcwi
2290088 Cadm2Tn(sb-T2/Bart3)2.180Mcwi immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. 2008-02-26 2008-02-26 1305678 Cadm2 Rnor_6.0 11 4175078 4397335 - Igsf4dTn(sb-T2/Bart3)2.180Mcwi;Cadm2Tn(sb-T2/Bart3)2.180Mcwi
19259465 Camk2n1em1Tja calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja This 38-bp deletion mutant allele was generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1. 2020-02-06 2020-02-06 708430 Camk2n1 RGSC 3.4 5 157235534 157237314 +
19259465 Camk2n1em1Tja calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja This 38-bp deletion mutant allele was generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1. 2020-02-06 2020-02-06 708430 Camk2n1 Rnor_5.0 5 160625616 160627396 +
19259465 Camk2n1em1Tja calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja This 38-bp deletion mutant allele was generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1. 2020-02-06 2020-02-06 708430 Camk2n1 Rnor_6.0 5 156876706 156878486 +
2302642 Casp7Tn(sb-T2/Bart3)2.280Mcwi caspase 7; transposon insertion 2.280, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. 2009-01-06 2009-01-06 620944 Casp7 RGSC 3.4 1 262689300 262721591 + Casp7Tn(sb-T2/Bart3)2.280Mcwi
2302642 Casp7Tn(sb-T2/Bart3)2.280Mcwi caspase 7; transposon insertion 2.280, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. 2009-01-06 2009-01-06 620944 Casp7 Rnor_5.0 1 284572208 284623736 + Casp7Tn(sb-T2/Bart3)2.280Mcwi
2302642 Casp7Tn(sb-T2/Bart3)2.280Mcwi caspase 7; transposon insertion 2.280, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. 2009-01-06 2009-01-06 620944 Casp7 Rnor_6.0 1 277190557 277242779 + Casp7Tn(sb-T2/Bart3)2.280Mcwi
10054308 Casrem1Mcwi calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (T) insertion in the Casr gene; (RGSC 5.0/rn5): chr11:70,329,456-70,329,457 2015-08-04 2017-07-21 2277 Casr RGSC 3.4 11 66084169 66153292 - Casrem1Mcwi
10054308 Casrem1Mcwi calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (T) insertion in the Casr gene; (RGSC 5.0/rn5): chr11:70,329,456-70,329,457 2015-08-04 2017-07-21 2277 Casr Rnor_5.0 11 70278784 70352137 + Casrem1Mcwi
10054308 Casrem1Mcwi calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (T) insertion in the Casr gene; (RGSC 5.0/rn5): chr11:70,329,456-70,329,457 2015-08-04 2017-07-21 2277 Casr Rnor_6.0 11 67188204 67262261 + Casrem1Mcwi
150521525 Ccdc39em1Jgn coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. 2021-11-09 2021-11-09 1306277 Ccdc39 RGSC 3.4 2 120117112 120154958 -
150521525 Ccdc39em1Jgn coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. 2021-11-09 2021-11-09 1306277 Ccdc39 Rnor_5.0 2 139933049 139971476 -
150521525 Ccdc39em1Jgn coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. 2021-11-09 2021-11-09 1306277 Ccdc39 Rnor_6.0 2 120278605 120367829 -
2299113 Ccdc85aTn(sb-T2/Bart3)2.248Mcwi coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. 2008-08-12 2008-08-12 1311700 Ccdc85a RGSC 3.4 14 109197317 109434306 - Ccdc85aTn(sb-T2/Bart3)2.248Mcwi
2299113 Ccdc85aTn(sb-T2/Bart3)2.248Mcwi coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. 2008-08-12 2008-08-12 1311700 Ccdc85a Rnor_5.0 14 112609601 112636341 - Ccdc85aTn(sb-T2/Bart3)2.248Mcwi
2299113 Ccdc85aTn(sb-T2/Bart3)2.248Mcwi coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. 2008-08-12 2008-08-12 1311700 Ccdc85a Rnor_6.0 14 112719482 112900724 - Ccdc85aTn(sb-T2/Bart3)2.248Mcwi
11565090 Ccdc85cem1Kyo coiled-coil domain containing 85C; TALEN induced mutant1,Kyo TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. 2016-11-18 2016-11-18 1589818 Ccdc85c RGSC 3.4 6 132572485 132641431 - Ccdc85cem1Kyo
11565090 Ccdc85cem1Kyo coiled-coil domain containing 85C; TALEN induced mutant1,Kyo TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. 2016-11-18 2016-11-18 1589818 Ccdc85c Rnor_5.0 6 141284186 141353658 - Ccdc85cem1Kyo
11565090 Ccdc85cem1Kyo coiled-coil domain containing 85C; TALEN induced mutant1,Kyo TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. 2016-11-18 2016-11-18 1589818 Ccdc85c Rnor_6.0 6 132113806 132183434 - Ccdc85cem1Kyo
736530103 Ccl2em1Mcwi C-C motif chemokine ligand 2; CRISPR/Cas9 induced mutant 1, Mcwi This mutant allele carries a 40-bp deletion that produces a frameshift and a premature stop codon, disrupting the CC motif and “N-loop” sequences, and truncating CCL2 to 50 amino acids. 2026-06-12 2026-06-12 3645 Ccl2 RGSC 3.4 10 70256263 70258061 +
736530103 Ccl2em1Mcwi C-C motif chemokine ligand 2; CRISPR/Cas9 induced mutant 1, Mcwi This mutant allele carries a 40-bp deletion that produces a frameshift and a premature stop codon, disrupting the CC motif and “N-loop” sequences, and truncating CCL2 to 50 amino acids. 2026-06-12 2026-06-12 3645 Ccl2 Rnor_5.0 10 69047091 69048889 +
736530103 Ccl2em1Mcwi C-C motif chemokine ligand 2; CRISPR/Cas9 induced mutant 1, Mcwi This mutant allele carries a 40-bp deletion that produces a frameshift and a premature stop codon, disrupting the CC motif and “N-loop” sequences, and truncating CCL2 to 50 amino acids. 2026-06-12 2026-06-12 3645 Ccl2 Rnor_6.0 10 69412065 69413863 +
1579888 Ccr2m1Mcwi C-C motif chemokine receptor 2; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); N117S mutation is generated from the codon change AAT/AGT. 2006-05-24 2006-05-24 620876 Ccr2 RGSC 3.4 8 128892784 128893905 + Ccr2m1Mcwi
1642356 Ccr2m2Mcwi C-C motif chemokine receptor 2; mutation 2, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); I99T mutation is generated from the codon change ATC/ACC. 2007-09-13 2007-09-13 620876 Ccr2 RGSC 3.4 8 128892784 128893905 + Ccr2m2Mcwi
1581492 Ccr4m1Mcwi C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); I133V mutation is generated from the codon change ATA/GTA. 2006-10-06 2006-10-06 620594 Ccr4 RGSC 3.4 8 118883148 118884230 - Ccr4m1Mcwi
1581492 Ccr4m1Mcwi C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); I133V mutation is generated from the codon change ATA/GTA. 2006-10-06 2006-10-06 620594 Ccr4 Rnor_5.0 8 121843005 121848545 - Ccr4m1Mcwi
1581492 Ccr4m1Mcwi C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); I133V mutation is generated from the codon change ATA/GTA. 2006-10-06 2006-10-06 620594 Ccr4 Rnor_6.0 8 122530152 122535959 - Ccr4m1Mcwi
12790606 Cd14em1Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the exon 2 of rat Cd14 gene 2017-02-17 2017-02-17 620588 Cd14 RGSC 3.4 18 29374593 29376190 - Cd14em1Mcwi
12790606 Cd14em1Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the exon 2 of rat Cd14 gene 2017-02-17 2017-02-17 620588 Cd14 Rnor_5.0 18 29265328 29267236 - Cd14em1Mcwi
12790606 Cd14em1Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the exon 2 of rat Cd14 gene 2017-02-17 2017-02-17 620588 Cd14 Rnor_6.0 18 29560341 29562290 - Cd14em1Mcwi
12790611 Cd14em2Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a net 7-bp deletion in the rat Cd14 gene. 2017-02-17 2017-02-17 620588 Cd14 RGSC 3.4 18 29374593 29376190 - Cd14em2Mcwi
12790611 Cd14em2Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a net 7-bp deletion in the rat Cd14 gene. 2017-02-17 2017-02-17 620588 Cd14 Rnor_5.0 18 29265328 29267236 - Cd14em2Mcwi
12790611 Cd14em2Mcwi CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a net 7-bp deletion in the rat Cd14 gene. 2017-02-17 2017-02-17 620588 Cd14 Rnor_6.0 18 29560341 29562290 - Cd14em2Mcwi
2290158 Cd226Tn(sb-T2/Bart3)2.141Mcwi CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. 2008-02-26 2008-02-26 1311513 Cd226 RGSC 3.4 18 86064574 86157909 + Cd226Tn(sb-T2/Bart3)2.141Mcwi
2290158 Cd226Tn(sb-T2/Bart3)2.141Mcwi CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. 2008-02-26 2008-02-26 1311513 Cd226 Rnor_5.0 18 85337942 85433295 + Cd226Tn(sb-T2/Bart3)2.141Mcwi
2290158 Cd226Tn(sb-T2/Bart3)2.141Mcwi CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. 2008-02-26 2008-02-26 1311513 Cd226 Rnor_6.0 18 86299392 86394772 + Cd226Tn(sb-T2/Bart3)2.141Mcwi
5687703 Cd247em1Mcwi Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 1 (del 154-164) 2012-02-09 2012-02-09 2305 Cd247 RGSC 3.4 13 81515383 81594699 + Cd247em1Mcwi
5687703 Cd247em1Mcwi Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 1 (del 154-164) 2012-02-09 2012-02-09 2305 Cd247 Rnor_5.0 13 88876046 88951003 + Cd247em1Mcwi
5687703 Cd247em1Mcwi Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 1 (del 154-164) 2012-02-09 2012-02-09 2305 Cd247 Rnor_6.0 13 83996045 84071408 + Cd247em1Mcwi
5687730 Cd247em3Mcwi Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 155-167) 2012-02-09 2012-02-09 2305 Cd247 RGSC 3.4 13 81515383 81594699 + Cd247em3Mcwi
5687730 Cd247em3Mcwi Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 155-167) 2012-02-09 2012-02-09 2305 Cd247 Rnor_5.0 13 88876046 88951003 + Cd247em3Mcwi
5687730 Cd247em3Mcwi Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 155-167) 2012-02-09 2012-02-09 2305 Cd247 Rnor_6.0 13 83996045 84071408 + Cd247em3Mcwi
5687713 Cd247em5Mcwi Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 159-166) 2012-02-09 2012-02-09 2305 Cd247 RGSC 3.4 13 81515383 81594699 + Cd247em5Mcwi
5687713 Cd247em5Mcwi Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 159-166) 2012-02-09 2012-02-09 2305 Cd247 Rnor_5.0 13 88876046 88951003 + Cd247em5Mcwi
5687713 Cd247em5Mcwi Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 159-166) 2012-02-09 2012-02-09 2305 Cd247 Rnor_6.0 13 83996045 84071408 + Cd247em5Mcwi
640480084 Cd247em9Mcwi Cd247 molecule; CRIPSR/Cas9 induced mutant 9, Mcwi CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. The mutation was identifiedas a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) 2026-03-31 2026-03-31 2305 Cd247 RGSC 3.4 13 81515383 81594699 +
640480084 Cd247em9Mcwi Cd247 molecule; CRIPSR/Cas9 induced mutant 9, Mcwi CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. The mutation was identifiedas a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) 2026-03-31 2026-03-31 2305 Cd247 Rnor_5.0 13 88876046 88951003 +
640480084 Cd247em9Mcwi Cd247 molecule; CRIPSR/Cas9 induced mutant 9, Mcwi CRISPR/Cas9 mutagenesis was used to knockout Cd247 in the WAG/RijCmcr (WAG) strain. The mutation was identifiedas a 17-bp frame-shift indel mutation deleting GAATCCTCTTCATCTAC (rn6.0 chr13:84,064,185-84,064,201) 2026-03-31 2026-03-31 2305 Cd247 Rnor_6.0 13 83996045 84071408 +
14398461 Cd40em1Uthal CD40 molecule; ZFN induced mutant 1, Uthal Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein. 2019-04-18 2019-04-18 619830 Cd40 RGSC 3.4 3 156092602 156107427 +
14398461 Cd40em1Uthal CD40 molecule; ZFN induced mutant 1, Uthal Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein. 2019-04-18 2019-04-18 619830 Cd40 Rnor_5.0 3 167704285 167719416 +
14398461 Cd40em1Uthal CD40 molecule; ZFN induced mutant 1, Uthal Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein. 2019-04-18 2019-04-18 619830 Cd40 Rnor_6.0 3 161519789 161534943 +
13207495 Cd55em4Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 RGSC 3.4 13 43322246 43348334 - Cd55em4Mcwi
13207495 Cd55em4Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 Rnor_5.0 13 52177543 52206137 - Cd55em4Mcwi
13207495 Cd55em4Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 Rnor_6.0 13 47125156 47153557 - Cd55em4Mcwi
13207493 Cd55em6Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion and one C insertion, resulting in a net 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 RGSC 3.4 13 43322246 43348334 - Cd55em6Mcwi
13207493 Cd55em6Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion and one C insertion, resulting in a net 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 Rnor_5.0 13 52177543 52206137 - Cd55em6Mcwi
13207493 Cd55em6Mcwi CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion and one C insertion, resulting in a net 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 2017-08-02 2017-08-02 620651 Cd55 Rnor_6.0 13 47125156 47153557 - Cd55em6Mcwi
13792720 Cd59bem1Ask CD59b molecule; CRISPR/Cas9 induced mutant1, Ask The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. 2018-09-24 2018-09-24 2311 Cd59b RGSC 3.4 3 89243600 89245129 + CD59 molecule; CRISPR/Cas9 induced mutant1, Ask;Cd59em1Ask
13792720 Cd59bem1Ask CD59b molecule; CRISPR/Cas9 induced mutant1, Ask The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. 2018-09-24 2018-09-24 2311 Cd59b Rnor_5.0 3 100650411 100668036 + CD59 molecule; CRISPR/Cas9 induced mutant1, Ask;Cd59em1Ask
13792720 Cd59bem1Ask CD59b molecule; CRISPR/Cas9 induced mutant1, Ask The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. 2018-09-24 2018-09-24 2311 Cd59b Rnor_6.0 3 94010481 94028660 + CD59 molecule; CRISPR/Cas9 induced mutant1, Ask;Cd59em1Ask
5131919 Cdh13em1Mcwi cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 104-111). 2011-05-16 2011-05-16 619745 Cdh13 RGSC 3.4 19 48507173 49575123 + Cdh13em1Mcwi
5131919 Cdh13em1Mcwi cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 104-111). 2011-05-16 2011-05-16 619745 Cdh13 Rnor_5.0 19 61621434 62245798 + Cdh13em1Mcwi
5131919 Cdh13em1Mcwi cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 104-111). 2011-05-16 2011-05-16 619745 Cdh13 Rnor_5.0 19 62345236 62720155 + Cdh13em1Mcwi
5131919 Cdh13em1Mcwi cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 104-111). 2011-05-16 2011-05-16 619745 Cdh13 Rnor_6.0 19 50848793 51971618 + Cdh13em1Mcwi
626419670 Cdkl5em1Sidb cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb The CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. 2025-09-04 2025-09-04 2324133 Cdkl5 RGSC 3.4 X 55033499 55228646 +
626419670 Cdkl5em1Sidb cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb The CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. 2025-09-04 2025-09-04 2324133 Cdkl5 Rnor_5.0 X 35864921 36102409 +
626419670 Cdkl5em1Sidb cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb The CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression. 2025-09-04 2025-09-04 2324133 Cdkl5 Rnor_6.0 X 35536396 35773204 +
126928147 Cdkn1bem1Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 32-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b RGSC 3.4 4 171841705 171846506 + DEL-32
126928147 Cdkn1bem1Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 32-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b Rnor_5.0 4 232962218 232967323 + DEL-32
126928147 Cdkn1bem1Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 32-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b Rnor_6.0 4 168689043 168694159 + DEL-32
126928151 Cdkn1bem4Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 65-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b RGSC 3.4 4 171841705 171846506 +
126928151 Cdkn1bem4Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 65-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b Rnor_5.0 4 232962218 232967323 +
126928151 Cdkn1bem4Musc cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 65-bp deletion that disrupts the reading frame of the gene. 2021-06-01 2021-06-01 69062 Cdkn1b Rnor_6.0 4 168689043 168694159 +
12910941 Cdkn1bwe cyclin-dependent kinase inhibitor 1B; white eye mutation A tandem duplication of 8 nt in exon 2 of the rat Cdkn1b was identified in the Sprague-Dawley white eye mutant strain. The 8-nt insertion results in a frameshift after codon 177 (p. G177fs), predicting a different C-terminal domain containing 42 p27-unrelated amino acid residues. 2017-06-28 2017-06-28 69062 Cdkn1b RGSC 3.4 4 171841705 171846506 + p27-G177fs;Cdkn1bwe
12910941 Cdkn1bwe cyclin-dependent kinase inhibitor 1B; white eye mutation A tandem duplication of 8 nt in exon 2 of the rat Cdkn1b was identified in the Sprague-Dawley white eye mutant strain. The 8-nt insertion results in a frameshift after codon 177 (p. G177fs), predicting a different C-terminal domain containing 42 p27-unrelated amino acid residues. 2017-06-28 2017-06-28 69062 Cdkn1b Rnor_5.0 4 232962218 232967323 + p27-G177fs;Cdkn1bwe
12910941 Cdkn1bwe cyclin-dependent kinase inhibitor 1B; white eye mutation A tandem duplication of 8 nt in exon 2 of the rat Cdkn1b was identified in the Sprague-Dawley white eye mutant strain. The 8-nt insertion results in a frameshift after codon 177 (p. G177fs), predicting a different C-terminal domain containing 42 p27-unrelated amino acid residues. 2017-06-28 2017-06-28 69062 Cdkn1b Rnor_6.0 4 168689043 168694159 + p27-G177fs;Cdkn1bwe
1581494 Cebpem1Mcwi CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); E37G mutation is generated from the codon change GAG/GGG. 2006-10-06 2006-10-06 2329 Cebpe RGSC 3.4 15 32787946 32789344 - Cebpem1Mcwi
1581494 Cebpem1Mcwi CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); E37G mutation is generated from the codon change GAG/GGG. 2006-10-06 2006-10-06 2329 Cebpe Rnor_5.0 15 37241081 37242479 - Cebpem1Mcwi
1581494 Cebpem1Mcwi CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); E37G mutation is generated from the codon change GAG/GGG. 2006-10-06 2006-10-06 2329 Cebpe Rnor_6.0 15 33356119 33357517 - Cebpem1Mcwi
127285405 Cfbem1Tja complement factor B, ZFN induced mutant 1, Tja This allele was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion. 2021-06-21 2021-06-21 2204 Cfb Rnor_5.0 20 6616005 6621872 -
127285405 Cfbem1Tja complement factor B, ZFN induced mutant 1, Tja This allele was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion. 2021-06-21 2021-06-21 2204 Cfb Rnor_6.0 20 4536206 4542073 -
126925993 Cftrem1Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification. 2021-05-25 2021-05-25 2332 Cftr RGSC 3.4 4 43874852 44041870 +
126925993 Cftrem1Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification. 2021-05-25 2021-05-25 2332 Cftr Rnor_5.0 4 42281040 42448571 +
126925993 Cftrem1Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification. 2021-05-25 2021-05-25 2332 Cftr Rnor_6.0 4 42693263 42860679 +
151660342 Cftrem1Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos. One rat had this allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT). 2022-03-03 2022-03-03 2332 Cftr RGSC 3.4 4 43874852 44041870 +
151660342 Cftrem1Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos. One rat had this allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT). 2022-03-03 2022-03-03 2332 Cftr Rnor_5.0 4 42281040 42448571 +
151660342 Cftrem1Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos. One rat had this allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT). 2022-03-03 2022-03-03 2332 Cftr Rnor_6.0 4 42693263 42860679 +
14392814 Cftrem1Sage cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage A 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (CFTR) was induced in Sprague Dawley rats (Ntac:SD), resulting in loss of protein expression. 2019-03-04 2019-03-04 2332 Cftr RGSC 3.4 4 43874852 44041870 +
14392814 Cftrem1Sage cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage A 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (CFTR) was induced in Sprague Dawley rats (Ntac:SD), resulting in loss of protein expression. 2019-03-04 2019-03-04 2332 Cftr Rnor_5.0 4 42281040 42448571 +
14392814 Cftrem1Sage cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage A 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (CFTR) was induced in Sprague Dawley rats (Ntac:SD), resulting in loss of protein expression. 2019-03-04 2019-03-04 2332 Cftr Rnor_6.0 4 42693263 42860679 +
598092489 Cftrem1Wpick cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology. 2025-03-18 2025-03-18 2332 Cftr RGSC 3.4 4 43874852 44041870 +
598092489 Cftrem1Wpick cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology. 2025-03-18 2025-03-18 2332 Cftr Rnor_5.0 4 42281040 42448571 +
598092489 Cftrem1Wpick cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology. 2025-03-18 2025-03-18 2332 Cftr Rnor_6.0 4 42693263 42860679 +
126925995 Cftrem2Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. 2021-05-25 2021-05-25 2332 Cftr RGSC 3.4 4 43874852 44041870 + CFTR KO
126925995 Cftrem2Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. 2021-05-25 2021-05-25 2332 Cftr Rnor_5.0 4 42281040 42448571 + CFTR KO
126925995 Cftrem2Ang cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. 2021-05-25 2021-05-25 2332 Cftr Rnor_6.0 4 42693263 42860679 + CFTR KO
151660343 Cftrem2Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos . This allele with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain. 2022-03-03 2022-03-03 2332 Cftr RGSC 3.4 4 43874852 44041870 +
151660343 Cftrem2Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos . This allele with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain. 2022-03-03 2022-03-03 2332 Cftr Rnor_5.0 4 42281040 42448571 +
151660343 Cftrem2Apb cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos . This allele with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain. 2022-03-03 2022-03-03 2332 Cftr Rnor_6.0 4 42693263 42860679 +
13799347 Cgnl1em1Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 80-bp deletion of exon 2 of SS/JrHsdMcwi embryos 2018-10-10 2018-10-10 1304623 Cgnl1 RGSC 3.4 8 76088865 76241145 -
13799347 Cgnl1em1Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 80-bp deletion of exon 2 of SS/JrHsdMcwi embryos 2018-10-10 2018-10-10 1304623 Cgnl1 Rnor_5.0 8 74800532 74950938 +
13799347 Cgnl1em1Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 80-bp deletion of exon 2 of SS/JrHsdMcwi embryos 2018-10-10 2018-10-10 1304623 Cgnl1 Rnor_6.0 8 78126670 78278490 -
13799349 Cgnl1em2Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi 2018-10-10 2018-10-10 1304623 Cgnl1 RGSC 3.4 8 76088865 76241145 -
13799349 Cgnl1em2Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi 2018-10-10 2018-10-10 1304623 Cgnl1 Rnor_5.0 8 74800532 74950938 +
13799349 Cgnl1em2Mcwi cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi 2018-10-10 2018-10-10 1304623 Cgnl1 Rnor_6.0 8 78126670 78278490 -
25330100 Chd8em1Mcwi chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi This allele was made by CRISPR/Cas9 system. It introduced a 5-bp deletion in exon 3 of rat Chd8gene. 2020-04-07 2020-04-07 620696 Chd8 RGSC 3.4 15 27642767 27704443 -
25330100 Chd8em1Mcwi chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi This allele was made by CRISPR/Cas9 system. It introduced a 5-bp deletion in exon 3 of rat Chd8gene. 2020-04-07 2020-04-07 620696 Chd8 Rnor_5.0 15 32423198 32482762 -
25330100 Chd8em1Mcwi chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi This allele was made by CRISPR/Cas9 system. It introduced a 5-bp deletion in exon 3 of rat Chd8gene. 2020-04-07 2020-04-07 620696 Chd8 Rnor_6.0 15 28612932 28672574 -
10054371 Chrna3em1Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene;(RGSC 5.0/rn5) chr8:58,186,969-58,186,970 2015-08-05 2016-10-03 2345 Chrna3 RGSC 3.4 8 58570223 58583594 - Chrna3em1Mcwi
10054371 Chrna3em1Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene;(RGSC 5.0/rn5) chr8:58,186,969-58,186,970 2015-08-05 2016-10-03 2345 Chrna3 Rnor_5.0 8 58176165 58189008 - Chrna3em1Mcwi
10054371 Chrna3em1Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene;(RGSC 5.0/rn5) chr8:58,186,969-58,186,970 2015-08-05 2016-10-03 2345 Chrna3 Rnor_6.0 8 59594007 59607122 - Chrna3em1Mcwi
10054374 Chrna3em9Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 9, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Chrna3 gene. 2015-08-05 2016-10-03 2345 Chrna3 RGSC 3.4 8 58570223 58583594 - Chrna3em9Mcwi
10054374 Chrna3em9Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 9, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Chrna3 gene. 2015-08-05 2016-10-03 2345 Chrna3 Rnor_5.0 8 58176165 58189008 - Chrna3em9Mcwi
10054374 Chrna3em9Mcwi cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 9, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Chrna3 gene. 2015-08-05 2016-10-03 2345 Chrna3 Rnor_6.0 8 59594007 59607122 - Chrna3em9Mcwi
10054380 Chrna4em3Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 RGSC 3.4 3 170171214 170185998 - Chrna4em3Mcwi
10054380 Chrna4em3Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 Rnor_5.0 3 180243234 180258017 - Chrna4em3Mcwi
10054380 Chrna4em3Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 Rnor_6.0 3 176533182 176547965 - Chrna4em3Mcwi
10054377 Chrna4em4Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion (16-bp deletion and 11-bp insertion) in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 RGSC 3.4 3 170171214 170185998 - Chrna4em4Mcwi
10054377 Chrna4em4Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion (16-bp deletion and 11-bp insertion) in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 Rnor_5.0 3 180243234 180258017 - Chrna4em4Mcwi
10054377 Chrna4em4Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion (16-bp deletion and 11-bp insertion) in the Chrna4 gene 2015-08-05 2016-10-03 2346 Chrna4 Rnor_6.0 3 176533182 176547965 - Chrna4em4Mcwi
12790616 Chrna4em5Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in the Chrna4 gene 2017-02-17 2017-02-17 2346 Chrna4 RGSC 3.4 3 170171214 170185998 - Chrna4em5Mcwi
12790616 Chrna4em5Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in the Chrna4 gene 2017-02-17 2017-02-17 2346 Chrna4 Rnor_5.0 3 180243234 180258017 - Chrna4em5Mcwi
12790616 Chrna4em5Mcwi cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in the Chrna4 gene 2017-02-17 2017-02-17 2346 Chrna4 Rnor_6.0 3 176533182 176547965 - Chrna4em5Mcwi
14402420 Chrna5em18Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas The Zinc Finger Nuclease system was used to created184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 RGSC 3.4 8 58538002 58566388 +
14402420 Chrna5em18Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas The Zinc Finger Nuclease system was used to created184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 Rnor_5.0 8 58143974 58172330 +
14402420 Chrna5em18Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas The Zinc Finger Nuclease system was used to created184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 Rnor_6.0 8 59561817 59590172 +
10054384 Chrna5em1Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Chrna5 gene 2015-08-05 2016-10-19 2347 Chrna5 RGSC 3.4 8 58538002 58566388 + Chrna5em1Mcwi
10054384 Chrna5em1Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Chrna5 gene 2015-08-05 2016-10-19 2347 Chrna5 Rnor_5.0 8 58143974 58172330 + Chrna5em1Mcwi
10054384 Chrna5em1Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Chrna5 gene 2015-08-05 2016-10-19 2347 Chrna5 Rnor_6.0 8 59561817 59590172 + Chrna5em1Mcwi
14402422 Chrna5em20(D398N)Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 RGSC 3.4 8 58538002 58566388 +
14402422 Chrna5em20(D398N)Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 Rnor_5.0 8 58143974 58172330 +
14402422 Chrna5em20(D398N)Pas cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). 2019-06-04 2019-06-18 2347 Chrna5 Rnor_6.0 8 59561817 59590172 +
10054387 Chrna5em2Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 20-bp deletion in the Chrna5 gene (RGSC 5.0/rn5) chr8:58,166,756-58,166,775 2015-08-05 2016-10-19 2347 Chrna5 RGSC 3.4 8 58538002 58566388 + Chrna5em2Mcwi
10054387 Chrna5em2Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 20-bp deletion in the Chrna5 gene (RGSC 5.0/rn5) chr8:58,166,756-58,166,775 2015-08-05 2016-10-19 2347 Chrna5 Rnor_5.0 8 58143974 58172330 + Chrna5em2Mcwi
10054387 Chrna5em2Mcwi cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 20-bp deletion in the Chrna5 gene (RGSC 5.0/rn5) chr8:58,166,756-58,166,775 2015-08-05 2016-10-19 2347 Chrna5 Rnor_6.0 8 59561817 59590172 + Chrna5em2Mcwi
155900756 Chrna6em1Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 RGSC 3.4 16 69012201 69018901 +
155900756 Chrna6em1Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 Rnor_5.0 16 68486608 68493308 +
155900756 Chrna6em1Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 Rnor_6.0 16 68860018 68866718 +
155900759 Chrna6em2Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 RGSC 3.4 16 69012201 69018901 +
155900759 Chrna6em2Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 Rnor_5.0 16 68486608 68493308 +
155900759 Chrna6em2Slot cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 2023-02-09 2023-02-09 69281 Chrna6 Rnor_6.0 16 68860018 68866718 +
13207489 Chrnb4em5Mcwi cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. 2017-08-02 2017-08-02 2351 Chrnb4 RGSC 3.4 8 58586961 58605545 - Chrnb4em5Mcwi
13207489 Chrnb4em5Mcwi cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. 2017-08-02 2017-08-02 2351 Chrnb4 Rnor_5.0 8 58192375 58210959 - Chrnb4em5Mcwi
13207489 Chrnb4em5Mcwi cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. 2017-08-02 2017-08-02 2351 Chrnb4 Rnor_6.0 8 59610489 59629073 - Chrnb4em5Mcwi
2290123 Chsy1Tn(sb-T2/Bart3)2.165Mcwi carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. 2008-02-26 2008-02-26 1311904 Chsy1 RGSC 3.4 1 120539002 120600102 + Chsy1Tn(sb-T2/Bart3)2.165Mcwi
2290123 Chsy1Tn(sb-T2/Bart3)2.165Mcwi carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. 2008-02-26 2008-02-26 1311904 Chsy1 Rnor_5.0 1 128095353 128156041 + Chsy1Tn(sb-T2/Bart3)2.165Mcwi
2290123 Chsy1Tn(sb-T2/Bart3)2.165Mcwi carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. 2008-02-26 2008-02-26 1311904 Chsy1 Rnor_6.0 1 127010587 127071570 + Chsy1Tn(sb-T2/Bart3)2.165Mcwi
13204831 CitfhJjlo citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo Spontaneous single G deletion in exon 1 of citron kinase (Cit)confers a premature stop codon and lack of citron kinase protein. 2017-07-21 2017-07-21 70878 Cit RGSC 3.4 12 41858134 42019601 - CitfhJjlo
13204831 CitfhJjlo citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo Spontaneous single G deletion in exon 1 of citron kinase (Cit)confers a premature stop codon and lack of citron kinase protein. 2017-07-21 2017-07-21 70878 Cit Rnor_5.0 12 48136329 48295119 - CitfhJjlo
13204831 CitfhJjlo citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo Spontaneous single G deletion in exon 1 of citron kinase (Cit)confers a premature stop codon and lack of citron kinase protein. 2017-07-21 2017-07-21 70878 Cit Rnor_6.0 12 46334669 46494152 - CitfhJjlo
5687740 Clcn6em2Mcwi chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp frameshift deletion in exon 13 (del 1180-1194) 2012-02-09 2012-02-09 1305379 Clcn6 RGSC 3.4 5 165079773 165110594 - Clcn6em2Mcwi
5687740 Clcn6em2Mcwi chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp frameshift deletion in exon 13 (del 1180-1194) 2012-02-09 2012-02-09 1305379 Clcn6 Rnor_5.0 5 168469718 168502323 - Clcn6em2Mcwi
5687740 Clcn6em2Mcwi chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp frameshift deletion in exon 13 (del 1180-1194) 2012-02-09 2012-02-09 1305379 Clcn6 Rnor_6.0 5 164811815 164844554 - Clcn6em2Mcwi
11568647 Cntnap2em1Sage contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-08 2016-12-08 1307076 Cntnap2 RGSC 3.4 4 74277978 75440178 + Cntnap2tm1Sage;Cntnap2em1Sage
11568647 Cntnap2em1Sage contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-08 2016-12-08 1307076 Cntnap2 Rnor_5.0 4 140006078 140855979 + Cntnap2tm1Sage;Cntnap2em1Sage
11568647 Cntnap2em1Sage contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-08 2016-12-08 1307076 Cntnap2 Rnor_5.0 4 141164125 141697964 + Cntnap2tm1Sage;Cntnap2em1Sage
11568647 Cntnap2em1Sage contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-08 2016-12-08 1307076 Cntnap2 Rnor_6.0 4 74700539 77025463 + Cntnap2tm1Sage;Cntnap2em1Sage
150521554 Cntrobhd centrobin, centriole duplication and spindle assembly protein; hypodacty mutant The hd (hypodacty) mutation is caused by an insertion of an endogenous retrovirus (ERV-K8e family) into intron 10 of the Cntrob gene. The insertion disrupts the normal splicing of Cntrob transcripts and results in the expression of a truncated protein. 2021-11-10 2021-11-10 1307488 Cntrob RGSC 3.4 10 56094489 56116421 -
150521554 Cntrobhd centrobin, centriole duplication and spindle assembly protein; hypodacty mutant The hd (hypodacty) mutation is caused by an insertion of an endogenous retrovirus (ERV-K8e family) into intron 10 of the Cntrob gene. The insertion disrupts the normal splicing of Cntrob transcripts and results in the expression of a truncated protein. 2021-11-10 2021-11-10 1307488 Cntrob Rnor_5.0 10 55644004 55666957 -
150521554 Cntrobhd centrobin, centriole duplication and spindle assembly protein; hypodacty mutant The hd (hypodacty) mutation is caused by an insertion of an endogenous retrovirus (ERV-K8e family) into intron 10 of the Cntrob gene. The insertion disrupts the normal splicing of Cntrob transcripts and results in the expression of a truncated protein. 2021-11-10 2021-11-10 1307488 Cntrob Rnor_6.0 10 55901929 55927121 -
329969888 Col4a5em1Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 RGSC 3.4 X 36918697 37130659 -
329969888 Col4a5em1Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_5.0 X 111226503 111437171 +
329969888 Col4a5em1Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_6.0 X 112769595 112983720 +
329969892 Col4a5em2Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 RGSC 3.4 X 36918697 37130659 - WKY-Col4a5em2Matsu
329969892 Col4a5em2Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_5.0 X 111226503 111437171 + WKY-Col4a5em2Matsu
329969892 Col4a5em2Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_6.0 X 112769595 112983720 + WKY-Col4a5em2Matsu
329969893 Col4a5em3Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene. This em3 mutant carries a deletion of 56 base pairs containing the first methioine. 2023-07-26 2023-07-26 1565499 Col4a5 RGSC 3.4 X 36918697 37130659 - WKY-Col4a5em3Matsu
329969893 Col4a5em3Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene. This em3 mutant carries a deletion of 56 base pairs containing the first methioine. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_5.0 X 111226503 111437171 + WKY-Col4a5em3Matsu
329969893 Col4a5em3Matsu collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene. This em3 mutant carries a deletion of 56 base pairs containing the first methioine. 2023-07-26 2023-07-26 1565499 Col4a5 Rnor_6.0 X 112769595 112983720 + WKY-Col4a5em3Matsu
626419684 Col7a1em1Jtol collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. 2025-09-05 2025-09-05 1311417 Col7a1 RGSC 3.4 8 113971207 114003445 +
626419684 Col7a1em1Jtol collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. 2025-09-05 2025-09-05 1311417 Col7a1 Rnor_5.0 8 117046218 117078589 +
626419684 Col7a1em1Jtol collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. 2025-09-05 2025-09-05 1311417 Col7a1 Rnor_6.0 8 117694441 117726844 +
5687725 Comtem1Mcwi catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 4 (del 639-652) 2012-02-09 2012-02-09 2379 Comt RGSC 3.4 11 84561591 84581713 + Comtem1Mcwi
5687725 Comtem1Mcwi catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 4 (del 639-652) 2012-02-09 2012-02-09 2379 Comt Rnor_5.0 11 89809853 89829568 + Comtem1Mcwi
5687725 Comtem1Mcwi catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 4 (del 639-652) 2012-02-09 2012-02-09 2379 Comt Rnor_6.0 11 86715981 86735630 + Comtem1Mcwi
12790718 Rfwd2em1Mcwi ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4. 2017-02-21 2017-02-21 1304773 Cop1 RGSC 3.4 13 74552876 74590608 + Rfwd2em1Mcwi
12790718 Rfwd2em1Mcwi ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4. 2017-02-21 2017-02-21 1304773 Cop1 Rnor_5.0 13 81853391 81986197 + Rfwd2em1Mcwi
12790718 Rfwd2em1Mcwi ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4. 2017-02-21 2017-02-21 1304773 Cop1 Rnor_6.0 13 76942883 77076015 + Rfwd2em1Mcwi
38501062 Cpem1Ang ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang The mutations created by CRISPR/Cas9 in the Crl:SD embryos contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 2020-08-14 2020-08-14 2387 Cp RGSC 3.4 2 105086278 105135367 +
38501062 Cpem1Ang ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang The mutations created by CRISPR/Cas9 in the Crl:SD embryos contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 2020-08-14 2020-08-14 2387 Cp Rnor_5.0 2 124467383 124524140 +
38501062 Cpem1Ang ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang The mutations created by CRISPR/Cas9 in the Crl:SD embryos contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 2020-08-14 2020-08-14 2387 Cp Rnor_6.0 2 104744249 104803034 +
1642174 Cpt2m1Mcwi carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F475L mutation is generated from the codon change TTC/CTC 2007-09-06 2007-09-06 2398 Cpt2 RGSC 3.4 5 129007685 129025501 - Cpt2m1Mcwi
1642174 Cpt2m1Mcwi carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F475L mutation is generated from the codon change TTC/CTC 2007-09-06 2007-09-06 2398 Cpt2 Rnor_5.0 5 131353542 131370821 - Cpt2m1Mcwi
1642174 Cpt2m1Mcwi carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F475L mutation is generated from the codon change TTC/CTC 2007-09-06 2007-09-06 2398 Cpt2 Rnor_6.0 5 127505646 127523016 - Cpt2m1Mcwi
13451133 Crb1m1 crumbs 1, cell polarity complex component, mutant 1 A deletion insertion mutation (c.1685_1698delinsCAAGATGG) in exon 6 of the rat crb1 was identified to be responsible for the retinal phenotype of BN-Crb1m1 (RGD:13451132). 2017-11-15 2017-11-15 1309947 Crb1 RGSC 3.4 13 52558317 52725099 - Crb1m1;crumbs 1, cell polarity complex component;mutant 1
13451133 Crb1m1 crumbs 1, cell polarity complex component, mutant 1 A deletion insertion mutation (c.1685_1698delinsCAAGATGG) in exon 6 of the rat crb1 was identified to be responsible for the retinal phenotype of BN-Crb1m1 (RGD:13451132). 2017-11-15 2017-11-15 1309947 Crb1 Rnor_5.0 13 61413282 61480872 - Crb1m1;crumbs 1, cell polarity complex component;mutant 1
13451133 Crb1m1 crumbs 1, cell polarity complex component, mutant 1 A deletion insertion mutation (c.1685_1698delinsCAAGATGG) in exon 6 of the rat crb1 was identified to be responsible for the retinal phenotype of BN-Crb1m1 (RGD:13451132). 2017-11-15 2017-11-15 1309947 Crb1 Rnor_5.0 13 61292273 61369526 - Crb1m1;crumbs 1, cell polarity complex component;mutant 1
13451133 Crb1m1 crumbs 1, cell polarity complex component, mutant 1 A deletion insertion mutation (c.1685_1698delinsCAAGATGG) in exon 6 of the rat crb1 was identified to be responsible for the retinal phenotype of BN-Crb1m1 (RGD:13451132). 2017-11-15 2017-11-15 1309947 Crb1 Rnor_6.0 13 56270519 56462893 - Crb1m1;crumbs 1, cell polarity complex component;mutant 1
11049142 Crhem1Ionsz corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. 2016-04-05 2016-04-05 620505 Crh RGSC 3.4 2 104764023 104765887 - Crhem1Ionsz
11049142 Crhem1Ionsz corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. 2016-04-05 2016-04-05 620505 Crh Rnor_5.0 2 124182919 124184783 - Crhem1Ionsz
11049142 Crhem1Ionsz corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. 2016-04-05 2016-04-05 620505 Crh Rnor_6.0 2 104459999 104461863 - Crhem1Ionsz
38676462 Cryba1Hiser crystallin, beta A1; HiSER mutant HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. 2020-09-18 2020-09-18 2415 Cryba1 RGSC 3.4 10 63758929 63765451 -
38676462 Cryba1Hiser crystallin, beta A1; HiSER mutant HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. 2020-09-18 2020-09-18 2415 Cryba1 Rnor_5.0 10 66458061 66480390 -
38676462 Cryba1Hiser crystallin, beta A1; HiSER mutant HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. 2020-09-18 2020-09-18 2415 Cryba1 Rnor_6.0 10 65160777 65167504 +
126925758 Cryba1Nuc1Dbsa crystallin, beta A1;Nuc1 mutant, Dbsa This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. 2021-05-19 2021-05-19 2415 Cryba1 RGSC 3.4 10 63758929 63765451 -
126925758 Cryba1Nuc1Dbsa crystallin, beta A1;Nuc1 mutant, Dbsa This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. 2021-05-19 2021-05-19 2415 Cryba1 Rnor_5.0 10 66458061 66480390 -
126925758 Cryba1Nuc1Dbsa crystallin, beta A1;Nuc1 mutant, Dbsa This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. 2021-05-19 2021-05-19 2415 Cryba1 Rnor_6.0 10 65160777 65167504 +
12910954 Csf1tl colony stimulating factor 1; tooth less mutant A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon. 2017-06-29 2017-06-29 621063 Csf1 RGSC 3.4 2 203292765 203307968 - Csf1tl
12910954 Csf1tl colony stimulating factor 1; tooth less mutant A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon. 2017-06-29 2017-06-29 621063 Csf1 Rnor_5.0 2 229989430 230017945 - Csf1tl
12910954 Csf1tl colony stimulating factor 1; tooth less mutant A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon. 2017-06-29 2017-06-29 621063 Csf1 Rnor_6.0 2 210522370 210550546 - Csf1tl
126781692 Csf1rtm(EGFP)Tset colony stimulating factor 1 receptor; target mutant, Tset Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. 2021-04-15 2021-04-15 2425 Csf1r RGSC 3.4 18 57080324 57107295 +
126781692 Csf1rtm(EGFP)Tset colony stimulating factor 1 receptor; target mutant, Tset Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. 2021-04-15 2021-04-15 2425 Csf1r Rnor_5.0 18 55662670 55689297 +
126781692 Csf1rtm(EGFP)Tset colony stimulating factor 1 receptor; target mutant, Tset Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. 2021-04-15 2021-04-15 2425 Csf1r Rnor_6.0 18 56414493 56458300 +
2302637 Csmd3Tn(sb-T2/Bart3)2.288Mcwi CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene 2009-01-06 2009-01-06 1594530 Csmd3 RGSC 3.4 7 83586771 84932392 - Csmd3Tn(sb-T2/Bart3)2.288Mcwi
2302637 Csmd3Tn(sb-T2/Bart3)2.288Mcwi CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene 2009-01-06 2009-01-06 1594530 Csmd3 Rnor_5.0 7 86689912 87802035 - Csmd3Tn(sb-T2/Bart3)2.288Mcwi
2302637 Csmd3Tn(sb-T2/Bart3)2.288Mcwi CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene 2009-01-06 2009-01-06 1594530 Csmd3 Rnor_6.0 7 86695703 88072106 - Csmd3Tn(sb-T2/Bart3)2.288Mcwi
2290093 Cst3Tn(sb-T2/Bart3)2.172Mcwi cystatin C; transposon insertion 2.172, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. 2008-02-26 2008-02-26 2432 Cst3 RGSC 3.4 3 137650903 137654776 - Cst3Tn(sb-T2/Bart3)2.172Mcwi
2290093 Cst3Tn(sb-T2/Bart3)2.172Mcwi cystatin C; transposon insertion 2.172, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. 2008-02-26 2008-02-26 2432 Cst3 Rnor_5.0 3 149628692 149632565 - Cst3Tn(sb-T2/Bart3)2.172Mcwi
2290093 Cst3Tn(sb-T2/Bart3)2.172Mcwi cystatin C; transposon insertion 2.172, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. 2008-02-26 2008-02-26 2432 Cst3 Rnor_6.0 3 143219671 143223544 - Cst3Tn(sb-T2/Bart3)2.172Mcwi
5687708 Cst3em1Mcwi cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 18-bp deletion in exon 1 (del 228-245) 2012-02-09 2013-10-07 2432 Cst3 RGSC 3.4 3 137650903 137654776 - Cst3em1Mcwi
5687708 Cst3em1Mcwi cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 18-bp deletion in exon 1 (del 228-245) 2012-02-09 2013-10-07 2432 Cst3 Rnor_5.0 3 149628692 149632565 - Cst3em1Mcwi
5687708 Cst3em1Mcwi cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 18-bp deletion in exon 1 (del 228-245) 2012-02-09 2013-10-07 2432 Cst3 Rnor_6.0 3 143219671 143223544 - Cst3em1Mcwi
5687738 Cst3em3Mcwi cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 1 (ins t at position 234) 2012-02-09 2012-02-09 2432 Cst3 RGSC 3.4 3 137650903 137654776 - Cst3em3Mcwi
5687738 Cst3em3Mcwi cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 1 (ins t at position 234) 2012-02-09 2012-02-09 2432 Cst3 Rnor_5.0 3 149628692 149632565 - Cst3em3Mcwi
5687738 Cst3em3Mcwi cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 1 (ins t at position 234) 2012-02-09 2012-02-09 2432 Cst3 Rnor_6.0 3 143219671 143223544 - Cst3em3Mcwi
401938654 Ctnsem1Odev cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev This allele was produced by targeting Ctns gene in Sprague Dawley rats (PolyGene AG, Zurich,Switzer-land). Two single guide RNAs (sgRNAs) targeting exon3 o fCtns were selected:CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG),CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resulting in a premature stop codon in the exon3 of Ctns. 2023-12-19 2023-12-19 1308466 Ctns RGSC 3.4 10 60060254 60075352 -
401938654 Ctnsem1Odev cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev This allele was produced by targeting Ctns gene in Sprague Dawley rats (PolyGene AG, Zurich,Switzer-land). Two single guide RNAs (sgRNAs) targeting exon3 o fCtns were selected:CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG),CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resulting in a premature stop codon in the exon3 of Ctns. 2023-12-19 2023-12-19 1308466 Ctns Rnor_5.0 10 59488895 59503993 -
401938654 Ctnsem1Odev cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev This allele was produced by targeting Ctns gene in Sprague Dawley rats (PolyGene AG, Zurich,Switzer-land). Two single guide RNAs (sgRNAs) targeting exon3 o fCtns were selected:CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG),CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resulting in a premature stop codon in the exon3 of Ctns. 2023-12-19 2023-12-19 1308466 Ctns Rnor_6.0 10 59749250 59772475 -
155630632 Ctnsem2Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk This 2-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns RGSC 3.4 10 60060254 60075352 - CtnsE3N-2Vjupk/Vju
155630632 Ctnsem2Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk This 2-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_5.0 10 59488895 59503993 - CtnsE3N-2Vjupk/Vju
155630632 Ctnsem2Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk This 2-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_6.0 10 59749250 59772475 - CtnsE3N-2Vjupk/Vju
155630634 Ctnsem3Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk This 8-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns RGSC 3.4 10 60060254 60075352 - CtnsE3N-3Vjupk/Vju
155630634 Ctnsem3Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk This 8-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_5.0 10 59488895 59503993 - CtnsE3N-3Vjupk/Vju
155630634 Ctnsem3Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk This 8-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_6.0 10 59749250 59772475 - CtnsE3N-3Vjupk/Vju
155630636 Ctnsem4Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk This 7-bp deletion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns RGSC 3.4 10 60060254 60075352 -
155630636 Ctnsem4Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk This 7-bp deletion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_5.0 10 59488895 59503993 -
155630636 Ctnsem4Vjupk cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk This 7-bp deletion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. 2022-10-26 2022-10-26 1308466 Ctns Rnor_6.0 10 59749250 59772475 -
6484705 Cubnem1Mcwi cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 14. 2012-07-02 2012-07-02 68355 Cubn RGSC 3.4 17 87545893 87772079 - Cubnem1Mcwi
6484705 Cubnem1Mcwi cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 14. 2012-07-02 2012-07-02 68355 Cubn Rnor_5.0 17 82205509 82425565 - Cubnem1Mcwi
6484705 Cubnem1Mcwi cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 14. 2012-07-02 2012-07-02 68355 Cubn Rnor_6.0 17 80584921 80807181 - Cubnem1Mcwi
5131930 Cybaem1Mcwi cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89). 2011-05-16 2011-05-16 620573 Cyba RGSC 3.4 19 52713150 52721609 - Cybaem1Mcwi;cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5131930 Cybaem1Mcwi cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89). 2011-05-16 2011-05-16 620573 Cyba Rnor_5.0 19 65959818 65967224 - Cybaem1Mcwi;cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5131930 Cybaem1Mcwi cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89). 2011-05-16 2011-05-16 620573 Cyba Rnor_6.0 19 55249634 55257824 - Cybaem1Mcwi;cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
13209000 CybamesSdi cytochrome b-245 alpha chain;mutant 1,Sdi This allele was identified in the MES rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. It carries a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. 2017-08-28 2017-08-28 620573 Cyba RGSC 3.4 19 52713150 52721609 - Cybam1Sdi;Cybames/Sdi;Cybames;Cybam1Sdi
13209000 CybamesSdi cytochrome b-245 alpha chain;mutant 1,Sdi This allele was identified in the MES rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. It carries a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. 2017-08-28 2017-08-28 620573 Cyba Rnor_5.0 19 65959818 65967224 - Cybam1Sdi;Cybames/Sdi;Cybames;Cybam1Sdi
13209000 CybamesSdi cytochrome b-245 alpha chain;mutant 1,Sdi This allele was identified in the MES rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. It carries a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. 2017-08-28 2017-08-28 620573 Cyba Rnor_6.0 19 55249634 55257824 - Cybam1Sdi;Cybames/Sdi;Cybames;Cybam1Sdi
12790620 Cybbem1Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb RGSC 3.4 X 25514572 25547181 - Cybbem1Mcwi
12790620 Cybbem1Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb Rnor_5.0 X 15359405 15391317 + Cybbem1Mcwi
12790620 Cybbem1Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb Rnor_6.0 X 14578330 14610049 + Cybbem1Mcwi
626419689 Cybbem1Shmo cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620574 Cybb RGSC 3.4 X 25514572 25547181 -
626419689 Cybbem1Shmo cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620574 Cybb Rnor_5.0 X 15359405 15391317 +
626419689 Cybbem1Shmo cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620574 Cybb Rnor_6.0 X 14578330 14610049 +
12790624 Cybbem3Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb RGSC 3.4 X 25514572 25547181 - Cybbem3Mcwi
12790624 Cybbem3Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb Rnor_5.0 X 15359405 15391317 + Cybbem3Mcwi
12790624 Cybbem3Mcwi cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. 2017-02-17 2017-02-17 620574 Cybb Rnor_6.0 X 14578330 14610049 + Cybbem3Mcwi
14985211 Cyfip1em1Sage cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage The guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1) was injected to Long Evans one cell embryos. The resultant mutation is 4 bp out of frame deletion in exon 7 of the rat Cyfip1, resulting an early stop codon in exon 8. 2019-10-09 2019-10-09 1310332 Cyfip1 RGSC 3.4 1 107245993 107334337 +
14985211 Cyfip1em1Sage cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage The guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1) was injected to Long Evans one cell embryos. The resultant mutation is 4 bp out of frame deletion in exon 7 of the rat Cyfip1, resulting an early stop codon in exon 8. 2019-10-09 2019-10-09 1310332 Cyfip1 Rnor_5.0 1 115265128 115353515 +
14985211 Cyfip1em1Sage cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage The guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1) was injected to Long Evans one cell embryos. The resultant mutation is 4 bp out of frame deletion in exon 7 of the rat Cyfip1, resulting an early stop codon in exon 8. 2019-10-09 2019-10-09 1310332 Cyfip1 Rnor_6.0 1 114258773 114347138 +
728295 Cyp11b2m1 cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1 nucleotide 752 (G) in exon 4 of Milan hypertensive (MHS) differs from that of normotensive (MNS) rats (A) 2003-11-13 2003-11-13 2454 Cyp11b2 RGSC 3.4 7 113043365 113049779 - Cyp11b2m1
728295 Cyp11b2m1 cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1 nucleotide 752 (G) in exon 4 of Milan hypertensive (MHS) differs from that of normotensive (MNS) rats (A) 2003-11-13 2003-11-13 2454 Cyp11b2 Rnor_5.0 7 116151128 116157542 - Cyp11b2m1
728295 Cyp11b2m1 cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1 nucleotide 752 (G) in exon 4 of Milan hypertensive (MHS) differs from that of normotensive (MNS) rats (A) 2003-11-13 2003-11-13 2454 Cyp11b2 Rnor_6.0 7 116248759 116255205 - Cyp11b2m1
5131928 Cyp1a1em1Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 19-bp frameshift deletion in exon 4 (del 1098-1116). 2011-05-16 2011-05-16 2458 Cyp1a1 RGSC 3.4 8 61462207 61468237 + Cyp1a1em1Mcwi
5131928 Cyp1a1em1Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 19-bp frameshift deletion in exon 4 (del 1098-1116). 2011-05-16 2011-05-16 2458 Cyp1a1 Rnor_5.0 8 62249046 62255081 + Cyp1a1em1Mcwi
5131928 Cyp1a1em1Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 19-bp frameshift deletion in exon 4 (del 1098-1116). 2011-05-16 2011-05-16 2458 Cyp1a1 Rnor_6.0 8 62472087 62478122 + Cyp1a1em1Mcwi
5509976 Cyp1a1em2Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 188-bp deletion encompassing exon 4 (del 61466251-61466438) 2011-11-16 2011-11-16 2458 Cyp1a1 RGSC 3.4 8 61462207 61468237 + Cyp1a1em2Mcwi
5509976 Cyp1a1em2Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 188-bp deletion encompassing exon 4 (del 61466251-61466438) 2011-11-16 2011-11-16 2458 Cyp1a1 Rnor_5.0 8 62249046 62255081 + Cyp1a1em2Mcwi
5509976 Cyp1a1em2Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 188-bp deletion encompassing exon 4 (del 61466251-61466438) 2011-11-16 2011-11-16 2458 Cyp1a1 Rnor_6.0 8 62472087 62478122 + Cyp1a1em2Mcwi
5131929 Cyp1a1em5Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 4 (del 1099-1106). 2011-05-16 2011-05-16 2458 Cyp1a1 RGSC 3.4 8 61462207 61468237 + Cyp1a1em5Mcwi
5131929 Cyp1a1em5Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 4 (del 1099-1106). 2011-05-16 2011-05-16 2458 Cyp1a1 Rnor_5.0 8 62249046 62255081 + Cyp1a1em5Mcwi
5131929 Cyp1a1em5Mcwi cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 4 (del 1099-1106). 2011-05-16 2011-05-16 2458 Cyp1a1 Rnor_6.0 8 62472087 62478122 + Cyp1a1em5Mcwi
408364974 Cyp27b1em1Hfd cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG 2024-11-06 2024-11-06 69192 Cyp27b1 Rnor_5.0 7 70512763 70517707 +
408364974 Cyp27b1em1Hfd cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG 2024-11-06 2024-11-06 69192 Cyp27b1 Rnor_6.0 7 70333150 70340006 +
124713545 Cyp27b1em1Thka cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. 2021-03-19 2021-03-19 69192 Cyp27b1 Rnor_5.0 7 70512763 70517707 +
124713545 Cyp27b1em1Thka cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. 2021-03-19 2021-03-19 69192 Cyp27b1 Rnor_6.0 7 70333150 70340006 +
408364975 Cyp27b1em2Hfd cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG 2024-11-06 2024-11-06 69192 Cyp27b1 Rnor_5.0 7 70512763 70517707 +
408364975 Cyp27b1em2Hfd cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG 2024-11-06 2024-11-06 69192 Cyp27b1 Rnor_6.0 7 70333150 70340006 +
150429708 Cyp2c11em1Nju cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju This allele was created by CRISPR/Cas9 system in the Sprague-Dawley embryo. The mutant allele carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. 2021-09-17 2021-09-17 2469 Cyp2c11 RGSC 3.4 1 243281320 243320945 +
150429708 Cyp2c11em1Nju cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju This allele was created by CRISPR/Cas9 system in the Sprague-Dawley embryo. The mutant allele carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. 2021-09-17 2021-09-17 2469 Cyp2c11 Rnor_5.0 1 265418158 265454574 +
150429708 Cyp2c11em1Nju cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju This allele was created by CRISPR/Cas9 system in the Sprague-Dawley embryo. The mutant allele carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. 2021-09-17 2021-09-17 2469 Cyp2c11 Rnor_6.0 1 257676172 258004428 +
12904681 Cyp2j4em1Sage cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. 2017-05-17 2017-05-17 620007 Cyp2j4 RGSC 3.4 5 116702370 116729722 - Cyp2j4-KO;Cyp2j4em1Sage
12904681 Cyp2j4em1Sage cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. 2017-05-17 2017-05-17 620007 Cyp2j4 Rnor_5.0 5 123437429 123455814 - Cyp2j4-KO;Cyp2j4em1Sage
12904681 Cyp2j4em1Sage cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. 2017-05-17 2017-05-17 620007 Cyp2j4 Rnor_5.0 5 119130644 119130903 - Cyp2j4-KO;Cyp2j4em1Sage
12904681 Cyp2j4em1Sage cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. 2017-05-17 2017-05-17 620007 Cyp2j4 Rnor_6.0 5 119546458 119564843 - Cyp2j4-KO;Cyp2j4em1Sage
14696725 Cyp3a2em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu A 10-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a2 gene in the Sprague Dawley embryo 2019-07-19 2019-07-19 708379 Cyp3a2 RGSC 3.4 12 9517016 9541000 -
14696725 Cyp3a2em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu A 10-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a2 gene in the Sprague Dawley embryo 2019-07-19 2019-07-19 708379 Cyp3a2 Rnor_5.0 12 13719927 13740743 -
14696725 Cyp3a2em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu A 10-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a2 gene in the Sprague Dawley embryo 2019-07-19 2019-07-19 708379 Cyp3a2 Rnor_6.0 12 11641500 11677818 -
14696724 Cyp3a23-3a1em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu A 22-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a23/3a1gene in the Sprague Dawley embryo. 2019-07-19 2019-07-19 628626 Cyp3a23-3a1 RGSC 3.4 12 9567120 9595974 - cytochrome P450, family 3, subfamily a, polypeptide 23/polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu;Cyp3a23/3a1em1Myliu
14696724 Cyp3a23-3a1em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu A 22-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a23/3a1gene in the Sprague Dawley embryo. 2019-07-19 2019-07-19 628626 Cyp3a23-3a1 Rnor_5.0 12 13145742 13174596 - cytochrome P450, family 3, subfamily a, polypeptide 23/polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu;Cyp3a23/3a1em1Myliu
14696724 Cyp3a23-3a1em1Myliu cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu A 22-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a23/3a1gene in the Sprague Dawley embryo. 2019-07-19 2019-07-19 628626 Cyp3a23-3a1 Rnor_6.0 12 11053888 11082742 - cytochrome P450, family 3, subfamily a, polypeptide 23/polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu;Cyp3a23/3a1em1Myliu
5687724 Cyp4a2em1Mcwi cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 2-bp frameshift deletion in exon 2 (del 319-320) 2012-02-09 2012-08-28 2479 Cyp4a2 RGSC 3.4 5 135765673 135773006 - Cyp4a2em1Mcwi
5687724 Cyp4a2em1Mcwi cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 2-bp frameshift deletion in exon 2 (del 319-320) 2012-02-09 2012-08-28 2479 Cyp4a2 Rnor_5.0 5 137989327 138000302 - Cyp4a2em1Mcwi
5687724 Cyp4a2em1Mcwi cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 2-bp frameshift deletion in exon 2 (del 319-320) 2012-02-09 2012-08-28 2479 Cyp4a2 Rnor_6.0 5 134196910 134207888 - Cyp4a2em1Mcwi
5687737 Cyp4a3em3Mcwi cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp deletion in exon 2 (del 311-321) 2012-02-09 2012-02-09 631356 Cyp4a3 RGSC 3.4 5 135876140 135893753 - Cyp4a3em3Mcwi
5687737 Cyp4a3em3Mcwi cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp deletion in exon 2 (del 311-321) 2012-02-09 2012-02-09 631356 Cyp4a3 Rnor_5.0 5 138258628 138274813 - Cyp4a3em3Mcwi
5687737 Cyp4a3em3Mcwi cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp deletion in exon 2 (del 311-321) 2012-02-09 2012-02-09 631356 Cyp4a3 Rnor_6.0 5 134468666 134484851 - Cyp4a3em3Mcwi
2303974 Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. 2009-03-03 2009-03-03 2483 Cyp7b1 RGSC 3.4 2 103102679 103271273 - Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi
2303974 Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. 2009-03-03 2009-03-03 2483 Cyp7b1 Rnor_5.0 2 122442002 122610354 - Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi
2303974 Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. 2009-03-03 2009-03-03 2483 Cyp7b1 Rnor_6.0 2 102701903 102871257 - Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi
2290095 CyssTn(sb-T2/Bart3)2.173Mcwi cystatin S; transposon insertion 2.173, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene 2008-02-26 2008-02-26 735160 Cyss RGSC 3.4 3 138826625 138830963 - CyssTn(sb-T2/Bart3)2.173Mcwi
2290095 CyssTn(sb-T2/Bart3)2.173Mcwi cystatin S; transposon insertion 2.173, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene 2008-02-26 2008-02-26 735160 Cyss Rnor_5.0 3 150801395 150805733 - CyssTn(sb-T2/Bart3)2.173Mcwi
2290095 CyssTn(sb-T2/Bart3)2.173Mcwi cystatin S; transposon insertion 2.173, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene 2008-02-26 2008-02-26 735160 Cyss Rnor_6.0 3 144427430 144431768 - CyssTn(sb-T2/Bart3)2.173Mcwi
2307440 Cyyr1Tn(sb-T2/Bart3)2.328Mcwi cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. 2009-06-05 2009-06-05 1359578 Cyyr1 RGSC 3.4 11 25036792 25157304 - Cyyr1Tn(sb-T2/Bart3)2.328Mcwi
2307440 Cyyr1Tn(sb-T2/Bart3)2.328Mcwi cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. 2009-06-05 2009-06-05 1359578 Cyyr1 Rnor_5.0 11 28591553 28702298 - Cyyr1Tn(sb-T2/Bart3)2.328Mcwi
2307440 Cyyr1Tn(sb-T2/Bart3)2.328Mcwi cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. 2009-06-05 2009-06-05 1359578 Cyyr1 Rnor_6.0 11 24967936 25078740 - Cyyr1Tn(sb-T2/Bart3)2.328Mcwi
2298938 DccTn(sb-T2/Bart3)2.205Mcwi deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. 2008-08-04 2008-08-04 2492 Dcc RGSC 3.4 18 68026795 69140741 - DccTn(sb-T2/Bart3)2.205Mcwi
2298938 DccTn(sb-T2/Bart3)2.205Mcwi deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. 2008-08-04 2008-08-04 2492 Dcc Rnor_5.0 18 65688901 66793126 - DccTn(sb-T2/Bart3)2.205Mcwi
2298938 DccTn(sb-T2/Bart3)2.205Mcwi deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. 2008-08-04 2008-08-04 2492 Dcc Rnor_6.0 18 66518213 67629801 - DccTn(sb-T2/Bart3)2.205Mcwi
645244064 Dcdc2aem1.2Gapp doublecortin domain containing 2a; CRISPR/Cas9 induced mutant 1.2,Gapp The CRISPR/cas9 system was used to introduce a premature STOP codon in exon 1 of the Dcdc2 gene in the Dcdc2a gene of Sprague Dawley rats 2026-05-05 2026-05-05 1310227 Dcdc2a RGSC 3.4 17 46899656 47090283 -
645244064 Dcdc2aem1.2Gapp doublecortin domain containing 2a; CRISPR/Cas9 induced mutant 1.2,Gapp The CRISPR/cas9 system was used to introduce a premature STOP codon in exon 1 of the Dcdc2 gene in the Dcdc2a gene of Sprague Dawley rats 2026-05-05 2026-05-05 1310227 Dcdc2a Rnor_5.0 17 43711172 43899961 -
645244064 Dcdc2aem1.2Gapp doublecortin domain containing 2a; CRISPR/Cas9 induced mutant 1.2,Gapp The CRISPR/cas9 system was used to introduce a premature STOP codon in exon 1 of the Dcdc2 gene in the Dcdc2a gene of Sprague Dawley rats 2026-05-05 2026-05-05 1310227 Dcdc2a Rnor_6.0 17 41838201 42031265 -
151347606 Ddah1em1Ywxu dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3'). 2022-01-28 2022-01-28 70968 Ddah1 RGSC 3.4 2 243932221 244069832 +
151347606 Ddah1em1Ywxu dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3'). 2022-01-28 2022-01-28 70968 Ddah1 Rnor_5.0 2 270160842 270289319 +
151347606 Ddah1em1Ywxu dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3'). 2022-01-28 2022-01-28 70968 Ddah1 Rnor_6.0 2 251634368 251766009 +
38599011 Defb23em1Mlit defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. 2020-09-08 2020-09-08 1560097 Defb23 RGSC 3.4 3 142780126 142784338 -
38599011 Defb23em1Mlit defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. 2020-09-08 2020-09-08 1560097 Defb23 Rnor_5.0 3 154275191 154279834 -
38599011 Defb23em1Mlit defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. 2020-09-08 2020-09-08 1560097 Defb23 Rnor_6.0 3 147928201 147932413 -
38599012 Defb26em1Mlit defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. 2020-09-08 2020-09-08 1564413 Defb26 RGSC 3.4 3 142834066 142837469 -
38599012 Defb26em1Mlit defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. 2020-09-08 2020-09-08 1564413 Defb26 Rnor_5.0 3 154391632 154395035 -
38599012 Defb26em1Mlit defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. 2020-09-08 2020-09-08 1564413 Defb26 Rnor_6.0 3 147982213 147985616 -
38599013 Defb42em1Mlit defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. 2020-09-08 2020-09-08 1560445 Defb48 RGSC 3.4 15 42247668 42254485 -
38599013 Defb42em1Mlit defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. 2020-09-08 2020-09-08 1560445 Defb48 Rnor_5.0 15 49925455 49932279 -
38599013 Defb42em1Mlit defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. 2020-09-08 2020-09-08 1560445 Defb48 Rnor_6.0 15 46159511 46166335 -
38599194 Depdc5em1Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 RGSC 3.4 14 83484354 83614818 -
38599194 Depdc5em1Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 Rnor_5.0 14 83775510 83906381 -
38599194 Depdc5em1Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 Rnor_6.0 14 83089000 83219576 -
38599195 Depdc5em2Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 RGSC 3.4 14 83484354 83614818 -
38599195 Depdc5em2Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 Rnor_5.0 14 83775510 83906381 -
38599195 Depdc5em2Kyo DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 2020-09-14 2020-09-14 1311535 Depdc5 Rnor_6.0 14 83089000 83219576 -
1578801 Desm1Mcwi desmin; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); S25T mutation is generated. 2006-05-02 2006-05-02 620686 Des RGSC 3.4 9 74637783 74645499 + Desm1Mcwi
1578801 Desm1Mcwi desmin; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); S25T mutation is generated. 2006-05-02 2006-05-02 620686 Des Rnor_5.0 9 82325835 82333549 + Desm1Mcwi
1578801 Desm1Mcwi desmin; mutation 1, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); S25T mutation is generated. 2006-05-02 2006-05-02 620686 Des Rnor_6.0 9 82556574 82564288 + Desm1Mcwi
5508345 Dguokem1Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) 2011-10-13 2013-10-07 1304799 Dguok RGSC 3.4 4 117697251 117725383 - Dguokem1Mcwi
5508345 Dguokem1Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) 2011-10-13 2013-10-07 1304799 Dguok Rnor_5.0 4 179770727 179798683 - Dguokem1Mcwi
5508345 Dguokem1Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) 2011-10-13 2013-10-07 1304799 Dguok Rnor_6.0 4 115180433 115208061 - Dguokem1Mcwi
5508354 Dguokem2Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) 2011-10-13 2013-10-07 1304799 Dguok RGSC 3.4 4 117697251 117725383 - Dguokem2Mcwi
5508354 Dguokem2Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) 2011-10-13 2013-10-07 1304799 Dguok Rnor_5.0 4 179770727 179798683 - Dguokem2Mcwi
5508354 Dguokem2Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) 2011-10-13 2013-10-07 1304799 Dguok Rnor_6.0 4 115180433 115208061 - Dguokem2Mcwi
5508325 Dguokem3Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) 2011-10-13 2013-10-07 1304799 Dguok RGSC 3.4 4 117697251 117725383 - Dguokem3Mcwi
5508325 Dguokem3Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) 2011-10-13 2013-10-07 1304799 Dguok Rnor_5.0 4 179770727 179798683 - Dguokem3Mcwi
5508325 Dguokem3Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) 2011-10-13 2013-10-07 1304799 Dguok Rnor_6.0 4 115180433 115208061 - Dguokem3Mcwi
5508323 Dguokem4Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp frameshift deletion in exon 1 (del 78-86) 2011-10-13 2011-10-13 1304799 Dguok RGSC 3.4 4 117697251 117725383 - Dguokem4Mcwi
5508323 Dguokem4Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp frameshift deletion in exon 1 (del 78-86) 2011-10-13 2011-10-13 1304799 Dguok Rnor_5.0 4 179770727 179798683 - Dguokem4Mcwi
5508323 Dguokem4Mcwi deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp frameshift deletion in exon 1 (del 78-86) 2011-10-13 2011-10-13 1304799 Dguok Rnor_6.0 4 115180433 115208061 - Dguokem4Mcwi
2306275 Diaph3Tn(sb-T2/Bart3)2.318Mcwi diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. 2009-04-01 2009-04-01 1593287 Diaph3 RGSC 3.4 15 68905784 69267707 - Diaph3Tn(sb-T2/Bart3)2.318Mcwi
2306275 Diaph3Tn(sb-T2/Bart3)2.318Mcwi diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. 2009-04-01 2009-04-01 1593287 Diaph3 Rnor_5.0 15 73538942 74007617 - Diaph3Tn(sb-T2/Bart3)2.318Mcwi
2306275 Diaph3Tn(sb-T2/Bart3)2.318Mcwi diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. 2009-04-01 2009-04-01 1593287 Diaph3 Rnor_6.0 15 69928507 70400077 - Diaph3Tn(sb-T2/Bart3)2.318Mcwi
125093747 Disc1em1Rst DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. 2021-03-30 2021-03-30 631359 Disc1 RGSC 3.4 19 55265116 55449375 +
125093747 Disc1em1Rst DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. 2021-03-30 2021-03-30 631359 Disc1 Rnor_5.0 19 68529791 68641620 +
125093747 Disc1em1Rst DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. 2021-03-30 2021-03-30 631359 Disc1 Rnor_5.0 19 68711386 68769050 +
125093747 Disc1em1Rst DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. 2021-03-30 2021-03-30 631359 Disc1 Rnor_6.0 19 57818838 58069992 +
2290152 Dlg1Tn(sb-T2/Bart3)2.133Mcwi discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2008-02-26 2008-02-26 2505 Dlg1 RGSC 3.4 11 70735283 70930374 - Dlg1Tn(sb-T2/Bart3)2.133Mcwi
2290152 Dlg1Tn(sb-T2/Bart3)2.133Mcwi discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2008-02-26 2008-02-26 2505 Dlg1 Rnor_5.0 11 75239783 75349409 - Dlg1Tn(sb-T2/Bart3)2.133Mcwi
2290152 Dlg1Tn(sb-T2/Bart3)2.133Mcwi discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2008-02-26 2008-02-26 2505 Dlg1 Rnor_5.0 11 75389409 75454358 - Dlg1Tn(sb-T2/Bart3)2.133Mcwi
2290152 Dlg1Tn(sb-T2/Bart3)2.133Mcwi discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2008-02-26 2008-02-26 2505 Dlg1 Rnor_6.0 11 72164566 72378895 - Dlg1Tn(sb-T2/Bart3)2.133Mcwi
12880032 Dmdem1Ang dystrophin; TALEN-induced mutant1, Ang This mutant allele was generated using TALEN targeting exon23 of rat Dmd. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 frame shift and premature stop codon 81 bp after the mutation. 2017-05-02 2017-05-02 2507 Dmd RGSC 3.4 X 71501362 71671414 + Dmdmdx;Dmdem1Ang
12880032 Dmdem1Ang dystrophin; TALEN-induced mutant1, Ang This mutant allele was generated using TALEN targeting exon23 of rat Dmd. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 frame shift and premature stop codon 81 bp after the mutation. 2017-05-02 2017-05-02 2507 Dmd Rnor_5.0 X 51475950 53700033 + Dmdmdx;Dmdem1Ang
12880032 Dmdem1Ang dystrophin; TALEN-induced mutant1, Ang This mutant allele was generated using TALEN targeting exon23 of rat Dmd. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 frame shift and premature stop codon 81 bp after the mutation. 2017-05-02 2017-05-02 2507 Dmd Rnor_6.0 X 51149358 53519271 + Dmdmdx;Dmdem1Ang
632518375 Dmdem1Gene dystrophin; CRISPR/Cas9 induced mutant 1, Gene This CRISPR/Cas9 induced rat Dmd gene mutation contains a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, 2026-02-10 2026-02-10 2507 Dmd RGSC 3.4 X 71501362 71671414 +
632518375 Dmdem1Gene dystrophin; CRISPR/Cas9 induced mutant 1, Gene This CRISPR/Cas9 induced rat Dmd gene mutation contains a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, 2026-02-10 2026-02-10 2507 Dmd Rnor_5.0 X 51475950 53700033 +
632518375 Dmdem1Gene dystrophin; CRISPR/Cas9 induced mutant 1, Gene This CRISPR/Cas9 induced rat Dmd gene mutation contains a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, 2026-02-10 2026-02-10 2507 Dmd Rnor_6.0 X 51149358 53519271 +
10045592 Dmdem1Kykn dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi mutation induced by CRISPR/Cas9 system in the Dmd gene resulting 329-bp deletion around exon 3 and 2-bp substitution in exon16. 2015-06-12 2015-06-12 2507 Dmd RGSC 3.4 X 71501362 71671414 + Dmdem1Kykn;Dmdem1Kykn
10045592 Dmdem1Kykn dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi mutation induced by CRISPR/Cas9 system in the Dmd gene resulting 329-bp deletion around exon 3 and 2-bp substitution in exon16. 2015-06-12 2015-06-12 2507 Dmd Rnor_5.0 X 51475950 53700033 + Dmdem1Kykn;Dmdem1Kykn
10045592 Dmdem1Kykn dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi mutation induced by CRISPR/Cas9 system in the Dmd gene resulting 329-bp deletion around exon 3 and 2-bp substitution in exon16. 2015-06-12 2015-06-12 2507 Dmd Rnor_6.0 X 51149358 53519271 + Dmdem1Kykn;Dmdem1Kykn
630350394 Dmdem2Kykn dystrophin; CRISPR/Cas9 system induced mutant 2, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 2026-01-12 2026-01-12 2507 Dmd RGSC 3.4 X 71501362 71671414 +
630350394 Dmdem2Kykn dystrophin; CRISPR/Cas9 system induced mutant 2, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 2026-01-12 2026-01-12 2507 Dmd Rnor_5.0 X 51475950 53700033 +
630350394 Dmdem2Kykn dystrophin; CRISPR/Cas9 system induced mutant 2, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 2026-01-12 2026-01-12 2507 Dmd Rnor_6.0 X 51149358 53519271 +
630350395 Dmdem3Kykn dystrophin; CRISPR/Cas9 system induced mutant 3, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). 2026-01-12 2026-01-12 2507 Dmd RGSC 3.4 X 71501362 71671414 +
630350395 Dmdem3Kykn dystrophin; CRISPR/Cas9 system induced mutant 3, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). 2026-01-12 2026-01-12 2507 Dmd Rnor_5.0 X 51475950 53700033 +
630350395 Dmdem3Kykn dystrophin; CRISPR/Cas9 system induced mutant 3, Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). 2026-01-12 2026-01-12 2507 Dmd Rnor_6.0 X 51149358 53519271 +
2303098 Dnah11Tn(sb-T2/Bart3)2.293Mcwi dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. 2009-02-02 2009-02-02 621088 Dnah11 RGSC 3.4 6 145190931 145516859 - Dnah11Tn(sb-T2/Bart3)2.293Mcwi
2303098 Dnah11Tn(sb-T2/Bart3)2.293Mcwi dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. 2009-02-02 2009-02-02 621088 Dnah11 Rnor_5.0 6 154698519 155011384 - Dnah11Tn(sb-T2/Bart3)2.293Mcwi
2303098 Dnah11Tn(sb-T2/Bart3)2.293Mcwi dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. 2009-02-02 2009-02-02 621088 Dnah11 Rnor_6.0 6 145784893 146099212 - Dnah11Tn(sb-T2/Bart3)2.293Mcwi
150340622 Dnd1ter DND microRNA-mediated repression inhibitor 1, ter mutant This is a spontaneous mutation (ter) allele leading to the formation of congenital ovarian and testicular tumorsin the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. 2021-08-20 2021-08-20 1583648 Dnd1 RGSC 3.4 18 29464691 29467315 -
150340622 Dnd1ter DND microRNA-mediated repression inhibitor 1, ter mutant This is a spontaneous mutation (ter) allele leading to the formation of congenital ovarian and testicular tumorsin the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. 2021-08-20 2021-08-20 1583648 Dnd1 Rnor_5.0 18 29312395 29315019 -
150340622 Dnd1ter DND microRNA-mediated repression inhibitor 1, ter mutant This is a spontaneous mutation (ter) allele leading to the formation of congenital ovarian and testicular tumorsin the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. 2021-08-20 2021-08-20 1583648 Dnd1 Rnor_6.0 18 29608588 29611212 -
2299114 Dnhd1Tn(sb-T2/Bart3)2.243Mcwi dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. 2008-08-12 2008-08-12 1584052 Dnhd1 RGSC 3.4 1 163380065 163467261 + transposon insertion 2.243, Medical College of Wisconsin;similar to Dynein heavy chain at 36C CG5526-PA;LOC686729Tn(sb-T2/Bart3)2.243Mcwi;Dnhd1Tn(sb-T2/Bart3)2.243Mcwi
2299114 Dnhd1Tn(sb-T2/Bart3)2.243Mcwi dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. 2008-08-12 2008-08-12 1584052 Dnhd1 Rnor_5.0 1 177487073 177576072 + transposon insertion 2.243, Medical College of Wisconsin;similar to Dynein heavy chain at 36C CG5526-PA;LOC686729Tn(sb-T2/Bart3)2.243Mcwi;Dnhd1Tn(sb-T2/Bart3)2.243Mcwi
2299114 Dnhd1Tn(sb-T2/Bart3)2.243Mcwi dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. 2008-08-12 2008-08-12 1584052 Dnhd1 Rnor_6.0 1 170473792 170570220 + transposon insertion 2.243, Medical College of Wisconsin;similar to Dynein heavy chain at 36C CG5526-PA;LOC686729Tn(sb-T2/Bart3)2.243Mcwi;Dnhd1Tn(sb-T2/Bart3)2.243Mcwi
126925165 Dnmt1tm1(Myh6-cre)Cqin DNA methyltransferase 1; tm1(Myh6-cre), Cqin Cre-loxP system was use to specifically knockout cardiac expression of Dnmt1. 2021-05-13 2021-05-13 620979 Dnmt1 RGSC 3.4 8 19926995 19973256 - DNA methyltransferase 1;tm1(Myh6-cre), Cqin
126925165 Dnmt1tm1(Myh6-cre)Cqin DNA methyltransferase 1; tm1(Myh6-cre), Cqin Cre-loxP system was use to specifically knockout cardiac expression of Dnmt1. 2021-05-13 2021-05-13 620979 Dnmt1 Rnor_5.0 8 21978830 22024656 - DNA methyltransferase 1;tm1(Myh6-cre), Cqin
126925165 Dnmt1tm1(Myh6-cre)Cqin DNA methyltransferase 1; tm1(Myh6-cre), Cqin Cre-loxP system was use to specifically knockout cardiac expression of Dnmt1. 2021-05-13 2021-05-13 620979 Dnmt1 Rnor_6.0 8 21922515 21968495 - DNA methyltransferase 1;tm1(Myh6-cre), Cqin
13830868 Dock8m1Ztm dedicator of cytokinesis 8;mutant 1, Ztm A spontaneous mutation from C to G in Dock8 in exon 44 at position 228, 622, 763 (RGSC Genome Assembly v3.4) on RNO1 was identified. This mutation caused the change of glutamine to glutamate (Q1864E). The mutation is located in β4 of the DOCK homology region (DHR)-2 involved in CDC42 binding. 2018-12-06 2018-12-06 1561588 Dock8 RGSC 3.4 1 228441384 228634717 +
13830868 Dock8m1Ztm dedicator of cytokinesis 8;mutant 1, Ztm A spontaneous mutation from C to G in Dock8 in exon 44 at position 228, 622, 763 (RGSC Genome Assembly v3.4) on RNO1 was identified. This mutation caused the change of glutamine to glutamate (Q1864E). The mutation is located in β4 of the DOCK homology region (DHR)-2 involved in CDC42 binding. 2018-12-06 2018-12-06 1561588 Dock8 Rnor_5.0 1 250200507 250417771 +
13830868 Dock8m1Ztm dedicator of cytokinesis 8;mutant 1, Ztm A spontaneous mutation from C to G in Dock8 in exon 44 at position 228, 622, 763 (RGSC Genome Assembly v3.4) on RNO1 was identified. This mutation caused the change of glutamine to glutamate (Q1864E). The mutation is located in β4 of the DOCK homology region (DHR)-2 involved in CDC42 binding. 2018-12-06 2018-12-06 1561588 Dock8 Rnor_6.0 1 242934685 243153472 +
626419686 Dop1avf DOP1 leucine zipper like protein A;vacuole formation This vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) in VF/Kyo strain. 2025-09-05 2025-09-05 1305534 Dop1a RGSC 3.4 8 91706333 91808911 +
626419686 Dop1avf DOP1 leucine zipper like protein A;vacuole formation This vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) in VF/Kyo strain. 2025-09-05 2025-09-05 1305534 Dop1a Rnor_5.0 8 93635887 93738274 +
626419686 Dop1avf DOP1 leucine zipper like protein A;vacuole formation This vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) in VF/Kyo strain. 2025-09-05 2025-09-05 1305534 Dop1a Rnor_6.0 8 94122733 94225131 +
12792942 Dpp4DPPIV dipeptidylpeptidase 4; DPPIV mutant The DPP4 mutant allele was a spontaneous mutation found in Fischer 344 rats, which caused a deficiency in Dpp4. The mutant allele has a G to A change at nucleotide 1897 (in exon 22), which results in an amino acid change of Gly (WT; GGA) to Arg (Mut; AGA). 2017-03-16 2017-03-16 2515 Dpp4 RGSC 3.4 3 44279255 44360283 - Dpp4DPPIV-;Dpp4DPPIV-
12792942 Dpp4DPPIV dipeptidylpeptidase 4; DPPIV mutant The DPP4 mutant allele was a spontaneous mutation found in Fischer 344 rats, which caused a deficiency in Dpp4. The mutant allele has a G to A change at nucleotide 1897 (in exon 22), which results in an amino acid change of Gly (WT; GGA) to Arg (Mut; AGA). 2017-03-16 2017-03-16 2515 Dpp4 Rnor_5.0 3 54957146 55038628 - Dpp4DPPIV-;Dpp4DPPIV-
12792942 Dpp4DPPIV dipeptidylpeptidase 4; DPPIV mutant The DPP4 mutant allele was a spontaneous mutation found in Fischer 344 rats, which caused a deficiency in Dpp4. The mutant allele has a G to A change at nucleotide 1897 (in exon 22), which results in an amino acid change of Gly (WT; GGA) to Arg (Mut; AGA). 2017-03-16 2017-03-16 2515 Dpp4 Rnor_6.0 3 48291055 48372672 - Dpp4DPPIV-;Dpp4DPPIV-
14398500 Drd1em1(iCre)Berke dopamine receptor D1; CRISPR induced targeted mutant 1, Berke The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. 2019-04-23 2019-04-23 2518 Drd1 RGSC 3.4 17 16655926 16658161 + Drd1tm1(Cre)Berke
14398500 Drd1em1(iCre)Berke dopamine receptor D1; CRISPR induced targeted mutant 1, Berke The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. 2019-04-23 2019-04-23 2518 Drd1 Rnor_5.0 17 13211031 13215581 + Drd1tm1(Cre)Berke
14398500 Drd1em1(iCre)Berke dopamine receptor D1; CRISPR induced targeted mutant 1, Berke The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. 2019-04-23 2019-04-23 2518 Drd1 Rnor_6.0 17 11099736 11104352 + Drd1tm1(Cre)Berke
11073717 Drd1em1Ionsz dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. 2016-05-04 2016-05-04 2518 Drd1 RGSC 3.4 17 16655926 16658161 + Drd1em1Ionsz
11073717 Drd1em1Ionsz dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. 2016-05-04 2016-05-04 2518 Drd1 Rnor_5.0 17 13211031 13215581 + Drd1em1Ionsz
11073717 Drd1em1Ionsz dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. 2016-05-04 2016-05-04 2518 Drd1 Rnor_6.0 17 11099736 11104352 + Drd1em1Ionsz
126925213 Drd1m1Hubr dopamine receptor D1; ENU induced mutant 1, Hubr The Drd1 mutant allele was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein. 2021-05-14 2021-05-14 2518 Drd1 RGSC 3.4 17 16655926 16658161 + Drd1I116S
126925213 Drd1m1Hubr dopamine receptor D1; ENU induced mutant 1, Hubr The Drd1 mutant allele was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein. 2021-05-14 2021-05-14 2518 Drd1 Rnor_5.0 17 13211031 13215581 + Drd1I116S
126925213 Drd1m1Hubr dopamine receptor D1; ENU induced mutant 1, Hubr The Drd1 mutant allele was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein. 2021-05-14 2021-05-14 2518 Drd1 Rnor_6.0 17 11099736 11104352 + Drd1I116S
150521603 Dsg4hr desmoglein 4; hairless mutant This Iffa Credo ( IC) hairless mutation was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. 2021-11-11 2021-11-11 735015 Dsg4 RGSC 3.4 18 12173507 12209833 +
150521603 Dsg4hr desmoglein 4; hairless mutant This Iffa Credo ( IC) hairless mutation was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. 2021-11-11 2021-11-11 735015 Dsg4 Rnor_5.0 18 11853980 11888828 +
150521603 Dsg4hr desmoglein 4; hairless mutant This Iffa Credo ( IC) hairless mutation was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. 2021-11-11 2021-11-11 735015 Dsg4 Rnor_6.0 18 12056113 12092858 +
13451539 Dusp5em1Mcwi dual specificity phosphatase 5; ZFN induced mutant1, Mcwi This mutation was induced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC- CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449¿464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid (AA) 121. 2017-11-16 2017-11-16 620854 Dusp5 RGSC 3.4 1 259754234 259767645 + Dusp5em1Mcwi
13451539 Dusp5em1Mcwi dual specificity phosphatase 5; ZFN induced mutant1, Mcwi This mutation was induced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC- CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449¿464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid (AA) 121. 2017-11-16 2017-11-16 620854 Dusp5 Rnor_5.0 1 281658075 281671486 + Dusp5em1Mcwi
13451539 Dusp5em1Mcwi dual specificity phosphatase 5; ZFN induced mutant1, Mcwi This mutation was induced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC- CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449¿464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid (AA) 121. 2017-11-16 2017-11-16 620854 Dusp5 Rnor_6.0 1 274245184 274258595 + Dusp5em1Mcwi
2291839 Dzank1Tn(sb-T2/Bart3)2.164Mcwi double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene 2008-04-01 2008-04-01 1311344 Dzank1 RGSC 3.4 3 133021912 133073987 - transposon insertion 2.164, Medical College of Wisconsin;RGD1311344Tn(sb-T2/Bart3)2.164Mcwi;similar to RIKEN cDNA 2810039F03;Dzank1Tn(sb-T2/Bart3)2.164Mcwi
2291839 Dzank1Tn(sb-T2/Bart3)2.164Mcwi double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene 2008-04-01 2008-04-01 1311344 Dzank1 Rnor_5.0 3 145054445 145114445 - transposon insertion 2.164, Medical College of Wisconsin;RGD1311344Tn(sb-T2/Bart3)2.164Mcwi;similar to RIKEN cDNA 2810039F03;Dzank1Tn(sb-T2/Bart3)2.164Mcwi
2291839 Dzank1Tn(sb-T2/Bart3)2.164Mcwi double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene 2008-04-01 2008-04-01 1311344 Dzank1 Rnor_6.0 3 138624517 138684530 - transposon insertion 2.164, Medical College of Wisconsin;RGD1311344Tn(sb-T2/Bart3)2.164Mcwi;similar to RIKEN cDNA 2810039F03;Dzank1Tn(sb-T2/Bart3)2.164Mcwi
14398765 EdaraddswhKyo EDAR-associated death domain;swh Kyo mutant A spontaneous sparse-and-wavy (swh) mutation was identified in WTC-swh/Kyo rats. A missense mutation (C to T) in exon 6 of the swh/swh Edaradd gene was identified in the mutant rat. 2019-04-30 2019-04-30 1564010 Edaradd RGSC 3.4 17 67056373 67143933 +
14398765 EdaraddswhKyo EDAR-associated death domain;swh Kyo mutant A spontaneous sparse-and-wavy (swh) mutation was identified in WTC-swh/Kyo rats. A missense mutation (C to T) in exon 6 of the swh/swh Edaradd gene was identified in the mutant rat. 2019-04-30 2019-04-30 1564010 Edaradd Rnor_5.0 17 92462305 92503399 +
14398765 EdaraddswhKyo EDAR-associated death domain;swh Kyo mutant A spontaneous sparse-and-wavy (swh) mutation was identified in WTC-swh/Kyo rats. A missense mutation (C to T) in exon 6 of the swh/swh Edaradd gene was identified in the mutant rat. 2019-04-30 2019-04-30 1564010 Edaradd Rnor_6.0 17 90802280 90843476 +
10755424 Ednrbsl endothelin receptor type B, spotting lethal This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats. 2016-01-27 2016-11-07 2536 Ednrb RGSC 3.4 15 87893141 87898700 - EdnrbslHkv;EdnrbslHkv;Ednrbsl
10755424 Ednrbsl endothelin receptor type B, spotting lethal This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats. 2016-01-27 2016-11-07 2536 Ednrb Rnor_5.0 15 91500400 91531979 - EdnrbslHkv;EdnrbslHkv;Ednrbsl
10755424 Ednrbsl endothelin receptor type B, spotting lethal This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats. 2016-01-27 2016-11-07 2536 Ednrb Rnor_6.0 15 88004775 88036354 - EdnrbslHkv;EdnrbslHkv;Ednrbsl
1578781 Egln3m1Mcwi egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E60G mutation is generated 2006-05-02 2006-05-02 71019 Egln3 RGSC 3.4 6 74451038 74476506 - Egln3m1Mcwi
1578781 Egln3m1Mcwi egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E60G mutation is generated 2006-05-02 2006-05-02 71019 Egln3 Rnor_5.0 6 84592894 84618360 - Egln3m1Mcwi
1578781 Egln3m1Mcwi egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E60G mutation is generated 2006-05-02 2006-05-02 71019 Egln3 Rnor_6.0 6 75050329 75075795 - Egln3m1Mcwi
38599016 Eif2ak4em1 eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1 The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. 2020-09-08 2020-09-08 1311439 Eif2ak4 RGSC 3.4 3 104870871 104875529 +
38599016 Eif2ak4em1 eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1 The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. 2020-09-08 2020-09-08 1311439 Eif2ak4 Rnor_5.0 3 116705333 116791037 +
38599016 Eif2ak4em1 eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1 The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. 2020-09-08 2020-09-08 1311439 Eif2ak4 Rnor_6.0 3 110159624 110245382 +
2290055 Elmod3Tn(sb-T2/Bart3)2.42Mcwi RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene 2008-02-26 2008-02-26 1306408 Elmod3 RGSC 3.4 4 105866419 106099850 - Rbed1Tn(sb-T2/Bart3)1.42Mcwi;Elmod3Tn(sb-T2/Bart3)2.42Mcwi
2290055 Elmod3Tn(sb-T2/Bart3)2.42Mcwi RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene 2008-02-26 2008-02-26 1306408 Elmod3 Rnor_5.0 4 165192607 165237016 - Rbed1Tn(sb-T2/Bart3)1.42Mcwi;Elmod3Tn(sb-T2/Bart3)2.42Mcwi
2290055 Elmod3Tn(sb-T2/Bart3)2.42Mcwi RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene 2008-02-26 2008-02-26 1306408 Elmod3 Rnor_6.0 4 100422256 100465152 - Rbed1Tn(sb-T2/Bart3)1.42Mcwi;Elmod3Tn(sb-T2/Bart3)2.42Mcwi
597538481 Eml1tish EMAP like 1, tish mutant The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the Eml1 genome (Rnor_6.0; ENSRNOG00000043143). It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. 2025-01-23 2025-01-23 1306374 Eml1 RGSC 3.4 6 132825590 132880169 +
597538481 Eml1tish EMAP like 1, tish mutant The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the Eml1 genome (Rnor_6.0; ENSRNOG00000043143). It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. 2025-01-23 2025-01-23 1306374 Eml1 Rnor_5.0 6 141536753 141619726 +
597538481 Eml1tish EMAP like 1, tish mutant The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the Eml1 genome (Rnor_6.0; ENSRNOG00000043143). It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. 2025-01-23 2025-01-23 1306374 Eml1 Rnor_6.0 6 132367342 132450488 +
2302641 Enox1Tn(sb-T2/Bart3)2.282Mcwi ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. 2009-01-06 2009-01-06 1306118 Enox1 RGSC 3.4 15 58555747 58762870 + Enox1Tn(sb-T2/Bart3)2.282Mcwi
2302641 Enox1Tn(sb-T2/Bart3)2.282Mcwi ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. 2009-01-06 2009-01-06 1306118 Enox1 Rnor_5.0 15 63013519 63564418 + Enox1Tn(sb-T2/Bart3)2.282Mcwi
2302641 Enox1Tn(sb-T2/Bart3)2.282Mcwi ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. 2009-01-06 2009-01-06 1306118 Enox1 Rnor_6.0 15 59331134 59884512 + Enox1Tn(sb-T2/Bart3)2.282Mcwi
2290086 Entpd6Tn(sb-T2/Bart3)2.174Mcwi ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene 2008-02-26 2008-02-26 619725 Entpd6 RGSC 3.4 3 141385480 141407860 + Entpd6Tn(sb-T2/Bart3)2.174Mcwi
2290086 Entpd6Tn(sb-T2/Bart3)2.174Mcwi ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene 2008-02-26 2008-02-26 619725 Entpd6 Rnor_5.0 3 152905464 152927857 + Entpd6Tn(sb-T2/Bart3)2.174Mcwi
2290086 Entpd6Tn(sb-T2/Bart3)2.174Mcwi ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene 2008-02-26 2008-02-26 619725 Entpd6 Rnor_6.0 3 146546424 146568828 + Entpd6Tn(sb-T2/Bart3)2.174Mcwi
628359038 Epas1em1Soar endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene 2025-09-19 2025-09-19 68404 Epas1 RGSC 3.4 6 10203108 10297215 + Epas1em1Soar
628359038 Epas1em1Soar endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene 2025-09-19 2025-09-19 68404 Epas1 Rnor_5.0 6 20299603 20379864 + Epas1em1Soar
628359038 Epas1em1Soar endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene 2025-09-19 2025-09-19 68404 Epas1 Rnor_6.0 6 10306508 10385239 + Epas1em1Soar
25394529 Ephx2em2Mcwi epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. 2020-04-09 2020-05-28 620732 Ephx2 RGSC 3.4 15 45497660 45556101 -
25394529 Ephx2em2Mcwi epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. 2020-04-09 2020-05-28 620732 Ephx2 Rnor_5.0 15 48799823 48836848 +
25394529 Ephx2em2Mcwi epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. 2020-04-09 2020-05-28 620732 Ephx2 Rnor_6.0 15 42757241 42794211 -
2299110 Erbb4Tn(sb-T2/Bart3)2.208Mcwi v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. 2008-08-12 2008-08-12 620486 Erbb4 RGSC 3.4 9 66843898 67967970 - Erbb4Tn(sb-T2/Bart3)2.208Mcwi
2299110 Erbb4Tn(sb-T2/Bart3)2.208Mcwi v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. 2008-08-12 2008-08-12 620486 Erbb4 Rnor_5.0 9 74804287 75310350 - Erbb4Tn(sb-T2/Bart3)2.208Mcwi
2299110 Erbb4Tn(sb-T2/Bart3)2.208Mcwi v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. 2008-08-12 2008-08-12 620486 Erbb4 Rnor_6.0 9 75021790 76178936 - Erbb4Tn(sb-T2/Bart3)2.208Mcwi
126925980 Ercc6em1Cgen ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA) to SD embryos. 2021-05-24 2021-05-24 1311509 Ercc6 RGSC 3.4 16 8024881 8091587 +
126925980 Ercc6em1Cgen ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA) to SD embryos. 2021-05-24 2021-05-24 1311509 Ercc6 Rnor_5.0 16 10699983 10770565 +
126925980 Ercc6em1Cgen ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA) to SD embryos. 2021-05-24 2021-05-24 1311509 Ercc6 Rnor_6.0 16 8734028 8804610 +
405649861 Esr1em1Bra estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra This CRISPR/Cas9 system was used to generate a 25 bp deletion in the rat Esr1, resulting lost of function for Esr1. 2024-04-17 2024-04-17 2581 Esr1 RGSC 3.4 1 35523680 35759891 +
405649861 Esr1em1Bra estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra This CRISPR/Cas9 system was used to generate a 25 bp deletion in the rat Esr1, resulting lost of function for Esr1. 2024-04-17 2024-04-17 2581 Esr1 Rnor_5.0 1 42534049 42935434 +
405649861 Esr1em1Bra estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra This CRISPR/Cas9 system was used to generate a 25 bp deletion in the rat Esr1, resulting lost of function for Esr1. 2024-04-17 2024-04-17 2581 Esr1 Rnor_6.0 1 41192029 41594799 +
12910736 Esr1em1Soar estrogen receptor 1; ZFN induced mutant 1, Soar zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out. 2017-06-22 2017-06-22 2581 Esr1 RGSC 3.4 1 35523680 35759891 + Esr1em1Soar
12910736 Esr1em1Soar estrogen receptor 1; ZFN induced mutant 1, Soar zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out. 2017-06-22 2017-06-22 2581 Esr1 Rnor_5.0 1 42534049 42935434 + Esr1em1Soar
12910736 Esr1em1Soar estrogen receptor 1; ZFN induced mutant 1, Soar zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out. 2017-06-22 2017-06-22 2581 Esr1 Rnor_6.0 1 41192029 41594799 + Esr1em1Soar
40902840 Esr2em1Soar estrogen receptor 2; ZFN induced mutant 1, Soar Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4 2020-12-14 2020-12-14 2582 Esr2 RGSC 3.4 6 98691167 98775299 -
40902840 Esr2em1Soar estrogen receptor 2; ZFN induced mutant 1, Soar Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4 2020-12-14 2020-12-14 2582 Esr2 Rnor_5.0 6 108576398 108626196 -
40902840 Esr2em1Soar estrogen receptor 2; ZFN induced mutant 1, Soar Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4 2020-12-14 2020-12-14 2582 Esr2 Rnor_6.0 6 99163953 99214711 -
4139856 Ets1em1Mcwi v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 515-522). 2010-08-19 2010-08-19 2583 Ets1 RGSC 3.4 8 32481694 32545237 + Ets1em1Mcwi
4139856 Ets1em1Mcwi v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 515-522). 2010-08-19 2010-08-19 2583 Ets1 Rnor_5.0 8 33798598 33921593 + Ets1em1Mcwi
4139856 Ets1em1Mcwi v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 515-522). 2010-08-19 2010-08-19 2583 Ets1 Rnor_6.0 8 33756634 33879625 + Ets1em1Mcwi
2299094 Eva1aTn(sb-T2/Bart3)2.233Mcwi eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. 2008-08-12 2008-08-12 1559797 Eva1a RGSC 3.4 4 116280880 116330122 + Tmem166Tn(sb-T2/Bart3)2.233Mcwi;Fam176aTn(sb-T2/Bart3)2.233Mcwi;Eva1aTn(sb-T2/Bart3)2.233Mcwi
2299094 Eva1aTn(sb-T2/Bart3)2.233Mcwi eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. 2008-08-12 2008-08-12 1559797 Eva1a Rnor_5.0 4 177461600 177511382 + Tmem166Tn(sb-T2/Bart3)2.233Mcwi;Fam176aTn(sb-T2/Bart3)2.233Mcwi;Eva1aTn(sb-T2/Bart3)2.233Mcwi
2299094 Eva1aTn(sb-T2/Bart3)2.233Mcwi eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. 2008-08-12 2008-08-12 1559797 Eva1a Rnor_6.0 4 112714023 112823659 + Tmem166Tn(sb-T2/Bart3)2.233Mcwi;Fam176aTn(sb-T2/Bart3)2.233Mcwi;Eva1aTn(sb-T2/Bart3)2.233Mcwi
2306273 Exoc4Tn(sb-T2/Bart3)2.317Mcwi exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2009-04-01 2009-04-01 621791 Exoc4 RGSC 3.4 4 60406942 61284294 + Exoc4Tn(sb-T2/Bart3)2.317Mcwi
2306273 Exoc4Tn(sb-T2/Bart3)2.317Mcwi exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2009-04-01 2009-04-01 621791 Exoc4 Rnor_5.0 4 60913238 61081401 + Exoc4Tn(sb-T2/Bart3)2.317Mcwi
2306273 Exoc4Tn(sb-T2/Bart3)2.317Mcwi exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2009-04-01 2009-04-01 621791 Exoc4 Rnor_5.0 4 60287465 60839820 + Exoc4Tn(sb-T2/Bart3)2.317Mcwi
2306273 Exoc4Tn(sb-T2/Bart3)2.317Mcwi exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2009-04-01 2009-04-01 621791 Exoc4 Rnor_6.0 4 60549128 61358305 + Exoc4Tn(sb-T2/Bart3)2.317Mcwi
1578783 F10m1Mcwi coagulation factor X; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V453G mutation is generated from the codon change GTC/GGC 2006-05-02 2006-05-02 61850 F10 RGSC 3.4 16 81327237 81346544 - F10m1Mcwi
1578783 F10m1Mcwi coagulation factor X; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V453G mutation is generated from the codon change GTC/GGC 2006-05-02 2006-05-02 61850 F10 Rnor_5.0 16 81288536 81307842 - F10m1Mcwi
1578783 F10m1Mcwi coagulation factor X; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V453G mutation is generated from the codon change GTC/GGC 2006-05-02 2006-05-02 61850 F10 Rnor_6.0 16 81803169 81822476 - F10m1Mcwi
1579886 F10m2Mcwi coagulation factor X; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA 2006-05-24 2006-05-24 61850 F10 RGSC 3.4 16 81327237 81346544 - F10m2Mcwi
1579886 F10m2Mcwi coagulation factor X; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA 2006-05-24 2006-05-24 61850 F10 Rnor_5.0 16 81288536 81307842 - F10m2Mcwi
1579886 F10m2Mcwi coagulation factor X; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA 2006-05-24 2006-05-24 61850 F10 Rnor_6.0 16 81803169 81822476 - F10m2Mcwi
13799351 F2rem1Mcwi coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. 2018-10-10 2018-10-10 2586 F2r RGSC 3.4 2 25985800 25989072 -
13799351 F2rem1Mcwi coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. 2018-10-10 2018-10-10 2586 F2r Rnor_5.0 2 45254489 45257761 -
13799351 F2rem1Mcwi coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. 2018-10-10 2018-10-10 2586 F2r Rnor_6.0 2 26118760 26135340 -
11531096 F8em1Sage coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage This F8 mutant allele carrying a 13-bp deletion in exon 16 causing a premature translation stop in the C-terminal part of the A3 domain. 2016-08-25 2016-08-25 727845 F8 RGSC 3.4 18 121134 162008 + zinc finger nuclease induced mutant1, Sage, Ycb;coagulation factor VIII, procoagulant component;F8em1Sage
11531096 F8em1Sage coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage This F8 mutant allele carrying a 13-bp deletion in exon 16 causing a premature translation stop in the C-terminal part of the A3 domain. 2016-08-25 2016-08-25 727845 F8 Rnor_5.0 18 413447 444491 - zinc finger nuclease induced mutant1, Sage, Ycb;coagulation factor VIII, procoagulant component;F8em1Sage
11531096 F8em1Sage coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage This F8 mutant allele carrying a 13-bp deletion in exon 16 causing a premature translation stop in the C-terminal part of the A3 domain. 2016-08-25 2016-08-25 727845 F8 Rnor_6.0 18 367862 399242 - zinc finger nuclease induced mutant1, Sage, Ycb;coagulation factor VIII, procoagulant component;F8em1Sage
2314903 F8m1Ycb coagulation factor VIII, procoagulant component; mutation 1, Ycb This allele is a naturally occurring missense mutation found in an inherited coagulopathy arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. 2009-12-08 2013-06-17 727845 F8 RGSC 3.4 18 121134 162008 + F8m1Ycb
2314903 F8m1Ycb coagulation factor VIII, procoagulant component; mutation 1, Ycb This allele is a naturally occurring missense mutation found in an inherited coagulopathy arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. 2009-12-08 2013-06-17 727845 F8 Rnor_5.0 18 413447 444491 - F8m1Ycb
2314903 F8m1Ycb coagulation factor VIII, procoagulant component; mutation 1, Ycb This allele is a naturally occurring missense mutation found in an inherited coagulopathy arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. 2009-12-08 2013-06-17 727845 F8 Rnor_6.0 18 367862 399242 - F8m1Ycb
13800747 F8em1Mcwi coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. 2018-10-17 2018-10-17 727845 F8 RGSC 3.4 18 121134 162008 +
13800747 F8em1Mcwi coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. 2018-10-17 2018-10-17 727845 F8 Rnor_5.0 18 413447 444491 -
13800747 F8em1Mcwi coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. 2018-10-17 2018-10-17 727845 F8 Rnor_6.0 18 367862 399242 -
14398829 Fahem10Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. 2019-05-02 2019-05-02 61932 Fah RGSC 3.4 1 140851975 140876187 -
14398829 Fahem10Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. 2019-05-02 2019-05-02 61932 Fah Rnor_5.0 1 147640316 147662920 -
14398829 Fahem10Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. 2019-05-02 2019-05-02 61932 Fah Rnor_6.0 1 146713663 146736339 -
14398826 Fahem15Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. 2019-05-02 2019-05-02 61932 Fah RGSC 3.4 1 140851975 140876187 -
14398826 Fahem15Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. 2019-05-02 2019-05-02 61932 Fah Rnor_5.0 1 147640316 147662920 -
14398826 Fahem15Dlli-/- fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. 2019-05-02 2019-05-02 61932 Fah Rnor_6.0 1 146713663 146736339 -
10002790 Fahem3Mcwi fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 3 causing a predicted non-functional protein. 2015-04-28 2015-04-28 61932 Fah RGSC 3.4 1 140851975 140876187 - Fahem3Mcwi
10002790 Fahem3Mcwi fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 3 causing a predicted non-functional protein. 2015-04-28 2015-04-28 61932 Fah Rnor_5.0 1 147640316 147662920 - Fahem3Mcwi
10002790 Fahem3Mcwi fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 3 causing a predicted non-functional protein. 2015-04-28 2015-04-28 61932 Fah Rnor_6.0 1 146713663 146736339 - Fahem3Mcwi
2311687 Fam227aTn(sb-T2/Bart3)2.333Mcwi family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. 2009-07-30 2009-07-30 1305939 Fam227a RGSC 3.4 7 117441099 117469873 + hypothetical protein LOC685444;transposon insertion 2.333, Medical College of Wisconsin;LOC685444Tn(sb-T2/Bart3)2.333Mcwi;Fam227aTn(sb-T2/Bart3)2.333Mcwi
2311687 Fam227aTn(sb-T2/Bart3)2.333Mcwi family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. 2009-07-30 2009-07-30 1305939 Fam227a Rnor_5.0 7 120839737 120881869 - hypothetical protein LOC685444;transposon insertion 2.333, Medical College of Wisconsin;LOC685444Tn(sb-T2/Bart3)2.333Mcwi;Fam227aTn(sb-T2/Bart3)2.333Mcwi
2311687 Fam227aTn(sb-T2/Bart3)2.333Mcwi family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. 2009-07-30 2009-07-30 1305939 Fam227a Rnor_6.0 7 120846166 120891738 - hypothetical protein LOC685444;transposon insertion 2.333, Medical College of Wisconsin;LOC685444Tn(sb-T2/Bart3)2.333Mcwi;Fam227aTn(sb-T2/Bart3)2.333Mcwi
2306872 FaslgTn(sb-T2/Bart3)2.325Mcwi Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. 2009-05-11 2009-05-11 3880 Faslg RGSC 3.4 13 77472950 77480210 - FaslgTn(sb-T2/Bart3)2.325Mcwi
2306872 FaslgTn(sb-T2/Bart3)2.325Mcwi Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. 2009-05-11 2009-05-11 3880 Faslg Rnor_5.0 13 84590119 84605900 - FaslgTn(sb-T2/Bart3)2.325Mcwi
2306872 FaslgTn(sb-T2/Bart3)2.325Mcwi Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. 2009-05-11 2009-05-11 3880 Faslg Rnor_6.0 13 79696811 79717581 - FaslgTn(sb-T2/Bart3)2.325Mcwi
6893412 Fgf1em2Mcwi fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp deletion in exon 3 (del 442-451) 2012-08-28 2012-08-28 2605 Fgf1 RGSC 3.4 18 31785480 31806452 - Fgf1em2Mcwi
6893412 Fgf1em2Mcwi fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp deletion in exon 3 (del 442-451) 2012-08-28 2012-08-28 2605 Fgf1 Rnor_5.0 18 31951411 32037426 + Fgf1em2Mcwi
6893412 Fgf1em2Mcwi fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp deletion in exon 3 (del 442-451) 2012-08-28 2012-08-28 2605 Fgf1 Rnor_6.0 18 32273830 32359831 + Fgf1em2Mcwi
5687720 Fgf5em1Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp deletion in exon 1 (del 314-345) 2012-02-09 2012-02-09 620129 Fgf5 RGSC 3.4 14 12713971 12734634 - Fgf5em1Mcwi
5687720 Fgf5em1Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp deletion in exon 1 (del 314-345) 2012-02-09 2012-02-09 620129 Fgf5 Rnor_5.0 14 12917742 12938879 - Fgf5em1Mcwi
5687720 Fgf5em1Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp deletion in exon 1 (del 314-345) 2012-02-09 2012-02-09 620129 Fgf5 Rnor_6.0 14 12974921 12996046 - Fgf5em1Mcwi
5687727 Fgf5em5Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp deletion in exon 1 (del 341-342) 2012-02-09 2012-02-09 620129 Fgf5 RGSC 3.4 14 12713971 12734634 - Fgf5em5Mcwi
5687727 Fgf5em5Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp deletion in exon 1 (del 341-342) 2012-02-09 2012-02-09 620129 Fgf5 Rnor_5.0 14 12917742 12938879 - Fgf5em5Mcwi
5687727 Fgf5em5Mcwi fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp deletion in exon 1 (del 341-342) 2012-02-09 2012-02-09 620129 Fgf5 Rnor_6.0 14 12974921 12996046 - Fgf5em5Mcwi
1579885 Fgl2m1Mcwi fibrinogen-like 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); A301S mutation is generated from the codon change GCA/TCA 2006-05-24 2006-05-24 620170 Fgl2 RGSC 3.4 4 9176333 9181976 - Fgl2m1Mcwi
1579885 Fgl2m1Mcwi fibrinogen-like 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); A301S mutation is generated from the codon change GCA/TCA 2006-05-24 2006-05-24 620170 Fgl2 Rnor_5.0 4 10315666 10321309 - Fgl2m1Mcwi
1579885 Fgl2m1Mcwi fibrinogen-like 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); A301S mutation is generated from the codon change GCA/TCA 2006-05-24 2006-05-24 620170 Fgl2 Rnor_6.0 4 10323598 10329241 - Fgl2m1Mcwi
1642181 Fgl2m2Mcwi fibrinogen-like 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K129N mutation is generated from the codon change AAG/AAT 2007-09-06 2007-09-06 620170 Fgl2 RGSC 3.4 4 9176333 9181976 - Fgl2m2Mcwi
1642181 Fgl2m2Mcwi fibrinogen-like 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K129N mutation is generated from the codon change AAG/AAT 2007-09-06 2007-09-06 620170 Fgl2 Rnor_5.0 4 10315666 10321309 - Fgl2m2Mcwi
1642181 Fgl2m2Mcwi fibrinogen-like 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K129N mutation is generated from the codon change AAG/AAT 2007-09-06 2007-09-06 620170 Fgl2 Rnor_6.0 4 10323598 10329241 - Fgl2m2Mcwi
1642355 Fgl2m3Mcwi fibrinogen-like 2; mutation 3, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); N353H mutation is generated from the codon change AAT/CAT. 2007-09-13 2007-09-13 620170 Fgl2 RGSC 3.4 4 9176333 9181976 - Fgl2m3Mcwi
1642355 Fgl2m3Mcwi fibrinogen-like 2; mutation 3, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); N353H mutation is generated from the codon change AAT/CAT. 2007-09-13 2007-09-13 620170 Fgl2 Rnor_5.0 4 10315666 10321309 - Fgl2m3Mcwi
1642355 Fgl2m3Mcwi fibrinogen-like 2; mutation 3, Medical College of Wisconsin Mutation generated by ENU (N-ethyl-N-nitrourea); N353H mutation is generated from the codon change AAT/CAT. 2007-09-13 2007-09-13 620170 Fgl2 Rnor_6.0 4 10323598 10329241 - Fgl2m3Mcwi
1642354 Fgl2m4Mcwi fibrinogen-like 2; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H338P mutation is generated from the codon change CAT/CCT 2007-09-13 2007-09-13 620170 Fgl2 RGSC 3.4 4 9176333 9181976 - Fgl2m4Mcwi
1642354 Fgl2m4Mcwi fibrinogen-like 2; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H338P mutation is generated from the codon change CAT/CCT 2007-09-13 2007-09-13 620170 Fgl2 Rnor_5.0 4 10315666 10321309 - Fgl2m4Mcwi
1642354 Fgl2m4Mcwi fibrinogen-like 2; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H338P mutation is generated from the codon change CAT/CCT 2007-09-13 2007-09-13 620170 Fgl2 Rnor_6.0 4 10323598 10329241 - Fgl2m4Mcwi
13792797 Fhem1 fumarate hydratase; TALEN induced mutant 1 A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. 2018-09-28 2018-09-28 2614 Fh RGSC 3.4 13 91329837 91355722 -
13792797 Fhem1 fumarate hydratase; TALEN induced mutant 1 A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. 2018-09-28 2018-09-28 2614 Fh Rnor_5.0 13 98116496 98142636 -
13792797 Fhem1 fumarate hydratase; TALEN induced mutant 1 A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. 2018-09-28 2018-09-28 2614 Fh Rnor_6.0 13 93651486 93677371 -
155631280 Flnaem1Ang filamin A; CRISPRs/Cas9 induced mutant 1, Ang This mutant allele was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. 2022-10-31 2022-10-31 1560614 Flna RGSC 3.4 X 160362334 160385626 +
155631280 Flnaem1Ang filamin A; CRISPRs/Cas9 induced mutant 1, Ang This mutant allele was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. 2022-10-31 2022-10-31 1560614 Flna Rnor_5.0 1 152200936 152227391 +
155631280 Flnaem1Ang filamin A; CRISPRs/Cas9 induced mutant 1, Ang This mutant allele was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. 2022-10-31 2022-10-31 1560614 Flna Rnor_6.0 X 156460785 156487245 +
124715480 Fmr1em1Mzhe FMRP translational regulator 1; CRISPR/Cas9 induced mutant1, Mzhe CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of rat Fmr1 gene of outbred Sprague-Dawley embryos. The resulting mutation a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification resulted in a frame-shift starting from the second Agenet-like 2 domain in Fmr1 protein. 2021-03-26 2021-03-26 2623 Fmr1 RGSC 3.4 X 154756031 154793782 +
124715480 Fmr1em1Mzhe FMRP translational regulator 1; CRISPR/Cas9 induced mutant1, Mzhe CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of rat Fmr1 gene of outbred Sprague-Dawley embryos. The resulting mutation a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification resulted in a frame-shift starting from the second Agenet-like 2 domain in Fmr1 protein. 2021-03-26 2021-03-26 2623 Fmr1 Rnor_6.0 X 154684924 154722369 -
11568041 Fmr1em1Sage FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp and caused knockout of Fmr1 demonstrated by western blot. 2016-12-06 2016-12-06 2623 Fmr1 RGSC 3.4 X 154756031 154793782 + Fmr1em1Sage;fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
11568041 Fmr1em1Sage FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp and caused knockout of Fmr1 demonstrated by western blot. 2016-12-06 2016-12-06 2623 Fmr1 Rnor_6.0 X 154684924 154722369 - Fmr1em1Sage;fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
625813034 Fmr1em1Sidb FMRP translational regulator 1; ZFN induced mutant1,Sidb This allele was produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting knock out of Fmr1 mRNA and protein 2025-08-14 2025-08-14 2623 Fmr1 RGSC 3.4 X 154756031 154793782 + Fmr1em1Pwc
625813034 Fmr1em1Sidb FMRP translational regulator 1; ZFN induced mutant1,Sidb This allele was produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting knock out of Fmr1 mRNA and protein 2025-08-14 2025-08-14 2623 Fmr1 Rnor_6.0 X 154684924 154722369 - Fmr1em1Pwc
11553872 Fmr1em2Mcwi FMRP translational regulator 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in exon 7 of the Fmr1 gene. 2016-10-17 2016-10-17 2623 Fmr1 RGSC 3.4 X 154756031 154793782 + Fmr1em2Mcwi;fragile X mental retardation 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin
11553872 Fmr1em2Mcwi FMRP translational regulator 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in exon 7 of the Fmr1 gene. 2016-10-17 2016-10-17 2623 Fmr1 Rnor_6.0 X 154684924 154722369 - Fmr1em2Mcwi;fragile X mental retardation 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin
11553874 Fmr1em4Mcwi FMRP translational regulator 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 7 of the Fmr1 gene. 2016-10-17 2016-10-17 2623 Fmr1 RGSC 3.4 X 154756031 154793782 + Fmr1em4Mcwi;fragile X mental retardation 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin
11553874 Fmr1em4Mcwi FMRP translational regulator 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 7 of the Fmr1 gene. 2016-10-17 2016-10-17 2623 Fmr1 Rnor_6.0 X 154684924 154722369 - Fmr1em4Mcwi;fragile X mental retardation 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin
10053596 Foxn1em1Nips forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). 2015-07-15 2016-12-12 3970 Foxn1 RGSC 3.4 10 64243323 64256847 + Foxn1em1Nips
10053596 Foxn1em1Nips forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). 2015-07-15 2016-12-12 3970 Foxn1 Rnor_5.0 10 66004940 66030134 + Foxn1em1Nips
10053596 Foxn1em1Nips forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). 2015-07-15 2016-12-12 3970 Foxn1 Rnor_6.0 10 65621142 65634666 - Foxn1em1Nips
10053599 Foxn1em2Nips forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105) 2015-07-15 2016-12-12 3970 Foxn1 RGSC 3.4 10 64243323 64256847 + Foxn1em2Nips
10053599 Foxn1em2Nips forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105) 2015-07-15 2016-12-12 3970 Foxn1 Rnor_5.0 10 66004940 66030134 + Foxn1em2Nips
10053599 Foxn1em2Nips forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences This allele was made by CRISPR mutagenesis. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105) 2015-07-15 2016-12-12 3970 Foxn1 Rnor_6.0 10 65621142 65634666 - Foxn1em2Nips
405855878 Foxo4em1Soar forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar This Foxo4 mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. 2024-06-18 2024-06-18 1561201 Foxo4 RGSC 3.4 X 89332278 89338835 +
405855878 Foxo4em1Soar forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar This Foxo4 mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. 2024-06-18 2024-06-18 1561201 Foxo4 Rnor_5.0 X 72007762 72014636 +
405855878 Foxo4em1Soar forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar This Foxo4 mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. 2024-06-18 2024-06-18 1561201 Foxo4 Rnor_6.0 X 71155284 71162158 +
13464330 Frem2fpl Fras1 related extracellular matrix protein 2;fpl mutant A spontaneous, nonsense mutation that introduced a stop codon at serine 2005 in the rat Frem2. The original fused pulmonary lobes was identified in a colony of Jcl:Wistar. 2018-01-03 2018-01-03 1566012 Frem2 RGSC 3.4 2 142464169 142604059 - Frem2fpl
13464330 Frem2fpl Fras1 related extracellular matrix protein 2;fpl mutant A spontaneous, nonsense mutation that introduced a stop codon at serine 2005 in the rat Frem2. The original fused pulmonary lobes was identified in a colony of Jcl:Wistar. 2018-01-03 2018-01-03 1566012 Frem2 Rnor_5.0 2 162430795 162568910 - Frem2fpl
13464330 Frem2fpl Fras1 related extracellular matrix protein 2;fpl mutant A spontaneous, nonsense mutation that introduced a stop codon at serine 2005 in the rat Frem2. The original fused pulmonary lobes was identified in a colony of Jcl:Wistar. 2018-01-03 2018-01-03 1566012 Frem2 Rnor_6.0 2 142747501 142885604 - Frem2fpl
628359040 Fstl3em1Soar follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 3243 bp deletion affecting Exons 1-3 of the Fstl3 gene 2025-09-19 2025-09-19 621811 Fstl3 RGSC 3.4 7 11438360 11442885 -
628359040 Fstl3em1Soar follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 3243 bp deletion affecting Exons 1-3 of the Fstl3 gene 2025-09-19 2025-09-19 621811 Fstl3 Rnor_5.0 7 12976235 12980760 -
628359040 Fstl3em1Soar follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 3243 bp deletion affecting Exons 1-3 of the Fstl3 gene 2025-09-19 2025-09-19 621811 Fstl3 Rnor_6.0 7 12806031 12810556 -
10047084 Fusem1Ionsz Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Fus gene that made the 521th amino acid Arg into Cys 2015-07-08 2015-07-08 1308864 Fus RGSC 3.4 1 187250871 187264742 + Fusem1Ionsz;fused in sarcoma RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences
10047084 Fusem1Ionsz Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Fus gene that made the 521th amino acid Arg into Cys 2015-07-08 2015-07-08 1308864 Fus Rnor_5.0 1 206435510 206449423 + Fusem1Ionsz;fused in sarcoma RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences
10047084 Fusem1Ionsz Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Fus gene that made the 521th amino acid Arg into Cys 2015-07-08 2015-07-08 1308864 Fus Rnor_6.0 1 199412805 199426705 + Fusem1Ionsz;fused in sarcoma RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences
152999004 Fxn em1Fara frataxin; CRISPR/Cas9 induced mutant 1,Fara Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 2022-07-15 2022-07-15 1565754 Fxn RGSC 3.4 1 227647092 227671081 -
152999004 Fxn em1Fara frataxin; CRISPR/Cas9 induced mutant 1,Fara Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 2022-07-15 2022-07-15 1565754 Fxn Rnor_5.0 1 249419972 249426597 -
152999004 Fxn em1Fara frataxin; CRISPR/Cas9 induced mutant 1,Fara Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 2022-07-15 2022-07-15 1565754 Fxn Rnor_5.0 1 249400435 249400757 -
152999004 Fxn em1Fara frataxin; CRISPR/Cas9 induced mutant 1,Fara Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 2022-07-15 2022-07-15 1565754 Fxn Rnor_6.0 1 242123975 242152834 -
152999006 Fxn em2Fara frataxin; CRISPR/Cas9 induced mutant 2,Fara Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 2022-07-15 2022-07-15 1565754 Fxn RGSC 3.4 1 227647092 227671081 -
152999006 Fxn em2Fara frataxin; CRISPR/Cas9 induced mutant 2,Fara Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 2022-07-15 2022-07-15 1565754 Fxn Rnor_5.0 1 249400435 249400757 -
152999006 Fxn em2Fara frataxin; CRISPR/Cas9 induced mutant 2,Fara Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 2022-07-15 2022-07-15 1565754 Fxn Rnor_5.0 1 249419972 249426597 -
152999006 Fxn em2Fara frataxin; CRISPR/Cas9 induced mutant 2,Fara Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 2022-07-15 2022-07-15 1565754 Fxn Rnor_6.0 1 242123975 242152834 -
6893411 Fynem1Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 4 (del 383-389) 2012-08-28 2012-08-28 2641 Fyn RGSC 3.4 20 43501853 43695567 + Fynem1Mcwi
6893411 Fynem1Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 4 (del 383-389) 2012-08-28 2012-08-28 2641 Fyn Rnor_5.0 20 46160734 46353456 + Fynem1Mcwi
6893411 Fynem1Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 4 (del 383-389) 2012-08-28 2012-08-28 2641 Fyn Rnor_6.0 20 44436354 44630316 + Fynem1Mcwi
6893380 Fynem6Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp deletion in exon 4 (del 385-392) 2012-08-24 2012-08-24 2641 Fyn RGSC 3.4 20 43501853 43695567 + Fynem6Mcwi
6893380 Fynem6Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp deletion in exon 4 (del 385-392) 2012-08-24 2012-08-24 2641 Fyn Rnor_5.0 20 46160734 46353456 + Fynem6Mcwi
6893380 Fynem6Mcwi FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp deletion in exon 4 (del 385-392) 2012-08-24 2012-08-24 2641 Fyn Rnor_6.0 20 44436354 44630316 + Fynem6Mcwi
11561925 Gabrb1Tn(pb-Bhr2)1Wmukf gamma-aminobutyric acid type A receptor beta 1 subunit; Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into intron 4 of Gabrb1 gene. 2016-11-11 2016-11-11 2649 Gabrb1 RGSC 3.4 14 38530259 39005615 - gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon-incuded mutant 1, Wmukf;gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon insertion 1, Wmukf;Gabrb1Tn(pb-Bhr2)1Wmukf
11561925 Gabrb1Tn(pb-Bhr2)1Wmukf gamma-aminobutyric acid type A receptor beta 1 subunit; Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into intron 4 of Gabrb1 gene. 2016-11-11 2016-11-11 2649 Gabrb1 Rnor_5.0 14 38453142 38924073 - gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon-incuded mutant 1, Wmukf;gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon insertion 1, Wmukf;Gabrb1Tn(pb-Bhr2)1Wmukf
11561925 Gabrb1Tn(pb-Bhr2)1Wmukf gamma-aminobutyric acid type A receptor beta 1 subunit; Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into intron 4 of Gabrb1 gene. 2016-11-11 2016-11-11 2649 Gabrb1 Rnor_6.0 14 38631192 39112598 - gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon-incuded mutant 1, Wmukf;gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon insertion 1, Wmukf;Gabrb1Tn(pb-Bhr2)1Wmukf
149735561 Gad1em15Yyan glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan This mutant allele carries a 291 bp deletion, including exon-6, of Gad1 gene using the CRISPR/Cas9. 2021-07-22 2021-07-22 2652 Gad1 RGSC 3.4 3 52789370 52830038 +
149735561 Gad1em15Yyan glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan This mutant allele carries a 291 bp deletion, including exon-6, of Gad1 gene using the CRISPR/Cas9. 2021-07-22 2021-07-22 2652 Gad1 Rnor_5.0 3 63479963 63519879 +
149735561 Gad1em15Yyan glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan This mutant allele carries a 291 bp deletion, including exon-6, of Gad1 gene using the CRISPR/Cas9. 2021-07-22 2021-07-22 2652 Gad1 Rnor_6.0 3 56861440 56902139 +
149735563 Gad2em24Yyan glutamate decarboxylase 2; TALEN induced mutant 24, Yyan This Gad2 allele was created by TALEN. 2021-07-22 2021-07-22 2653 Gad2 RGSC 3.4 17 96259430 96321857 +
149735563 Gad2em24Yyan glutamate decarboxylase 2; TALEN induced mutant 24, Yyan This Gad2 allele was created by TALEN. 2021-07-22 2021-07-22 2653 Gad2 Rnor_5.0 17 90851699 90914893 +
149735563 Gad2em24Yyan glutamate decarboxylase 2; TALEN induced mutant 24, Yyan This Gad2 allele was created by TALEN. 2021-07-22 2021-07-22 2653 Gad2 Rnor_6.0 17 89171576 89234770 +
2304194 Galntl6Tn(sb-T2/Bart3)2.311Mcwi UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene 2009-03-10 2009-03-10 1564773 Galntl6 RGSC 3.4 16 34557663 35853849 + Galntl6Tn(sb-T2/Bart3)2.311Mcwi
2304194 Galntl6Tn(sb-T2/Bart3)2.311Mcwi UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene 2009-03-10 2009-03-10 1564773 Galntl6 Rnor_5.0 16 34380195 35619972 + Galntl6Tn(sb-T2/Bart3)2.311Mcwi
2304194 Galntl6Tn(sb-T2/Bart3)2.311Mcwi UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene 2009-03-10 2009-03-10 1564773 Galntl6 Rnor_6.0 16 34551052 35803840 + Galntl6Tn(sb-T2/Bart3)2.311Mcwi
13441563 Galtem3Mcwi galactose-1-phosphate uridylyltransferase; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos 2017-10-27 2026-02-24 1306483 Galt RGSC 3.4 5 59185418 59188642 + Galtem3Mcwi
13441563 Galtem3Mcwi galactose-1-phosphate uridylyltransferase; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos 2017-10-27 2026-02-24 1306483 Galt Rnor_5.0 5 62669071 62672312 + Galtem3Mcwi
13441563 Galtem3Mcwi galactose-1-phosphate uridylyltransferase; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 2-base pair insertion mutation into exon 6 in the rat Galt gene of Crl:SD embryos 2017-10-27 2026-02-24 1306483 Galt Rnor_6.0 5 58144679 58147946 + Galtem3Mcwi
10758636 Gcdhem1Dba glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland CRISPR/Cas9 system was used to generate this mutant; the resulting knock-in mutation is R411W in exon 11 of the GCDH gene. 2016-02-05 2023-09-28 1308829 Gcdh RGSC 3.4 19 24919470 24925943 + GCDHem1Dba
10758636 Gcdhem1Dba glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland CRISPR/Cas9 system was used to generate this mutant; the resulting knock-in mutation is R411W in exon 11 of the GCDH gene. 2016-02-05 2023-09-28 1308829 Gcdh Rnor_5.0 19 36976120 36982606 - GCDHem1Dba
10758636 Gcdhem1Dba glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland CRISPR/Cas9 system was used to generate this mutant; the resulting knock-in mutation is R411W in exon 11 of the GCDH gene. 2016-02-05 2023-09-28 1308829 Gcdh Rnor_6.0 19 26000497 26006970 - GCDHem1Dba
10054277 Gfapem1Ionsz glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system that added a 2A and EYFP behind the last exon of Gfap 2015-08-03 2015-08-03 2679 Gfap RGSC 3.4 10 92059881 92068555 - Gfapem1Ionsz;Gfap tm(2A-EYFP)/Ionsz
10054277 Gfapem1Ionsz glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system that added a 2A and EYFP behind the last exon of Gfap 2015-08-03 2015-08-03 2679 Gfap Rnor_5.0 10 90763150 90771823 - Gfapem1Ionsz;Gfap tm(2A-EYFP)/Ionsz
10054277 Gfapem1Ionsz glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system that added a 2A and EYFP behind the last exon of Gfap 2015-08-03 2015-08-03 2679 Gfap Rnor_6.0 10 90990762 90999435 - Gfapem1Ionsz;Gfap tm(2A-EYFP)/Ionsz
150519905 Gfapem1Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human Alexander disease. 2021-10-15 2021-10-15 2679 Gfap RGSC 3.4 10 92059881 92068555 -
150519905 Gfapem1Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human Alexander disease. 2021-10-15 2021-10-15 2679 Gfap Rnor_5.0 10 90763150 90771823 -
150519905 Gfapem1Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human Alexander disease. 2021-10-15 2021-10-15 2679 Gfap Rnor_6.0 10 90990762 90999435 -
150519906 Gfapem2Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. 2021-10-15 2021-10-15 2679 Gfap RGSC 3.4 10 92059881 92068555 -
150519906 Gfapem2Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. 2021-10-15 2021-10-15 2679 Gfap Rnor_5.0 10 90763150 90771823 -
150519906 Gfapem2Mes glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. 2021-10-15 2021-10-15 2679 Gfap Rnor_6.0 10 90990762 90999435 -
12880380 Gh1sdr The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype in SDR rats. This spontaneous mutation affected the 3' splice/acceptor site causing 1-bp deletion in mRNA and resulting in pre-mature termination of translation. 2017-05-04 2017-05-04 2686 Gh1 RGSC 3.4 10 95692240 95694117 - Gh1sdr
12880380 Gh1sdr The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype in SDR rats. This spontaneous mutation affected the 3' splice/acceptor site causing 1-bp deletion in mRNA and resulting in pre-mature termination of translation. 2017-05-04 2017-05-04 2686 Gh1 Rnor_5.0 10 94237414 94239391 - Gh1sdr
12880380 Gh1sdr The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype in SDR rats. This spontaneous mutation affected the 3' splice/acceptor site causing 1-bp deletion in mRNA and resulting in pre-mature termination of translation. 2017-05-04 2017-05-04 2686 Gh1 Rnor_6.0 10 94486204 94488181 - Gh1sdr
329853764 Ghrhem1Mcwi growth hormone releasing hormone; CRISPR/Cas9 induced mutant 1, Mcwi The allele was created by CRISPR/SpCas9 system. It introduced a 10-bp deletion (rn6: chr3:153,453,801-153,453,810) in exon 3 of the Ghrh gene in Crl:SD Sprague Dawley embryos. 2023-06-20 2026-04-01 61883 Ghrh RGSC 3.4 3 148027235 148046352 - growth hormone releasing hormone; CRISPR/SpCas9 induced mutant 1, Mcwi
329853764 Ghrhem1Mcwi growth hormone releasing hormone; CRISPR/Cas9 induced mutant 1, Mcwi The allele was created by CRISPR/SpCas9 system. It introduced a 10-bp deletion (rn6: chr3:153,453,801-153,453,810) in exon 3 of the Ghrh gene in Crl:SD Sprague Dawley embryos. 2023-06-20 2026-04-01 61883 Ghrh Rnor_5.0 3 158251824 158270812 + growth hormone releasing hormone; CRISPR/SpCas9 induced mutant 1, Mcwi
329853764 Ghrhem1Mcwi growth hormone releasing hormone; CRISPR/Cas9 induced mutant 1, Mcwi The allele was created by CRISPR/SpCas9 system. It introduced a 10-bp deletion (rn6: chr3:153,453,801-153,453,810) in exon 3 of the Ghrh gene in Crl:SD Sprague Dawley embryos. 2023-06-20 2026-04-01 61883 Ghrh Rnor_6.0 3 153449124 153468794 - growth hormone releasing hormone; CRISPR/SpCas9 induced mutant 1, Mcwi
1578794 Ghsrm1Mcwi growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); codon CAG/TAG mutation is generated which changes the AA Q343Stop 2006-05-02 2006-05-02 621397 Ghsr RGSC 3.4 2 113269623 113272999 + Ghsrm1Mcwi
1578794 Ghsrm1Mcwi growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); codon CAG/TAG mutation is generated which changes the AA Q343Stop 2006-05-02 2006-05-02 621397 Ghsr Rnor_5.0 2 132784207 132789319 + Ghsrm1Mcwi
1578794 Ghsrm1Mcwi growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); codon CAG/TAG mutation is generated which changes the AA Q343Stop 2006-05-02 2006-05-02 621397 Ghsr Rnor_6.0 2 113065953 113071265 + Ghsrm1Mcwi
1642180 Ghsrm2Mcwi growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S342P mutation is generated from the codon change TCC/CCC 2007-09-06 2007-09-06 621397 Ghsr RGSC 3.4 2 113269623 113272999 + Ghsrm2Mcwi
1642180 Ghsrm2Mcwi growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S342P mutation is generated from the codon change TCC/CCC 2007-09-06 2007-09-06 621397 Ghsr Rnor_5.0 2 132784207 132789319 + Ghsrm2Mcwi
1642180 Ghsrm2Mcwi growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S342P mutation is generated from the codon change TCC/CCC 2007-09-06 2007-09-06 621397 Ghsr Rnor_6.0 2 113065953 113071265 + Ghsrm2Mcwi
1642357 Ghsrm3Mcwi growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N26K mutation is generated from the codon change AAC/AAA 2007-09-13 2007-09-13 621397 Ghsr RGSC 3.4 2 113269623 113272999 + Ghsrm3Mcwi
1642357 Ghsrm3Mcwi growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N26K mutation is generated from the codon change AAC/AAA 2007-09-13 2007-09-13 621397 Ghsr Rnor_5.0 2 132784207 132789319 + Ghsrm3Mcwi
1642357 Ghsrm3Mcwi growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N26K mutation is generated from the codon change AAC/AAA 2007-09-13 2007-09-13 621397 Ghsr Rnor_6.0 2 113065953 113071265 + Ghsrm3Mcwi
12880435 Ghsrem1Ottc growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc Mutation induced by CRISPR in the Ghsr gene,It is a 843-bp deletion mutation resulting knockout of protein expression. 2017-05-08 2017-05-08 621397 Ghsr RGSC 3.4 2 113269623 113272999 + Ghsrem1Ottc
12880435 Ghsrem1Ottc growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc Mutation induced by CRISPR in the Ghsr gene,It is a 843-bp deletion mutation resulting knockout of protein expression. 2017-05-08 2017-05-08 621397 Ghsr Rnor_5.0 2 132784207 132789319 + Ghsrem1Ottc
12880435 Ghsrem1Ottc growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc Mutation induced by CRISPR in the Ghsr gene,It is a 843-bp deletion mutation resulting knockout of protein expression. 2017-05-08 2017-05-08 621397 Ghsr Rnor_6.0 2 113065953 113071265 + Ghsrem1Ottc
13825144 Gja5em1Mcwi gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. 2018-11-19 2021-03-09 2692 Gja5 RGSC 3.4 2 191824118 191843867 +
13825144 Gja5em1Mcwi gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. 2018-11-19 2021-03-09 2692 Gja5 Rnor_5.0 2 218648368 218669354 +
13825144 Gja5em1Mcwi gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. 2018-11-19 2021-03-09 2692 Gja5 Rnor_6.0 2 199162745 199184942 +
13524999 Gja8m1Cas gap junction protein, alpha 8; mutant 1 Cas This mutation is identified in the UPL rat originally derived from Sprague-Dawley rats. It is a missense mutation (R340W) of the Cx50 (Gja8. ) 2018-05-02 2018-05-02 628890 Gja8 Rnor_5.0 2 218536831 218538447 -
13524999 Gja8m1Cas gap junction protein, alpha 8; mutant 1 Cas This mutation is identified in the UPL rat originally derived from Sprague-Dawley rats. It is a missense mutation (R340W) of the Cx50 (Gja8. ) 2018-05-02 2018-05-02 628890 Gja8 Rnor_6.0 2 199050854 199052470 -
12791992 Gja8m1Cub gap junction protein, alpha 8; mutant 1 Cub This mutation is derived from SHR where a missense mutation is observed in the NH2-terminal cytosolic domain of Gja8(Cx50). A T to A transversion at codon 7, leading to a substitution of glutamine for leucin (L7Q) was identified. 2017-03-07 2017-03-07 628890 Gja8 Rnor_5.0 2 218536831 218538447 - Gja8m1Cub
12791992 Gja8m1Cub gap junction protein, alpha 8; mutant 1 Cub This mutation is derived from SHR where a missense mutation is observed in the NH2-terminal cytosolic domain of Gja8(Cx50). A T to A transversion at codon 7, leading to a substitution of glutamine for leucin (L7Q) was identified. 2017-03-07 2017-03-07 628890 Gja8 Rnor_6.0 2 199050854 199052470 - Gja8m1Cub
10054395 Glaem2Mcwi galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 47-bp deletion in the Gla gene 2015-08-05 2016-10-19 1589721 Gla RGSC 3.4 X 122044703 122056327 - Glaem2Mcwi
10054395 Glaem2Mcwi galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 47-bp deletion in the Gla gene 2015-08-05 2016-10-19 1589721 Gla Rnor_5.0 X 105295029 105306686 - Glaem2Mcwi
10054395 Glaem2Mcwi galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 47-bp deletion in the Gla gene 2015-08-05 2016-10-19 1589721 Gla Rnor_6.0 X 105405915 105417331 - Glaem2Mcwi
2290128 Glis1Tn(sb-T2/Bart3)2.149Mcwi GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. 2008-02-26 2008-02-26 1308030 Glis1 RGSC 3.4 5 128736183 128739369 + Glis1Tn(sb-T2/Bart3)2.149Mcwi
2290128 Glis1Tn(sb-T2/Bart3)2.149Mcwi GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. 2008-02-26 2008-02-26 1308030 Glis1 Rnor_5.0 5 130891667 131081696 + Glis1Tn(sb-T2/Bart3)2.149Mcwi
2290128 Glis1Tn(sb-T2/Bart3)2.149Mcwi GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. 2008-02-26 2008-02-26 1308030 Glis1 Rnor_6.0 5 127043344 127233395 + Glis1Tn(sb-T2/Bart3)2.149Mcwi
13800750 Glp1rem1Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. 2018-10-17 2018-10-17 2703 Glp1r RGSC 3.4 20 9225881 9264184 +
13800750 Glp1rem1Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. 2018-10-17 2018-10-17 2703 Glp1r Rnor_5.0 20 11768479 11808416 +
13800750 Glp1rem1Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. 2018-10-17 2018-10-17 2703 Glp1r Rnor_6.0 20 9586075 9626228 +
14394489 Glp1rem2Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r RGSC 3.4 20 9225881 9264184 +
14394489 Glp1rem2Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r Rnor_5.0 20 11768479 11808416 +
14394489 Glp1rem2Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r Rnor_6.0 20 9586075 9626228 +
14394492 Glp1rem3Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r RGSC 3.4 20 9225881 9264184 + glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi
14394492 Glp1rem3Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r Rnor_5.0 20 11768479 11808416 + glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi
14394492 Glp1rem3Mcwi glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 2019-03-22 2019-03-22 2703 Glp1r Rnor_6.0 20 9586075 9626228 + glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi
150429816 Gnalem1Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng The Gnal mutant allele was created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids . 2021-09-30 2021-09-30 2715 Gnal RGSC 3.4 18 63595606 63735803 + Gnaldel34-46
150429816 Gnalem1Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng The Gnal mutant allele was created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids . 2021-09-30 2021-09-30 2715 Gnal Rnor_5.0 18 61991738 62131420 + Gnaldel34-46
150429816 Gnalem1Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng The Gnal mutant allele was created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids . 2021-09-30 2021-09-30 2715 Gnal Rnor_6.0 18 62805406 62946133 + Gnaldel34-46
626419678 Gnalem2Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng Gnal knockout allele was generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. 2025-09-05 2025-09-05 2715 Gnal RGSC 3.4 18 63595606 63735803 + Gnalsplicing variant 2-del44
626419678 Gnalem2Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng Gnal knockout allele was generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. 2025-09-05 2025-09-05 2715 Gnal Rnor_5.0 18 61991738 62131420 + Gnalsplicing variant 2-del44
626419678 Gnalem2Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng Gnal knockout allele was generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. 2025-09-05 2025-09-05 2715 Gnal Rnor_6.0 18 62805406 62946133 + Gnalsplicing variant 2-del44
626419680 Gnalem3Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng The allele was generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. 2025-09-05 2025-09-05 2715 Gnal RGSC 3.4 18 63595606 63735803 + Gnaldel44-178
626419680 Gnalem3Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng The allele was generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. 2025-09-05 2025-09-05 2715 Gnal Rnor_5.0 18 61991738 62131420 + Gnaldel44-178
626419680 Gnalem3Hpng G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng The allele was generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. 2025-09-05 2025-09-05 2715 Gnal Rnor_6.0 18 62805406 62946133 + Gnaldel44-178
5687696 Gnb3em1Mcwi guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 111-bp deletion overlapping exon 7 (del 160960366 160960476) 2012-02-09 2012-02-09 708344 Gnb3 RGSC 3.4 4 160957524 160963226 - Gnb3em1Mcwi
5687696 Gnb3em1Mcwi guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 111-bp deletion overlapping exon 7 (del 160960366 160960476) 2012-02-09 2012-02-09 708344 Gnb3 Rnor_5.0 4 224370234 224376918 - Gnb3em1Mcwi
5687696 Gnb3em1Mcwi guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 111-bp deletion overlapping exon 7 (del 160960366 160960476) 2012-02-09 2012-02-09 708344 Gnb3 Rnor_6.0 4 157352558 157359237 - Gnb3em1Mcwi
2306274 Gng12Tn(sb-T2/Bart3)2.320Mcwi guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene 2009-04-01 2009-04-01 621516 Gng12 RGSC 3.4 4 96622363 96624479 + Gng12Tn(sb-T2/Bart3)2.320Mcwi
2306274 Gng12Tn(sb-T2/Bart3)2.320Mcwi guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene 2009-04-01 2009-04-01 621516 Gng12 Rnor_5.0 4 162420268 162549350 + Gng12Tn(sb-T2/Bart3)2.320Mcwi
2306274 Gng12Tn(sb-T2/Bart3)2.320Mcwi guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene 2009-04-01 2009-04-01 621516 Gng12 Rnor_6.0 4 97634925 97763478 + Gng12Tn(sb-T2/Bart3)2.320Mcwi
151347865 Gper1em1Bj G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544 bps versus wild-type PCR product of 1484 bps. 2022-02-04 2022-02-04 619845 Gper1 RGSC 3.4 12 15718615 15719893 - Gper1em1Bj-/-
151347865 Gper1em1Bj G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544 bps versus wild-type PCR product of 1484 bps. 2022-02-04 2022-02-04 619845 Gper1 Rnor_5.0 12 19296086 19301691 - Gper1em1Bj-/-
151347865 Gper1em1Bj G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544 bps versus wild-type PCR product of 1484 bps. 2022-02-04 2022-02-04 619845 Gper1 Rnor_6.0 12 17309122 17315267 - Gper1em1Bj-/-
626419681 Gpr143em19Gosh G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh This allele carries deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. 2025-09-05 2025-09-05 1565799 Gpr143 RGSC 3.4 X 42481440 42506239 +
626419681 Gpr143em19Gosh G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh This allele carries deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. 2025-09-05 2025-09-05 1565799 Gpr143 Rnor_5.0 X 24084931 24109730 +
626419681 Gpr143em19Gosh G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh This allele carries deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. 2025-09-05 2025-09-05 1565799 Gpr143 Rnor_6.0 X 23668363 23693162 +
5143957 Gpr183em1Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 2 (del 550-556) 2011-07-27 2011-07-27 1598095 Gpr183 RGSC 3.4 15 107056367 107067887 - Gpr183em1Mcwi
5143957 Gpr183em1Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 2 (del 550-556) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_5.0 15 111751148 111763869 - Gpr183em1Mcwi
5143957 Gpr183em1Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 2 (del 550-556) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_6.0 15 108364701 108376221 - Gpr183em1Mcwi
5143955 Gpr183em2Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 2 (del 567-570) 2011-07-27 2011-07-27 1598095 Gpr183 RGSC 3.4 15 107056367 107067887 - Gpr183em2Mcwi
5143955 Gpr183em2Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 2 (del 567-570) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_5.0 15 111751148 111763869 - Gpr183em2Mcwi
5143955 Gpr183em2Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 2 (del 567-570) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_6.0 15 108364701 108376221 - Gpr183em2Mcwi
5143961 Gpr183em3Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 571-578) 2011-07-27 2011-07-27 1598095 Gpr183 RGSC 3.4 15 107056367 107067887 - Gpr183em3Mcwi
5143961 Gpr183em3Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 571-578) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_5.0 15 111751148 111763869 - Gpr183em3Mcwi
5143961 Gpr183em3Mcwi G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 571-578) 2011-07-27 2011-07-27 1598095 Gpr183 Rnor_6.0 15 108364701 108376221 - Gpr183em3Mcwi
2302635 Gramd1bTn(sb-T2/Bart3)2.287Mcwi GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene 2009-01-06 2009-01-06 1305443 Gramd1b RGSC 3.4 8 43260379 43429258 - Gramd1bTn(sb-T2/Bart3)2.287Mcwi
2302635 Gramd1bTn(sb-T2/Bart3)2.287Mcwi GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene 2009-01-06 2009-01-06 1305443 Gramd1b Rnor_5.0 8 61200537 61378124 + Gramd1bTn(sb-T2/Bart3)2.287Mcwi
2302635 Gramd1bTn(sb-T2/Bart3)2.287Mcwi GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene 2009-01-06 2009-01-06 1305443 Gramd1b Rnor_6.0 8 44160634 44399110 - Gramd1bTn(sb-T2/Bart3)2.287Mcwi
626419669 Grin2aem1Sidb glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb This allele has a deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. 2025-09-04 2025-09-04 2737 Grin2a RGSC 3.4 10 5588229 6004780 +
626419669 Grin2aem1Sidb glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb This allele has a deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. 2025-09-04 2025-09-04 2737 Grin2a Rnor_5.0 10 4523233 4940912 +
626419669 Grin2aem1Sidb glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb This allele has a deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. 2025-09-04 2025-09-04 2737 Grin2a Rnor_6.0 10 5707806 6123568 +
14394517 Grin2bem1Mcwi glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. 2019-03-26 2019-03-26 2738 Grin2b RGSC 3.4 4 172721895 173183187 -
14394517 Grin2bem1Mcwi glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. 2019-03-26 2019-03-26 2738 Grin2b Rnor_5.0 4 233806406 234260360 -
14394517 Grin2bem1Mcwi glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. 2019-03-26 2019-03-26 2738 Grin2b Rnor_6.0 4 169541620 170000216 -
2299115 Grk1Tn(sb-T2/Bart3)2.234Mcwi G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene 2008-08-12 2008-08-12 619712 Grk1 RGSC 3.4 16 80979323 80991796 - Grk1Tn(sb-T2/Bart3)2.234Mcwi
2299115 Grk1Tn(sb-T2/Bart3)2.234Mcwi G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene 2008-08-12 2008-08-12 619712 Grk1 Rnor_5.0 16 80641991 80657693 + Grk1Tn(sb-T2/Bart3)2.234Mcwi
2299115 Grk1Tn(sb-T2/Bart3)2.234Mcwi G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene 2008-08-12 2008-08-12 619712 Grk1 Rnor_6.0 16 81153489 81165442 + Grk1Tn(sb-T2/Bart3)2.234Mcwi
41410882 Grm2em1 glutamate metabotropic receptor 2; endonuclease induced mutant 1 The genome modification technology created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. 2021-02-17 2021-02-17 2743 Grm2 RGSC 3.4 8 111837086 111850133 -
41410882 Grm2em1 glutamate metabotropic receptor 2; endonuclease induced mutant 1 The genome modification technology created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. 2021-02-17 2021-02-17 2743 Grm2 Rnor_5.0 8 114705123 114718193 -
41410882 Grm2em1 glutamate metabotropic receptor 2; endonuclease induced mutant 1 The genome modification technology created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. 2021-02-17 2021-02-17 2743 Grm2 Rnor_6.0 8 115344999 115358628 -
11568068 Grm5em1Sage glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. 2016-12-07 2016-12-07 2746 Grm5 RGSC 3.4 1 143857225 144477419 + Grm5tm1Sage;Grm5em1Sage
11568068 Grm5em1Sage glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. 2016-12-07 2016-12-07 2746 Grm5 Rnor_5.0 1 157517676 158096869 + Grm5tm1Sage;Grm5em1Sage
11568068 Grm5em1Sage glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. 2016-12-07 2016-12-07 2746 Grm5 Rnor_6.0 1 151207846 151785038 + Grm5tm1Sage;Grm5em1Sage
6893416 Grm7em2Mcwi glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a) 2012-08-28 2012-08-28 619857 Grm7 RGSC 3.4 4 146952340 147270225 + Grm7em2Mcwi
6893416 Grm7em2Mcwi glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a) 2012-08-28 2012-08-28 619857 Grm7 Rnor_5.0 4 206230927 206680107 + Grm7em2Mcwi
6893416 Grm7em2Mcwi glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a) 2012-08-28 2012-08-28 619857 Grm7 Rnor_5.0 4 205768625 206090308 + Grm7em2Mcwi
6893416 Grm7em2Mcwi glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a) 2012-08-28 2012-08-28 619857 Grm7 Rnor_6.0 4 142452616 143368460 + Grm7em2Mcwi
640883992 Gsapem2mcwi gamma-secretase activating protein;CRISPR/Cas9 induced mutant 2, Mcwi This allele was produced using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp deletion was identified. 2026-04-01 2026-04-01 1563271 Gsap RGSC 3.4 4 9306309 9401421 -
640883992 Gsapem2mcwi gamma-secretase activating protein;CRISPR/Cas9 induced mutant 2, Mcwi This allele was produced using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp deletion was identified. 2026-04-01 2026-04-01 1563271 Gsap Rnor_5.0 4 10416312 10511062 -
640883992 Gsapem2mcwi gamma-secretase activating protein;CRISPR/Cas9 induced mutant 2, Mcwi This allele was produced using CRISPR Cas9 mutagenesis in the Crl:SD strain. A CRISPR SpCas9/sgRNA targeting the GTCCTTTGCAGTCCCTGCCG sequence within exon 15 of Gsap and a 5-bp deletion was identified. 2026-04-01 2026-04-01 1563271 Gsap Rnor_6.0 4 10423090 10517887 -
5508351 Gucy1a3em1Mcwi guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a14-bp frameshift deletion in exon 5 (del 784-797) 2011-10-13 2011-10-13 68436 Gucy1a1 RGSC 3.4 2 173756824 173818316 - Gucy1a3em1Mcwi
5508351 Gucy1a3em1Mcwi guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a14-bp frameshift deletion in exon 5 (del 784-797) 2011-10-13 2011-10-13 68436 Gucy1a1 Rnor_5.0 2 200453480 200515219 - Gucy1a3em1Mcwi
5508351 Gucy1a3em1Mcwi guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a14-bp frameshift deletion in exon 5 (del 784-797) 2011-10-13 2011-10-13 68436 Gucy1a1 Rnor_6.0 2 181045694 181103321 - Gucy1a3em1Mcwi
126848761 Gulood gulonolactone (L-) oxidase; osteogenic discorder mutant A point mutation (from G to A) at 182 nucelotide was identified in the cDNA isolated from ODS wistar rat. This mutation altered the 61st amino acid Cys to Tyr and resulted in the low gulonolactone (L-) oxidase activity in the ODS rat. 2021-04-29 2021-04-29 620701 Gulo RGSC 3.4 15 45410685 45434014 - gulonolactone (L-) oxidase; osteogenic discorderr, scurvy mutant;Guloods
126848761 Gulood gulonolactone (L-) oxidase; osteogenic discorder mutant A point mutation (from G to A) at 182 nucelotide was identified in the cDNA isolated from ODS wistar rat. This mutation altered the 61st amino acid Cys to Tyr and resulted in the low gulonolactone (L-) oxidase activity in the ODS rat. 2021-04-29 2021-04-29 620701 Gulo Rnor_5.0 15 48898664 48921163 + gulonolactone (L-) oxidase; osteogenic discorderr, scurvy mutant;Guloods
126848761 Gulood gulonolactone (L-) oxidase; osteogenic discorder mutant A point mutation (from G to A) at 182 nucelotide was identified in the cDNA isolated from ODS wistar rat. This mutation altered the 61st amino acid Cys to Tyr and resulted in the low gulonolactone (L-) oxidase activity in the ODS rat. 2021-04-29 2021-04-29 620701 Gulo Rnor_6.0 15 42671206 42693711 - gulonolactone (L-) oxidase; osteogenic discorderr, scurvy mutant;Guloods
38455987 Hamp em1Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 169-bp deletion between exons 2 & 3 of rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp RGSC 3.4 1 85978120 85980059 -
38455987 Hamp em1Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 169-bp deletion between exons 2 & 3 of rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_5.0 1 90523506 90525473 -
38455987 Hamp em1Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 169-bp deletion between exons 2 & 3 of rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_6.0 1 89368021 89369960 -
38455989 Hamp em2Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp RGSC 3.4 1 85978120 85980059 -
38455989 Hamp em2Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_5.0 1 90523506 90525473 -
38455989 Hamp em2Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_6.0 1 89368021 89369960 -
38455990 Hamp em3Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp RGSC 3.4 1 85978120 85980059 -
38455990 Hamp em3Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_5.0 1 90523506 90525473 -
38455990 Hamp em3Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_6.0 1 89368021 89369960 -
38455991 Hamp em4Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 15-bp deletion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp RGSC 3.4 1 85978120 85980059 -
38455991 Hamp em4Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 15-bp deletion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_5.0 1 90523506 90525473 -
38455991 Hamp em4Jfcol hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 15-bp deletion in exon 2 of the rat Hamp gene. 2020-08-07 2020-08-07 70971 Hamp Rnor_6.0 1 89368021 89369960 -
1581493 Hand1m1Mcwi heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S109G mutation is generated from the codon change AGC/GGC 2006-10-06 2006-10-06 621206 Hand1 RGSC 3.4 10 43423366 43425933 - Hand1m1Mcwi
1581493 Hand1m1Mcwi heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S109G mutation is generated from the codon change AGC/GGC 2006-10-06 2006-10-06 621206 Hand1 Rnor_5.0 10 43050068 43052635 - Hand1m1Mcwi
1581493 Hand1m1Mcwi heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); S109G mutation is generated from the codon change AGC/GGC 2006-10-06 2006-10-06 621206 Hand1 Rnor_6.0 10 43250729 43253296 - Hand1m1Mcwi
1581477 Has1m1Mcwi hyaluronan synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F55L mutation is generated from the codon change TTT/TTG 2006-10-06 2006-10-06 708528 Has1 RGSC 3.4 1 56503365 56516133 - Has1m1Mcwi
1581477 Has1m1Mcwi hyaluronan synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F55L mutation is generated from the codon change TTT/TTG 2006-10-06 2006-10-06 708528 Has1 Rnor_5.0 1 60640270 60652067 - Has1m1Mcwi
1581477 Has1m1Mcwi hyaluronan synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F55L mutation is generated from the codon change TTT/TTG 2006-10-06 2006-10-06 708528 Has1 Rnor_6.0 1 59720612 59732409 - Has1m1Mcwi
1642171 Has1m2Mcwi hyaluronan synthase 1; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V155L mutation is generated from the codon change GTC/CTC 2007-09-06 2007-09-06 708528 Has1 RGSC 3.4 1 56503365 56516133 - Has1m2Mcwi
1642171 Has1m2Mcwi hyaluronan synthase 1; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V155L mutation is generated from the codon change GTC/CTC 2007-09-06 2007-09-06 708528 Has1 Rnor_5.0 1 60640270 60652067 - Has1m2Mcwi
1642171 Has1m2Mcwi hyaluronan synthase 1; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V155L mutation is generated from the codon change GTC/CTC 2007-09-06 2007-09-06 708528 Has1 Rnor_6.0 1 59720612 59732409 - Has1m2Mcwi
1642359 Has1m3Mcwi hyaluronan synthase 1; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D167D mutation is generated from the codon change GAT/GAC 2007-09-13 2007-09-13 708528 Has1 RGSC 3.4 1 56503365 56516133 - Has1m3Mcwi
1642359 Has1m3Mcwi hyaluronan synthase 1; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D167D mutation is generated from the codon change GAT/GAC 2007-09-13 2007-09-13 708528 Has1 Rnor_5.0 1 60640270 60652067 - Has1m3Mcwi
1642359 Has1m3Mcwi hyaluronan synthase 1; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D167D mutation is generated from the codon change GAT/GAC 2007-09-13 2007-09-13 708528 Has1 Rnor_6.0 1 59720612 59732409 - Has1m3Mcwi
1599566 Has2m1Mcwi hyaluronan synthase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y344Stop mutation is generated from the codon change TAT/TAA 2007-02-07 2007-02-07 2781 Has2 RGSC 3.4 7 93230135 93256139 - Has2m1Mcwi
1599566 Has2m1Mcwi hyaluronan synthase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y344Stop mutation is generated from the codon change TAT/TAA 2007-02-07 2007-02-07 2781 Has2 Rnor_5.0 7 97055458 97081461 - Has2m1Mcwi
1599566 Has2m1Mcwi hyaluronan synthase 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y344Stop mutation is generated from the codon change TAT/TAA 2007-02-07 2007-02-07 2781 Has2 Rnor_6.0 7 96438046 96464049 - Has2m1Mcwi
13464319 Hcn1A354V hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant A spontaneous mutation occurred in the Kyo:Wistar stock that causes essential tremor in the TRM/Kyo rats. 2018-01-03 2018-01-03 620688 Hcn1 RGSC 3.4 2 49525949 49939066 + tm2;Hcn1A354V;trm2
13464319 Hcn1A354V hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant A spontaneous mutation occurred in the Kyo:Wistar stock that causes essential tremor in the TRM/Kyo rats. 2018-01-03 2018-01-03 620688 Hcn1 Rnor_5.0 2 68473431 68874494 + tm2;Hcn1A354V;trm2
13464319 Hcn1A354V hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant A spontaneous mutation occurred in the Kyo:Wistar stock that causes essential tremor in the TRM/Kyo rats. 2018-01-03 2018-01-03 620688 Hcn1 Rnor_6.0 2 50099576 50499799 + tm2;Hcn1A354V;trm2
150429632 Hcn1em1Kyo hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. 2021-09-10 2021-09-10 620688 Hcn1 RGSC 3.4 2 49525949 49939066 +
150429632 Hcn1em1Kyo hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. 2021-09-10 2021-09-10 620688 Hcn1 Rnor_5.0 2 68473431 68874494 +
150429632 Hcn1em1Kyo hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. 2021-09-10 2021-09-10 620688 Hcn1 Rnor_6.0 2 50099576 50499799 +
10054399 Helz2em3Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 11-bp deletion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 RGSC 3.4 3 170368815 170382086 - Helz2em3Mcwi
10054399 Helz2em3Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 11-bp deletion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 Rnor_5.0 3 180439958 180454321 - Helz2em3Mcwi
10054399 Helz2em3Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 11-bp deletion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 Rnor_6.0 3 176730024 176744382 - Helz2em3Mcwi
10054402 Helz2em4Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 RGSC 3.4 3 170368815 170382086 - Helz2em4Mcwi
10054402 Helz2em4Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 Rnor_5.0 3 180439958 180454321 - Helz2em4Mcwi
10054402 Helz2em4Mcwi helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Helz2 gene 2015-08-05 2016-10-19 1306056 Helz2 Rnor_6.0 3 176730024 176744382 - Helz2em4Mcwi
5144095 Hexim2em4Mcwi HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 3 (del 798-807) 2011-07-29 2011-07-29 1311635 Hexim2 RGSC 3.4 10 92306494 92312256 + Hexim2em4Mcwi;hexamethylene bis-acetamide inducible 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin
5144095 Hexim2em4Mcwi HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 3 (del 798-807) 2011-07-29 2011-07-29 1311635 Hexim2 Rnor_5.0 10 90988728 90994491 + Hexim2em4Mcwi;hexamethylene bis-acetamide inducible 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin
5144095 Hexim2em4Mcwi HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 3 (del 798-807) 2011-07-29 2011-07-29 1311635 Hexim2 Rnor_6.0 10 91212296 91222841 + Hexim2em4Mcwi;hexamethylene bis-acetamide inducible 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin
1599564 Hps6m1Mcwi HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L67R mutation is generated from the codon change CTG/CGG 2007-02-07 2007-02-07 631341 Hps6 RGSC 3.4 1 251226344 251228953 + Hps6m1Mcwi
1599564 Hps6m1Mcwi HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L67R mutation is generated from the codon change CTG/CGG 2007-02-07 2007-02-07 631341 Hps6 Rnor_5.0 1 273191755 273194364 + Hps6m1Mcwi
1599564 Hps6m1Mcwi HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L67R mutation is generated from the codon change CTG/CGG 2007-02-07 2007-02-07 631341 Hps6 Rnor_6.0 1 265761818 265764427 + Hps6m1Mcwi
13800560 Hsd11b2em1Jmul hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. 2018-10-15 2018-10-15 2835 Hsd11b2 RGSC 3.4 19 35336342 35341585 +
13800560 Hsd11b2em1Jmul hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. 2018-10-15 2018-10-15 2835 Hsd11b2 Rnor_5.0 19 48341841 48347084 +
13800560 Hsd11b2em1Jmul hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. 2018-10-15 2018-10-15 2835 Hsd11b2 Rnor_6.0 19 37476083 37481326 +
626467889 Hspa8em1Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. 2025-09-08 2025-09-08 621725 Hspa8 RGSC 3.4 8 43784035 43787760 +
626467889 Hspa8em1Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 43478238 43480456 +
626467889 Hspa8em1Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 46005304 46006864 -
626467889 Hspa8em1Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. 2025-09-08 2025-09-08 621725 Hspa8 Rnor_6.0 8 44989401 44993261 +
626467891 Hspa8em2Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 2025-09-08 2025-09-08 621725 Hspa8 RGSC 3.4 8 43784035 43787760 +
626467891 Hspa8em2Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 46005304 46006864 -
626467891 Hspa8em2Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 43478238 43480456 +
626467891 Hspa8em2Opu heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_6.0 8 44989401 44993261 +
626467888 Hspa8m1Kyo heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E). 2025-09-08 2025-09-08 621725 Hspa8 RGSC 3.4 8 43784035 43787760 +
626467888 Hspa8m1Kyo heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 46005304 46006864 -
626467888 Hspa8m1Kyo heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_5.0 8 43478238 43480456 +
626467888 Hspa8m1Kyo heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E). 2025-09-08 2025-09-08 621725 Hspa8 Rnor_6.0 8 44989401 44993261 +
1581496 Htr1am1Mcwi 5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C266Y mutation is generated from the codon change TGT/TAT 2006-10-06 2006-10-06 2845 Htr1a RGSC 3.4 2 36434518 36435786 + Htr1am1Mcwi
1581496 Htr1am1Mcwi 5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C266Y mutation is generated from the codon change TGT/TAT 2006-10-06 2006-10-06 2845 Htr1a Rnor_5.0 2 55362662 55363930 + Htr1am1Mcwi
1581496 Htr1am1Mcwi 5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); C266Y mutation is generated from the codon change TGT/TAT 2006-10-06 2006-10-06 2845 Htr1a Rnor_6.0 2 36246628 36247896 + Htr1am1Mcwi
1599562 Htr1am2Mcwi 5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G76R mutation is generated from the codon change GGC/CGC 2007-02-07 2007-02-07 2845 Htr1a RGSC 3.4 2 36434518 36435786 + Htr1am2Mcwi
1599562 Htr1am2Mcwi 5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G76R mutation is generated from the codon change GGC/CGC 2007-02-07 2007-02-07 2845 Htr1a Rnor_5.0 2 55362662 55363930 + Htr1am2Mcwi
1599562 Htr1am2Mcwi 5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G76R mutation is generated from the codon change GGC/CGC 2007-02-07 2007-02-07 2845 Htr1a Rnor_6.0 2 36246628 36247896 + Htr1am2Mcwi
14696714 Htr7em1Geh 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh CRISPR/Cas9 system was used to generate this mutation in Wistar (CRL:WI) embryos; this editing induced 89 base pair deletion in exon 1 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 RGSC 3.4 1 240136279 240260620 - 5-hydroxytryptamine receptor 7
14696714 Htr7em1Geh 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh CRISPR/Cas9 system was used to generate this mutation in Wistar (CRL:WI) embryos; this editing induced 89 base pair deletion in exon 1 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 Rnor_5.0 1 261759122 261879914 - 5-hydroxytryptamine receptor 7
14696714 Htr7em1Geh 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh CRISPR/Cas9 system was used to generate this mutation in Wistar (CRL:WI) embryos; this editing induced 89 base pair deletion in exon 1 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 Rnor_6.0 1 254547964 254671811 - 5-hydroxytryptamine receptor 7
14696716 Htr7em1Msu 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 RGSC 3.4 1 240136279 240260620 -
14696716 Htr7em1Msu 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 Rnor_5.0 1 261759122 261879914 -
14696716 Htr7em1Msu 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. 2019-07-18 2019-07-18 71034 Htr7 Rnor_6.0 1 254547964 254671811 -
6893410 Hvcn1em1Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 314-321) 2012-08-28 2012-08-28 1310788 Hvcn1 RGSC 3.4 12 35536954 35556666 - Hvcn1em1Mcwi
6893410 Hvcn1em1Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 314-321) 2012-08-28 2012-08-28 1310788 Hvcn1 Rnor_5.0 12 41702567 41731349 - Hvcn1em1Mcwi
6893410 Hvcn1em1Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 314-321) 2012-08-28 2012-08-28 1310788 Hvcn1 Rnor_6.0 12 39822814 39851093 - Hvcn1em1Mcwi
6893419 Hvcn1em2Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 313-320) 2012-08-28 2012-08-28 1310788 Hvcn1 RGSC 3.4 12 35536954 35556666 - Hvcn1em2Mcwi
6893419 Hvcn1em2Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 313-320) 2012-08-28 2012-08-28 1310788 Hvcn1 Rnor_5.0 12 41702567 41731349 - Hvcn1em2Mcwi
6893419 Hvcn1em2Mcwi hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 313-320) 2012-08-28 2012-08-28 1310788 Hvcn1 Rnor_6.0 12 39822814 39851093 - Hvcn1em2Mcwi
12910495 Ifnar1em1 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 RGSC 3.4 11 31454789 31478449 + Ifnar1em1
12910495 Ifnar1em1 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 Rnor_5.0 11 35248575 35272235 + Ifnar1em1
12910495 Ifnar1em1 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 Rnor_6.0 11 31640407 31666839 + Ifnar1em1
12910496 Ifnar1em2 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion and 4-bp insertion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 RGSC 3.4 11 31454789 31478449 + Ifnar1em2
12910496 Ifnar1em2 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion and 4-bp insertion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 Rnor_5.0 11 35248575 35272235 + Ifnar1em2
12910496 Ifnar1em2 interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2 An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion and 4-bp insertion in the exon 4 of Ifnar1 gene. 2017-06-16 2017-06-16 1305399 Ifnar1 Rnor_6.0 11 31640407 31666839 + Ifnar1em2
12879433 Ift140em1Kyo intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. 2017-04-19 2017-04-19 2318759 Ift140 RGSC 3.4 10 14258556 14348468 + Ift140em1Kyo
12879433 Ift140em1Kyo intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. 2017-04-19 2017-04-19 2318759 Ift140 Rnor_5.0 10 14189328 14276940 + Ift140em1Kyo
12879433 Ift140em1Kyo intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. 2017-04-19 2017-04-19 2318759 Ift140 Rnor_6.0 10 14373668 14461509 + Ift140em1Kyo
12790625 Igh-6em1Mcwi immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in exon 2 of the Igh-6 gene. 2017-02-17 2017-02-17 1359202 Igh-6 RGSC 3.4 6 143205627 143206076 - Igh-6em1Mcwi
12790630 Igh-6em4Mcwi immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 2 of the Igh-6 gene. 2017-02-17 2017-02-17 1359202 Igh-6 RGSC 3.4 6 143205627 143206076 - Igh-6em4Mcwi
150523756 Ighmem1Ang immunoglobulin heavy constant mu; ZFN induced mutant1, Ang The ZFN induced mutation in this rat allele comprised a 64 bp deletion of the IgM CH1 domain and resulted of a stop codon. 2021-11-18 2021-11-18 15004087 Ighm
150523758 Ighmem2Ang immunoglobulin heavy constant mu; ZFN induced mutant2, Ang Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus 2021-11-18 2021-11-18 15004087 Ighm
12910491 Il15em1Soar interleukin 15; ZFN induced mutant 1, Soar Zinc finger nuclease mediated 7bp deletion within exon 2 of the rat Il15 gene, resulting in a frameshift and premature stop codon. 2017-06-16 2017-06-16 2887 Il15 RGSC 3.4 19 27487268 27498973 + Il15em1Soar
12910491 Il15em1Soar interleukin 15; ZFN induced mutant 1, Soar Zinc finger nuclease mediated 7bp deletion within exon 2 of the rat Il15 gene, resulting in a frameshift and premature stop codon. 2017-06-16 2017-06-16 2887 Il15 Rnor_5.0 19 34532033 34598725 - Il15em1Soar
12910491 Il15em1Soar interleukin 15; ZFN induced mutant 1, Soar Zinc finger nuclease mediated 7bp deletion within exon 2 of the rat Il15 gene, resulting in a frameshift and premature stop codon. 2017-06-16 2017-06-16 2887 Il15 Rnor_6.0 19 23542606 23624366 - Il15em1Soar
6893425 Il1r1em1Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 5 (del 441-453) 2012-08-28 2012-08-28 2892 Il1r1 RGSC 3.4 9 39434910 39473552 + Il1r1em1Mcwi
6893425 Il1r1em1Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 5 (del 441-453) 2012-08-28 2012-08-28 2892 Il1r1 Rnor_5.0 9 46647422 46723241 + Il1r1em1Mcwi
6893425 Il1r1em1Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 5 (del 441-453) 2012-08-28 2012-08-28 2892 Il1r1 Rnor_6.0 9 46962291 47038139 + Il1r1em1Mcwi
6893414 Il1r1em2Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 (del 444-450) 2012-08-28 2012-08-28 2892 Il1r1 RGSC 3.4 9 39434910 39473552 + Il1r1em2Mcwi
6893414 Il1r1em2Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 (del 444-450) 2012-08-28 2012-08-28 2892 Il1r1 Rnor_5.0 9 46647422 46723241 + Il1r1em2Mcwi
6893414 Il1r1em2Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 (del 444-450) 2012-08-28 2012-08-28 2892 Il1r1 Rnor_6.0 9 46962291 47038139 + Il1r1em2Mcwi
6893378 Il1r1em3Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5.(ins a) 2012-08-24 2012-08-24 2892 Il1r1 RGSC 3.4 9 39434910 39473552 + Il1r1em3Mcwi
6893378 Il1r1em3Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5.(ins a) 2012-08-24 2012-08-24 2892 Il1r1 Rnor_5.0 9 46647422 46723241 + Il1r1em3Mcwi
6893378 Il1r1em3Mcwi interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5.(ins a) 2012-08-24 2012-08-24 2892 Il1r1 Rnor_6.0 9 46962291 47038139 + Il1r1em3Mcwi
126925159 Il1rl2tm1(Myh6-cre)Mhzh interleukin 1 receptor-like 2; tm1 (Myh6-cre), Mhzh The expression of Il1rl2 was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 621782 Il1rl2 RGSC 3.4 9 39492187 39537792 + Myh6-Cre IL1RL2flox/flox;interleukin 1 receptor-like 2; tm1, Mhzh
126925159 Il1rl2tm1(Myh6-cre)Mhzh interleukin 1 receptor-like 2; tm1 (Myh6-cre), Mhzh The expression of Il1rl2 was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 621782 Il1rl2 Rnor_5.0 9 46733619 46778352 + Myh6-Cre IL1RL2flox/flox;interleukin 1 receptor-like 2; tm1, Mhzh
126925159 Il1rl2tm1(Myh6-cre)Mhzh interleukin 1 receptor-like 2; tm1 (Myh6-cre), Mhzh The expression of Il1rl2 was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 621782 Il1rl2 Rnor_6.0 9 47044870 47093679 + Myh6-Cre IL1RL2flox/flox;interleukin 1 receptor-like 2; tm1, Mhzh
13628731 Il2rgem1Ang interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon. 2018-06-20 2018-06-20 621466 Il2rg RGSC 3.4 X 89342055 89345715 -
13628731 Il2rgem1Ang interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon. 2018-06-20 2018-06-20 621466 Il2rg Rnor_5.0 X 72017856 72021516 -
13628731 Il2rgem1Ang interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon. 2018-06-20 2018-06-20 621466 Il2rg Rnor_6.0 X 71165378 71169078 -
645123290 Il2rgem1Hera interleukin 2 receptor, gamma; endonuclease induced mutant 1, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying a sixteen base pair deletion (gagaatctaggctcat) in the first coding exon of the Il2rg gene. 2026-04-16 2026-04-16 621466 Il2rg RGSC 3.4 X 89342055 89345715 -
645123290 Il2rgem1Hera interleukin 2 receptor, gamma; endonuclease induced mutant 1, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying a sixteen base pair deletion (gagaatctaggctcat) in the first coding exon of the Il2rg gene. 2026-04-16 2026-04-16 621466 Il2rg Rnor_5.0 X 72017856 72021516 -
645123290 Il2rgem1Hera interleukin 2 receptor, gamma; endonuclease induced mutant 1, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying a sixteen base pair deletion (gagaatctaggctcat) in the first coding exon of the Il2rg gene. 2026-04-16 2026-04-16 621466 Il2rg Rnor_6.0 X 71165378 71169078 -
12798562 Il2rgem1Hina interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina This mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar). 2017-03-27 2017-03-27 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem1Hina
12798562 Il2rgem1Hina interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina This mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar). 2017-03-27 2017-03-27 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem1Hina
12798562 Il2rgem1Hina interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina This mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar). 2017-03-27 2017-03-27 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem1Hina
13464264 Il2rgem1Iexas interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. 2018-01-02 2018-01-02 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem1Iexas
13464264 Il2rgem1Iexas interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. 2018-01-02 2018-01-02 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem1Iexas
13464264 Il2rgem1Iexas interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. 2018-01-02 2018-01-02 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem1Iexas
12798560 Il2rgem1Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos.A 660-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem1Kyo
12798560 Il2rgem1Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos.A 660-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem1Kyo
12798560 Il2rgem1Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos.A 660-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem1Kyo
12790633 Il2rgem1Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2. 2017-02-17 2017-02-17 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem1Mcwi
12790633 Il2rgem1Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2. 2017-02-17 2017-02-17 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem1Mcwi
12790633 Il2rgem1Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2. 2017-02-17 2017-02-17 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem1Mcwi
12798561 Il2rgem2Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos. A 1097-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem2Kyo
12798561 Il2rgem2Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos. A 1097-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem2Kyo
12798561 Il2rgem2Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos. A 1097-bp deletion mutation was created and resulted no detectable protein expression by western blot. 2017-03-27 2017-03-27 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem2Kyo
10002792 Il2rgem2Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein. 2015-04-28 2015-04-28 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem2Mcwi
10002792 Il2rgem2Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein. 2015-04-28 2015-04-28 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem2Mcwi
10002792 Il2rgem2Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein. 2015-04-28 2015-04-28 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem2Mcwi
13464340 Il2rgem3Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo This mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo. 2018-01-04 2018-01-04 621466 Il2rg RGSC 3.4 X 89342055 89345715 - interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo;Il2rgem5Kyo;Il2rgem3Kyo
13464340 Il2rgem3Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo This mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo. 2018-01-04 2018-01-04 621466 Il2rg Rnor_5.0 X 72017856 72021516 - interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo;Il2rgem5Kyo;Il2rgem3Kyo
13464340 Il2rgem3Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo This mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo. 2018-01-04 2018-01-04 621466 Il2rg Rnor_6.0 X 71165378 71169078 - interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo;Il2rgem5Kyo;Il2rgem3Kyo
12790660 Il2rgem3Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2. 2017-02-20 2017-02-20 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem3Mcwi
12790660 Il2rgem3Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2. 2017-02-20 2017-02-20 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem3Mcwi
12790660 Il2rgem3Mcwi interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin This allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2. 2017-02-20 2017-02-20 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem3Mcwi
13464339 Il2rgem4Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo The mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo. 2018-01-04 2018-01-04 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem4Kyo
13464339 Il2rgem4Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo The mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo. 2018-01-04 2018-01-04 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem4Kyo
13464339 Il2rgem4Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo The mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo. 2018-01-04 2018-01-04 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem4Kyo
12910099 Il2rgem5Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo This ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene. 2017-06-08 2017-06-08 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem5Kyo
12910099 Il2rgem5Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo This ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene. 2017-06-08 2017-06-08 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem5Kyo
12910099 Il2rgem5Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo This ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene. 2017-06-08 2017-06-08 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem5Kyo
12910097 Il2rgem6Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created. 2017-06-08 2017-06-08 621466 Il2rg RGSC 3.4 X 89342055 89345715 - Il2rgem6Kyo
12910097 Il2rgem6Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created. 2017-06-08 2017-06-08 621466 Il2rg Rnor_5.0 X 72017856 72021516 - Il2rgem6Kyo
12910097 Il2rgem6Kyo interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created. 2017-06-08 2017-06-08 621466 Il2rg Rnor_6.0 X 71165378 71169078 - Il2rgem6Kyo
13628732 Il2rgem7Kyo interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo This mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN. 2018-06-20 2018-06-20 621466 Il2rg RGSC 3.4 X 89342055 89345715 -
13628732 Il2rgem7Kyo interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo This mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN. 2018-06-20 2018-06-20 621466 Il2rg Rnor_5.0 X 72017856 72021516 -
13628732 Il2rgem7Kyo interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo This mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN. 2018-06-20 2018-06-20 621466 Il2rg Rnor_6.0 X 71165378 71169078 -
126925161 Il36rntm1(Myh6-cre)Mhzh interleukin 36 receptor antagonist; tm1, Mhzh The expression of Il36rn was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 1311212 Il36rn RGSC 3.4 3 2530402 2536999 +
126925161 Il36rntm1(Myh6-cre)Mhzh interleukin 36 receptor antagonist; tm1, Mhzh The expression of Il36rn was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 1311212 Il36rn Rnor_5.0 3 1378833 1385430 +
126925161 Il36rntm1(Myh6-cre)Mhzh interleukin 36 receptor antagonist; tm1, Mhzh The expression of Il36rn was knockout by Cre-loxP system in cardiomyocytes. 2021-05-13 2021-05-13 1311212 Il36rn Rnor_6.0 3 1385256 1392275 +
407450416 Il6em1Yona interleukin 6; CRISPR/Cas9 induced mutant 1, Yona This allele was generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This allele carries a118 bp deleted in the second exon of IL-6 2024-09-06 2024-09-06 2901 Il6 RGSC 3.4 4 456799 461376 - Il6em1Yona-/-
407450416 Il6em1Yona interleukin 6; CRISPR/Cas9 induced mutant 1, Yona This allele was generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This allele carries a118 bp deleted in the second exon of IL-6 2024-09-06 2024-09-06 2901 Il6 Rnor_5.0 4 3095536 3100112 + Il6em1Yona-/-
407450416 Il6em1Yona interleukin 6; CRISPR/Cas9 induced mutant 1, Yona This allele was generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This allele carries a118 bp deleted in the second exon of IL-6 2024-09-06 2024-09-06 2901 Il6 Rnor_6.0 4 3043231 3047807 + Il6em1Yona-/-
2299102 Immp1lTn(sb-T2/Bart3)2.246Mcwi IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene 2008-08-12 2008-08-12 1587441 Immp1l RGSC 3.4 3 91408864 91436603 + Immp1lTn(sb-T2/Bart3)2.246Mcwi
2299102 Immp1lTn(sb-T2/Bart3)2.246Mcwi IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene 2008-08-12 2008-08-12 1587441 Immp1l Rnor_5.0 3 102575250 102646194 + Immp1lTn(sb-T2/Bart3)2.246Mcwi
2299102 Immp1lTn(sb-T2/Bart3)2.246Mcwi IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene 2008-08-12 2008-08-12 1587441 Immp1l Rnor_6.0 3 95955126 96024316 + Immp1lTn(sb-T2/Bart3)2.246Mcwi
2290149 Inpp4bTn(sb-T2/Bart3)2.143Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-02-26 2008-02-26 620470 Inpp4b RGSC 3.4 19 27722430 28363639 - Inpp4bTn(sb-T2/Bart3)2.143Mcwi
2290149 Inpp4bTn(sb-T2/Bart3)2.143Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-02-26 2008-02-26 620470 Inpp4b Rnor_5.0 19 40508684 41132035 - Inpp4bTn(sb-T2/Bart3)2.143Mcwi
2290149 Inpp4bTn(sb-T2/Bart3)2.143Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-02-26 2008-02-26 620470 Inpp4b Rnor_6.0 19 29592889 30341528 - Inpp4bTn(sb-T2/Bart3)2.143Mcwi
2299095 Inpp4bTn(sb-T2/Bart3)2.232Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-08-12 2008-08-12 620470 Inpp4b RGSC 3.4 19 27722430 28363639 - Inpp4bTn(sb-T2/Bart3)2.232Mcwi
2299095 Inpp4bTn(sb-T2/Bart3)2.232Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-08-12 2008-08-12 620470 Inpp4b Rnor_5.0 19 40508684 41132035 - Inpp4bTn(sb-T2/Bart3)2.232Mcwi
2299095 Inpp4bTn(sb-T2/Bart3)2.232Mcwi inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene 2008-08-12 2008-08-12 620470 Inpp4b Rnor_6.0 19 29592889 30341528 - Inpp4bTn(sb-T2/Bart3)2.232Mcwi
2306873 IntuTn(sb-T2/Bart3)2.324Mcwi inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene 2009-05-11 2009-05-11 1309446 Intu RGSC 3.4 2 127564813 127639564 + IntuTn(sb-T2/Bart3)2.324Mcwi
2306873 IntuTn(sb-T2/Bart3)2.324Mcwi inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene 2009-05-11 2009-05-11 1309446 Intu Rnor_5.0 2 147063971 147133390 + IntuTn(sb-T2/Bart3)2.324Mcwi
2306873 IntuTn(sb-T2/Bart3)2.324Mcwi inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene 2009-05-11 2009-05-11 1309446 Intu Rnor_5.0 2 147193461 147216092 + IntuTn(sb-T2/Bart3)2.324Mcwi
2306873 IntuTn(sb-T2/Bart3)2.324Mcwi inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene 2009-05-11 2009-05-11 1309446 Intu Rnor_6.0 2 127459089 127521327 + IntuTn(sb-T2/Bart3)2.324Mcwi
5144077 Itga9em1Mcwi integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor ( v3.4 del 123601499-123601585) 2011-07-29 2011-07-29 1311191 Itga9 RGSC 3.4 8 123526904 123838241 + Itga9em1Mcwi
5144077 Itga9em1Mcwi integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor ( v3.4 del 123601499-123601585) 2011-07-29 2011-07-29 1311191 Itga9 Rnor_5.0 8 126493359 126795566 + Itga9em1Mcwi
5144077 Itga9em1Mcwi integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor ( v3.4 del 123601499-123601585) 2011-07-29 2011-07-29 1311191 Itga9 Rnor_6.0 8 127271029 127576709 + Itga9em1Mcwi
329845587 Izumo1em1Osb izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb This CRISPR/Cas9 induced mutant allele carries a 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene. 2023-05-30 2023-05-30 1565454 Izumo1 RGSC 3.4 1 96090118 96095872 +
329845587 Izumo1em1Osb izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb This CRISPR/Cas9 induced mutant allele carries a 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene. 2023-05-30 2023-05-30 1565454 Izumo1 Rnor_5.0 1 102682002 102687757 +
329845587 Izumo1em1Osb izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb This CRISPR/Cas9 induced mutant allele carries a 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene. 2023-05-30 2023-05-30 1565454 Izumo1 Rnor_6.0 1 101603222 101608977 +
11084926 Jundem1Tja JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. 2016-06-01 2016-06-01 2945 Jund RGSC 3.4 16 19239694 19241529 - Jundem1Tja
11084926 Jundem1Tja JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. 2016-06-01 2016-06-01 2945 Jund Rnor_5.0 16 20342096 20343775 - Jundem1Tja
11084926 Jundem1Tja JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. 2016-06-01 2016-06-01 2945 Jund Rnor_6.0 16 20485028 20486707 - Jundem1Tja
12880383 Kcna1Adms potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures This allele was generated by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in rat Kcna1 gene. 2017-05-04 2017-05-04 2949 Kcna1 RGSC 3.4 4 163011777 163013522 - Kcna1Adms
12880383 Kcna1Adms potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures This allele was generated by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in rat Kcna1 gene. 2017-05-04 2017-05-04 2949 Kcna1 Rnor_5.0 4 226188851 226190596 - Kcna1Adms
12880383 Kcna1Adms potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures This allele was generated by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in rat Kcna1 gene. 2017-05-04 2017-05-04 2949 Kcna1 Rnor_6.0 4 159190781 159192526 - Kcna1Adms
1642177 Kcna5m1Mcwi potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N152K mutation is generated from the codon change AAT/AAA 2007-09-06 2007-09-06 2953 Kcna5 RGSC 3.4 4 162896283 162898091 - Kcna5m1Mcwi
1642177 Kcna5m1Mcwi potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N152K mutation is generated from the codon change AAT/AAA 2007-09-06 2007-09-06 2953 Kcna5 Rnor_5.0 4 226075051 226076859 - Kcna5m1Mcwi
1642177 Kcna5m1Mcwi potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N152K mutation is generated from the codon change AAT/AAA 2007-09-06 2007-09-06 2953 Kcna5 Rnor_6.0 4 159077195 159079003 - Kcna5m1Mcwi
2303094 Kcnab1Tn(sb-T2/Bart3)2.300Mcwi potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene 2009-02-02 2009-02-02 61827 Kcnab1 RGSC 3.4 2 154837841 155145882 + kcnb1tn(sb-t2/bart3)2.300mcwi;potassium voltage gated channel, shab-related subfamily, member 1;transposon insertion 2.300, medical college of wisconsin;Kcnab1Tn(sb-T2/Bart3)2.300Mcwi
2303094 Kcnab1Tn(sb-T2/Bart3)2.300Mcwi potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene 2009-02-02 2009-02-02 61827 Kcnab1 Rnor_5.0 2 174966379 175400010 + kcnb1tn(sb-t2/bart3)2.300mcwi;potassium voltage gated channel, shab-related subfamily, member 1;transposon insertion 2.300, medical college of wisconsin;Kcnab1Tn(sb-T2/Bart3)2.300Mcwi
2303094 Kcnab1Tn(sb-T2/Bart3)2.300Mcwi potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene 2009-02-02 2009-02-02 61827 Kcnab1 Rnor_6.0 2 155555798 156011438 + kcnb1tn(sb-t2/bart3)2.300mcwi;potassium voltage gated channel, shab-related subfamily, member 1;transposon insertion 2.300, medical college of wisconsin;Kcnab1Tn(sb-T2/Bart3)2.300Mcwi
2303095 Kcnh7Tn(sb-T2/Bart3)2.295Mcwi potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene 2009-02-02 2009-02-02 621112 Kcnh7 RGSC 3.4 3 44657361 45153509 - Kcnh7Tn(sb-T2/Bart3)2.295Mcwi
2303095 Kcnh7Tn(sb-T2/Bart3)2.295Mcwi potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene 2009-02-02 2009-02-02 621112 Kcnh7 Rnor_5.0 3 55325680 55822973 - Kcnh7Tn(sb-T2/Bart3)2.295Mcwi
2303095 Kcnh7Tn(sb-T2/Bart3)2.295Mcwi potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene 2009-02-02 2009-02-02 621112 Kcnh7 Rnor_6.0 3 48662450 49168716 - Kcnh7Tn(sb-T2/Bart3)2.295Mcwi
2299100 Kcnip4Tn(sb-T2/Bart3)2.225Mcwi Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene 2008-08-12 2008-08-12 708539 Kcnip4 RGSC 3.4 14 66284290 67452628 + Kcnip4Tn(sb-T2/Bart3)2.225Mcwi
2299100 Kcnip4Tn(sb-T2/Bart3)2.225Mcwi Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene 2008-08-12 2008-08-12 708539 Kcnip4 Rnor_5.0 14 65635533 66780362 + Kcnip4Tn(sb-T2/Bart3)2.225Mcwi
2299100 Kcnip4Tn(sb-T2/Bart3)2.225Mcwi Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene 2008-08-12 2008-08-12 708539 Kcnip4 Rnor_6.0 14 65549362 66749181 + Kcnip4Tn(sb-T2/Bart3)2.225Mcwi
13782352 Kcnj1em1Kasu potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA).The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. 2018-09-06 2018-09-06 2957 Kcnj1 RGSC 3.4 8 32158243 32162370 +
13782352 Kcnj1em1Kasu potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA).The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. 2018-09-06 2018-09-06 2957 Kcnj1 Rnor_5.0 8 33453597 33454750 +
13782352 Kcnj1em1Kasu potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA).The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. 2018-09-06 2018-09-06 2957 Kcnj1 Rnor_6.0 8 33490280 33519127 +
10054406 Kcnj10em1Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 RGSC 3.4 13 88341102 88370591 + Kcnj10em1Mcwi
10054406 Kcnj10em1Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 Rnor_5.0 13 95245046 95274535 + Kcnj10em1Mcwi
10054406 Kcnj10em1Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 Rnor_6.0 13 90722945 90753338 + Kcnj10em1Mcwi
10054409 Kcnj10em3Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp deletion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 RGSC 3.4 13 88341102 88370591 + Kcnj10em3Mcwi;potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
10054409 Kcnj10em3Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp deletion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 Rnor_5.0 13 95245046 95274535 + Kcnj10em3Mcwi;potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
10054409 Kcnj10em3Mcwi potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp deletion in the Kcnj10 gene 2015-08-05 2016-10-19 61822 Kcnj10 Rnor_6.0 13 90722945 90753338 + Kcnj10em3Mcwi;potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin
6893379 Kcnj11em5Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 8-bp deletion in exon 1 (del 311-318) 2012-08-24 2012-08-24 69247 Kcnj11 RGSC 3.4 1 96614960 96617993 - Kcnj11em5Mcwi
6893379 Kcnj11em5Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 8-bp deletion in exon 1 (del 311-318) 2012-08-24 2012-08-24 69247 Kcnj11 Rnor_5.0 1 103186859 103190535 - Kcnj11em5Mcwi
6893379 Kcnj11em5Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 8-bp deletion in exon 1 (del 311-318) 2012-08-24 2012-08-24 69247 Kcnj11 Rnor_6.0 1 102103093 102107134 - Kcnj11em5Mcwi
6893381 Kcnj11em9Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 5-bp deletion in exon 1 (del 310-314) 2012-08-24 2012-08-24 69247 Kcnj11 RGSC 3.4 1 96614960 96617993 - Kcnj11em9Mcwi
6893381 Kcnj11em9Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 5-bp deletion in exon 1 (del 310-314) 2012-08-24 2012-08-24 69247 Kcnj11 Rnor_5.0 1 103186859 103190535 - Kcnj11em9Mcwi
6893381 Kcnj11em9Mcwi potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 5-bp deletion in exon 1 (del 310-314) 2012-08-24 2012-08-24 69247 Kcnj11 Rnor_6.0 1 102103093 102107134 - Kcnj11em9Mcwi
13207498 Kcnj13em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. 2017-08-02 2017-08-02 621661 Kcnj13 RGSC 3.4 9 86206927 86216659 - Kcnj13em1Mcwi;potassium voltage-gated channel subfamily J member 13; CRISPR/Cas9 induced mutant1, Mcwi
13207498 Kcnj13em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. 2017-08-02 2017-08-02 621661 Kcnj13 Rnor_5.0 9 94208941 94224828 - Kcnj13em1Mcwi;potassium voltage-gated channel subfamily J member 13; CRISPR/Cas9 induced mutant1, Mcwi
13207498 Kcnj13em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. 2017-08-02 2017-08-02 621661 Kcnj13 Rnor_6.0 9 94486719 94495333 - Kcnj13em1Mcwi;potassium voltage-gated channel subfamily J member 13; CRISPR/Cas9 induced mutant1, Mcwi
6893423 Kcnj16em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 18-bp deletion in exon 1 (del 529-546) 2012-08-28 2012-08-28 61824 Kcnj16 RGSC 3.4 10 100514180 100515949 + Kcnj16em1Mcwi
6893423 Kcnj16em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 18-bp deletion in exon 1 (del 529-546) 2012-08-28 2012-08-28 61824 Kcnj16 Rnor_5.0 10 99027026 99087674 + Kcnj16em1Mcwi
6893423 Kcnj16em1Mcwi potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 18-bp deletion in exon 1 (del 529-546) 2012-08-28 2012-08-28 61824 Kcnj16 Rnor_6.0 10 99330894 99391551 + Kcnj16em1Mcwi
14394495 Kcnj2em2Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 RGSC 3.4 10 100574985 100576268 + potassium voltage-gated channel subfamily J member 2;CRISPR/Cas9 system induced mutant 2, Mcwi;potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 2, Mcwi
14394495 Kcnj2em2Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 Rnor_5.0 10 99125234 99134077 + potassium voltage-gated channel subfamily J member 2;CRISPR/Cas9 system induced mutant 2, Mcwi;potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 2, Mcwi
14394495 Kcnj2em2Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 Rnor_6.0 10 99429337 99442520 + potassium voltage-gated channel subfamily J member 2;CRISPR/Cas9 system induced mutant 2, Mcwi;potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 2, Mcwi
14394497 Kcnj2em4Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 RGSC 3.4 10 100574985 100576268 + potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 4, Mcwi
14394497 Kcnj2em4Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 Rnor_5.0 10 99125234 99134077 + potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 4, Mcwi
14394497 Kcnj2em4Mcwi potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 2019-03-22 2019-03-22 61968 Kcnj2 Rnor_6.0 10 99429337 99442520 + potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 4, Mcwi
126908015 Kcnk3em1Ang potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang The mutation created by CRISPR/Cas9 in Crl:SD embryos contained a 94- bp deletion in exon1 of resulted a premature stop codon. 2021-05-10 2021-05-10 61997 Kcnk3 RGSC 3.4 6 25745923 25782144 - Kcnk3em1Ang-/-
126908015 Kcnk3em1Ang potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang The mutation created by CRISPR/Cas9 in Crl:SD embryos contained a 94- bp deletion in exon1 of resulted a premature stop codon. 2021-05-10 2021-05-10 61997 Kcnk3 Rnor_5.0 6 36969843 37005778 - Kcnk3em1Ang-/-
126908015 Kcnk3em1Ang potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang The mutation created by CRISPR/Cas9 in Crl:SD embryos contained a 94- bp deletion in exon1 of resulted a premature stop codon. 2021-05-10 2021-05-10 61997 Kcnk3 Rnor_6.0 6 27154274 27190209 - Kcnk3em1Ang-/-
6893415 Kcnmb1em1Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a net 4-bp deletion in exon 2 (del 441-447, ins. Tct) 2012-08-28 2012-08-28 2961 Kcnmb1 RGSC 3.4 10 18904902 18912604 + Kcnmb1em1Mcwi
6893415 Kcnmb1em1Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a net 4-bp deletion in exon 2 (del 441-447, ins. Tct) 2012-08-28 2012-08-28 2961 Kcnmb1 Rnor_5.0 10 18790595 18800957 + Kcnmb1em1Mcwi
6893415 Kcnmb1em1Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a net 4-bp deletion in exon 2 (del 441-447, ins. Tct) 2012-08-28 2012-08-28 2961 Kcnmb1 Rnor_6.0 10 18910586 18922856 + Kcnmb1em1Mcwi
6893420 Kcnmb1em3Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692) 2012-08-28 2012-08-28 2961 Kcnmb1 RGSC 3.4 10 18904902 18912604 + Kcnmb1em3Mcwi
6893420 Kcnmb1em3Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692) 2012-08-28 2012-08-28 2961 Kcnmb1 Rnor_5.0 10 18790595 18800957 + Kcnmb1em3Mcwi
6893420 Kcnmb1em3Mcwi potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692) 2012-08-28 2012-08-28 2961 Kcnmb1 Rnor_6.0 10 18910586 18922856 + Kcnmb1em3Mcwi
149735330 Kcnn2Trdk potassium calcium-activated channel subfamily N member 2; Trdk mutant This is a mutant allele identified in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU). The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2. 2021-07-15 2021-07-15 2963 Kcnn2 RGSC 3.4 18 39560962 39705037 +
149735330 Kcnn2Trdk potassium calcium-activated channel subfamily N member 2; Trdk mutant This is a mutant allele identified in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU). The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2. 2021-07-15 2021-07-15 2963 Kcnn2 Rnor_5.0 18 38822146 38864110 +
149735330 Kcnn2Trdk potassium calcium-activated channel subfamily N member 2; Trdk mutant This is a mutant allele identified in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU). The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2. 2021-07-15 2021-07-15 2963 Kcnn2 Rnor_6.0 18 39331894 39479574 +
12802344 Kcnq1dfk potassium voltage-gated channel subfamily Q member 1;deafness Kyoto A naturally occurring deletion mutation arising on the genetic background of an inbred WTC strain. It is a 2040-bp deletion that included whole exon 7 and its flanking sequences of the Kcnq1 gene. 2017-04-05 2017-04-05 621503 Kcnq1 RGSC 3.4 1 203383401 203803687 + Kcnq1dfk
12802344 Kcnq1dfk potassium voltage-gated channel subfamily Q member 1;deafness Kyoto A naturally occurring deletion mutation arising on the genetic background of an inbred WTC strain. It is a 2040-bp deletion that included whole exon 7 and its flanking sequences of the Kcnq1 gene. 2017-04-05 2017-04-05 621503 Kcnq1 Rnor_5.0 1 223154713 223490458 + Kcnq1dfk
12802344 Kcnq1dfk potassium voltage-gated channel subfamily Q member 1;deafness Kyoto A naturally occurring deletion mutation arising on the genetic background of an inbred WTC strain. It is a 2040-bp deletion that included whole exon 7 and its flanking sequences of the Kcnq1 gene. 2017-04-05 2017-04-05 621503 Kcnq1 Rnor_6.0 1 216293087 216630339 + Kcnq1dfk
5144083 Kcnq1em14Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 3 (del 621-637) 2011-07-29 2011-07-29 621503 Kcnq1 RGSC 3.4 1 203383401 203803687 + Kcnq1em14Mcwi
5144083 Kcnq1em14Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 3 (del 621-637) 2011-07-29 2011-07-29 621503 Kcnq1 Rnor_5.0 1 223154713 223490458 + Kcnq1em14Mcwi
5144083 Kcnq1em14Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 3 (del 621-637) 2011-07-29 2011-07-29 621503 Kcnq1 Rnor_6.0 1 216293087 216630339 + Kcnq1em14Mcwi
13800813 Kcnq1em5Mcwi potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. 2018-10-18 2018-10-18 621503 Kcnq1 RGSC 3.4 1 203383401 203803687 + Kcnq1em5Mcwi
13800813 Kcnq1em5Mcwi potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. 2018-10-18 2018-10-18 621503 Kcnq1 Rnor_5.0 1 223154713 223490458 + Kcnq1em5Mcwi
13800813 Kcnq1em5Mcwi potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. 2018-10-18 2018-10-18 621503 Kcnq1 Rnor_6.0 1 216293087 216630339 + Kcnq1em5Mcwi
5144076 Kcnq1em9Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 3 (del 631-637) 2011-07-29 2011-07-29 621503 Kcnq1 RGSC 3.4 1 203383401 203803687 + Kcnq1em9Mcwi
5144076 Kcnq1em9Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 3 (del 631-637) 2011-07-29 2011-07-29 621503 Kcnq1 Rnor_5.0 1 223154713 223490458 + Kcnq1em9Mcwi
5144076 Kcnq1em9Mcwi potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 3 (del 631-637) 2011-07-29 2011-07-29 621503 Kcnq1 Rnor_6.0 1 216293087 216630339 + Kcnq1em9Mcwi
2299111 Kif16bTn(sb-T2/Bart3)2.200Mcwi kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene 2008-08-12 2008-08-12 1310146 Kif16b RGSC 3.4 3 130967515 131250402 - Kif16bTn(sb-T2/Bart3)2.200Mcwi
2299111 Kif16bTn(sb-T2/Bart3)2.200Mcwi kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene 2008-08-12 2008-08-12 1310146 Kif16b Rnor_5.0 3 143103727 143381598 - Kif16bTn(sb-T2/Bart3)2.200Mcwi
2299111 Kif16bTn(sb-T2/Bart3)2.200Mcwi kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene 2008-08-12 2008-08-12 1310146 Kif16b Rnor_6.0 3 136596621 136936809 - Kif16bTn(sb-T2/Bart3)2.200Mcwi
40902862 Kiss1tm1Nips KiSS-1 metastasis-suppressor; targeted mutant 1, Nips This mutation was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. 2020-12-15 2020-12-15 727850 Kiss1 RGSC 3.4 13 46244786 46247288 +
40902862 Kiss1tm1Nips KiSS-1 metastasis-suppressor; targeted mutant 1, Nips This mutation was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. 2020-12-15 2020-12-15 727850 Kiss1 Rnor_5.0 13 55582365 55590432 -
40902862 Kiss1tm1Nips KiSS-1 metastasis-suppressor; targeted mutant 1, Nips This mutation was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. 2020-12-15 2020-12-15 727850 Kiss1 Rnor_6.0 13 50529506 50537603 -
126781693 Kiss1tm8Nips KiSS-1 metastasis-suppressor; targeted mutant 8, Nips This mutation was created by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination 2021-04-15 2021-04-15 727850 Kiss1 RGSC 3.4 13 46244786 46247288 +
126781693 Kiss1tm8Nips KiSS-1 metastasis-suppressor; targeted mutant 8, Nips This mutation was created by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination 2021-04-15 2021-04-15 727850 Kiss1 Rnor_5.0 13 55582365 55590432 -
126781693 Kiss1tm8Nips KiSS-1 metastasis-suppressor; targeted mutant 8, Nips This mutation was created by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination 2021-04-15 2021-04-15 727850 Kiss1 Rnor_6.0 13 50529506 50537603 -
12910763 KitWs KIT proto-oncogene receptor tyrosine kinase; mutant 1 A spontaneous 12-bp deletion mutation in the tyrosine kinase domain of the c-Kit gene was identified in the white spotting rat. 2017-06-23 2017-06-23 620568 Kit RGSC 3.4 14 34906043 34984819 - KitWs
12910763 KitWs KIT proto-oncogene receptor tyrosine kinase; mutant 1 A spontaneous 12-bp deletion mutation in the tyrosine kinase domain of the c-Kit gene was identified in the white spotting rat. 2017-06-23 2017-06-23 620568 Kit Rnor_5.0 14 34901860 34979384 - KitWs
12910763 KitWs KIT proto-oncogene receptor tyrosine kinase; mutant 1 A spontaneous 12-bp deletion mutation in the tyrosine kinase domain of the c-Kit gene was identified in the white spotting rat. 2017-06-23 2017-06-23 620568 Kit Rnor_6.0 14 35072131 35149638 - KitWs
1599569 Klf4m1Mcwi KLF transcription factor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V243I mutation is generated from the codon change GTC/ATC 2007-02-07 2007-02-07 621445 Klf4 RGSC 3.4 5 73446928 73451286 - Klf4m1Mcwi
1599569 Klf4m1Mcwi KLF transcription factor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V243I mutation is generated from the codon change GTC/ATC 2007-02-07 2007-02-07 621445 Klf4 Rnor_5.0 5 76447643 76452001 - Klf4m1Mcwi
1599569 Klf4m1Mcwi KLF transcription factor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V243I mutation is generated from the codon change GTC/ATC 2007-02-07 2007-02-07 621445 Klf4 Rnor_6.0 5 72283311 72287669 - Klf4m1Mcwi
1599559 Klf4m2Mcwi KLF transcription factor 4; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I150N mutation is generated from the codon change ATC/AAC 2007-02-07 2007-02-07 621445 Klf4 RGSC 3.4 5 73446928 73451286 - Klf4m2Mcwi
1599559 Klf4m2Mcwi KLF transcription factor 4; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I150N mutation is generated from the codon change ATC/AAC 2007-02-07 2007-02-07 621445 Klf4 Rnor_5.0 5 76447643 76452001 - Klf4m2Mcwi
1599559 Klf4m2Mcwi KLF transcription factor 4; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); I150N mutation is generated from the codon change ATC/AAC 2007-02-07 2007-02-07 621445 Klf4 Rnor_6.0 5 72283311 72287669 - Klf4m2Mcwi
1642179 Klf4m3Mcwi KLF transcription factor 4; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H344L mutation is generated from the codon change CAT/CTT 2007-09-06 2007-09-06 621445 Klf4 RGSC 3.4 5 73446928 73451286 - Klf4m3Mcwi
1642179 Klf4m3Mcwi KLF transcription factor 4; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H344L mutation is generated from the codon change CAT/CTT 2007-09-06 2007-09-06 621445 Klf4 Rnor_5.0 5 76447643 76452001 - Klf4m3Mcwi
1642179 Klf4m3Mcwi KLF transcription factor 4; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H344L mutation is generated from the codon change CAT/CTT 2007-09-06 2007-09-06 621445 Klf4 Rnor_6.0 5 72283311 72287669 - Klf4m3Mcwi
1578789 Klf6m1Mcwi KLF transcription factor 6; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V135G mutation is generated 2006-05-02 2006-05-02 62389 Klf6 RGSC 3.4 17 75578498 75585072 - Klf6m1Mcwi;Copebm1Mcwi;core promoter element binding protein, mutation 1, Medical College of Wisconsin
1578789 Klf6m1Mcwi KLF transcription factor 6; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V135G mutation is generated 2006-05-02 2006-05-02 62389 Klf6 Rnor_5.0 17 69616967 69674031 - Klf6m1Mcwi;Copebm1Mcwi;core promoter element binding protein, mutation 1, Medical College of Wisconsin
1578789 Klf6m1Mcwi KLF transcription factor 6; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V135G mutation is generated 2006-05-02 2006-05-02 62389 Klf6 Rnor_6.0 17 67887939 67945052 - Klf6m1Mcwi;Copebm1Mcwi;core promoter element binding protein, mutation 1, Medical College of Wisconsin
2290085 Klhl13Tn(sb-T2/Bart3)2.176Mcwi kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene 2008-02-26 2008-02-26 1559646 Klhl13 RGSC 3.4 X 10344050 10424665 + Klhl13Tn(sb-T2/Bart3)2.176Mcwi
2290085 Klhl13Tn(sb-T2/Bart3)2.176Mcwi kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene 2008-02-26 2008-02-26 1559646 Klhl13 Rnor_5.0 X 121716856 121876640 - Klhl13Tn(sb-T2/Bart3)2.176Mcwi
2290085 Klhl13Tn(sb-T2/Bart3)2.176Mcwi kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene 2008-02-26 2008-02-26 1559646 Klhl13 Rnor_6.0 X 121578965 121735014 - Klhl13Tn(sb-T2/Bart3)2.176Mcwi
2302638 Klra1Tn(sb-T2/Bart3)2.279Mcwi killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene 2009-01-06 2009-01-06 1359667 Klra2 RGSC 3.4 4 168892865 168928286 - Klra2Tn(sb-T2/Bart3)2.279Mcwi;Klra1Tn(sb-T2/Bart3)2.279Mcwi
2302638 Klra1Tn(sb-T2/Bart3)2.279Mcwi killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene 2009-01-06 2009-01-06 1359667 Klra2 Rnor_5.0 4 227986994 228022556 - Klra2Tn(sb-T2/Bart3)2.279Mcwi;Klra1Tn(sb-T2/Bart3)2.279Mcwi
2302638 Klra1Tn(sb-T2/Bart3)2.279Mcwi killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene 2009-01-06 2009-01-06 1359667 Klra2 Rnor_6.0 4 165426365 165460140 - Klra2Tn(sb-T2/Bart3)2.279Mcwi;Klra1Tn(sb-T2/Bart3)2.279Mcwi
14394503 Klrb1aem1Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a RGSC 3.4 4 165637478 165654188 -
14394503 Klrb1aem1Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a Rnor_5.0 4 227150602 227167004 -
14394503 Klrb1aem1Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a Rnor_6.0 4 161950270 161966582 -
14394505 Klrb1aem2Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a RGSC 3.4 4 165637478 165654188 -
14394505 Klrb1aem2Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a Rnor_5.0 4 227150602 227167004 -
14394505 Klrb1aem2Mcwi killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. 2019-03-25 2019-03-25 1586149 Klrb1a Rnor_6.0 4 161950270 161966582 -
10002785 Krt71m1Yuyi keratin 71, type II; mutation 1, Laboratory Animal Center of Zhengzhou University a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate. 2015-04-28 2017-02-27 1584538 Krt71 Rnor_5.0 7 141143396 141166531 - KRT71RN;Krt71m1Yuyi
10002785 Krt71m1Yuyi keratin 71, type II; mutation 1, Laboratory Animal Center of Zhengzhou University a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate. 2015-04-28 2017-02-27 1584538 Krt71 Rnor_6.0 7 143345201 143371346 - KRT71RN;Krt71m1Yuyi
11570416 Krt71Rex keratin 71; autosomal dominant Rex A 7-bp deletion at the splice acceptor site of the first -> second coding exons of the keratin 71 (Krt71) gene is identified in this allele. 2016-12-14 2016-12-14 1584538 Krt71 Rnor_5.0 7 141143396 141166531 - keratin 71; autosomal dominant Re;Krt71Re;Krt71Rex
11570416 Krt71Rex keratin 71; autosomal dominant Rex A 7-bp deletion at the splice acceptor site of the first -> second coding exons of the keratin 71 (Krt71) gene is identified in this allele. 2016-12-14 2016-12-14 1584538 Krt71 Rnor_6.0 7 143345201 143371346 - keratin 71; autosomal dominant Re;Krt71Re;Krt71Rex
19165363 Krtcap3em3Mcwi keratinocyte associated protein 3; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/NCrl rat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene. 2020-02-05 2024-05-29 1596516 Krtcap3 Rnor_5.0 6 36304329 36305898 -
19165363 Krtcap3em3Mcwi keratinocyte associated protein 3; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/NCrl rat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene. 2020-02-05 2024-05-29 1596516 Krtcap3 Rnor_6.0 6 26485126 26486695 -
38599015 L1camem1Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. 2020-09-08 2020-09-08 619777 L1cam RGSC 3.4 X 159784792 159801553 +
38599015 L1camem1Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. 2020-09-08 2020-09-08 619777 L1cam Rnor_5.0 1 152649353 152676124 +
38599015 L1camem1Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. 2020-09-08 2020-09-08 619777 L1cam Rnor_6.0 X 156901244 156928064 +
14696788 L1camem2Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. 2019-07-25 2019-07-25 619777 L1cam RGSC 3.4 X 159784792 159801553 +
14696788 L1camem2Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. 2019-07-25 2019-07-25 619777 L1cam Rnor_5.0 1 152649353 152676124 +
14696788 L1camem2Jgn L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. 2019-07-25 2019-07-25 619777 L1cam Rnor_6.0 X 156901244 156928064 +
2290089 LOC290071Tn(sb-T2/Bart3)2.170Mcwi similar to RIKEN cDNA A430107P09 gene; transposon insertion 2.170, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene 2008-02-26 2008-02-26 1562163 LOC290071 RGSC 3.4 15 32234625 32273880 + LOC290071Tn(sb-T2/Bart3)2.170Mcwi
2290089 LOC290071Tn(sb-T2/Bart3)2.170Mcwi similar to RIKEN cDNA A430107P09 gene; transposon insertion 2.170, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene 2008-02-26 2008-02-26 1562163 LOC290071 RGSC 3.4 15 30634899 30636521 - LOC290071Tn(sb-T2/Bart3)2.170Mcwi
2290119 LOC681893Tn(sb-T2/Bart3)2.159Mcwi similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.159, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene 2008-02-26 2008-02-26 1590473 LOC681893 LOC681893Tn(sb-T2/Bart3)2.159Mcwi
2290118 LOC681893Tn(sb-T2/Bart3)2.161Mcwi similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.161, Medical College of Wisconsin trap construct into the LOC681893 gene 2008-02-26 2008-02-26 1590473 LOC681893 LOC681893Tn(sb-T2/Bart3)2.161Mcwi
2299103 Lama2Tn(sb-T2/Bart3)2.2013Mcwi laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene 2008-08-12 2008-08-12 1308889 Lama2 RGSC 3.4 1 18203466 18885462 + Lama2Tn(sb-T2/Bart3)2.2013Mcwi
2299103 Lama2Tn(sb-T2/Bart3)2.2013Mcwi laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene 2008-08-12 2008-08-12 1308889 Lama2 Rnor_5.0 1 20002787 20647256 + Lama2Tn(sb-T2/Bart3)2.2013Mcwi
2299103 Lama2Tn(sb-T2/Bart3)2.2013Mcwi laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene 2008-08-12 2008-08-12 1308889 Lama2 Rnor_6.0 1 18491264 19143486 + Lama2Tn(sb-T2/Bart3)2.2013Mcwi
13703121 Lamp2em1 lysosomal-associated membrane protein 2; TALEN induced mutant1 This mutation was generated by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion. 2018-08-02 2018-08-02 2990 Lamp2 RGSC 3.4 X 6908285 6951772 +
13703121 Lamp2em1 lysosomal-associated membrane protein 2; TALEN induced mutant1 This mutation was generated by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion. 2018-08-02 2018-08-02 2990 Lamp2 Rnor_5.0 X 124809053 124852509 -
13703121 Lamp2em1 lysosomal-associated membrane protein 2; TALEN induced mutant1 This mutation was generated by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion. 2018-08-02 2018-08-02 2990 Lamp2 Rnor_6.0 X 124722628 124766079 -
2313460 LargeTn(sb-T2/Bart3)2.336Mcwi like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene 2009-09-28 2009-09-28 1308895 Large1 RGSC 3.4 19 12043818 12497663 - LargeTn(sb-T2/Bart3)2.336Mcwi
2313460 LargeTn(sb-T2/Bart3)2.336Mcwi like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene 2009-09-28 2009-09-28 1308895 Large1 Rnor_5.0 19 23595328 24054765 - LargeTn(sb-T2/Bart3)2.336Mcwi
2313460 LargeTn(sb-T2/Bart3)2.336Mcwi like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene 2009-09-28 2009-09-28 1308895 Large1 Rnor_6.0 19 12481563 12945320 - LargeTn(sb-T2/Bart3)2.336Mcwi
1578793 Lcatm1Mcwi lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H353L mutation is generated from the codon change CAC/CTC 2006-05-02 2006-05-02 2993 Lcat RGSC 3.4 19 35781507 35784966 - Lcatm1Mcwi
1578793 Lcatm1Mcwi lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H353L mutation is generated from the codon change CAC/CTC 2006-05-02 2006-05-02 2993 Lcat Rnor_5.0 19 48780364 48783830 - Lcatm1Mcwi
1578793 Lcatm1Mcwi lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H353L mutation is generated from the codon change CAC/CTC 2006-05-02 2006-05-02 2993 Lcat Rnor_6.0 19 37913333 37916799 - Lcatm1Mcwi
1599570 Lcatm2Mcwi lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D359E mutation is generated from the codon change GAC/GAG 2007-02-07 2007-02-07 2993 Lcat RGSC 3.4 19 35781507 35784966 - Lcatm2Mcwi
1599570 Lcatm2Mcwi lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D359E mutation is generated from the codon change GAC/GAG 2007-02-07 2007-02-07 2993 Lcat Rnor_5.0 19 48780364 48783830 - Lcatm2Mcwi
1599570 Lcatm2Mcwi lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); D359E mutation is generated from the codon change GAC/GAG 2007-02-07 2007-02-07 2993 Lcat Rnor_6.0 19 37913333 37916799 - Lcatm2Mcwi
1642175 Lcatm3Mcwi lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H316N mutation is generated from the codon change CAC/AAC 2007-09-06 2007-09-06 2993 Lcat RGSC 3.4 19 35781507 35784966 - Lcatm3Mcwi
1642175 Lcatm3Mcwi lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H316N mutation is generated from the codon change CAC/AAC 2007-09-06 2007-09-06 2993 Lcat Rnor_5.0 19 48780364 48783830 - Lcatm3Mcwi
1642175 Lcatm3Mcwi lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H316N mutation is generated from the codon change CAC/AAC 2007-09-06 2007-09-06 2993 Lcat Rnor_6.0 19 37913333 37916799 - Lcatm3Mcwi
1642358 Lcatm4Mcwi lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y336N mutation is generated from the codon change TAT/AAT 2007-09-13 2007-09-13 2993 Lcat RGSC 3.4 19 35781507 35784966 - Lcatm4Mcwi
1642358 Lcatm4Mcwi lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y336N mutation is generated from the codon change TAT/AAT 2007-09-13 2007-09-13 2993 Lcat Rnor_5.0 19 48780364 48783830 - Lcatm4Mcwi
1642358 Lcatm4Mcwi lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y336N mutation is generated from the codon change TAT/AAT 2007-09-13 2007-09-13 2993 Lcat Rnor_6.0 19 37913333 37916799 - Lcatm4Mcwi
1642438 Lcatm5Mcwi lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y297Stop mutation is generated from the codon change TAC/TAA 2007-09-17 2007-09-17 2993 Lcat RGSC 3.4 19 35781507 35784966 - Lcatm5Mcwi
1642438 Lcatm5Mcwi lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y297Stop mutation is generated from the codon change TAC/TAA 2007-09-17 2007-09-17 2993 Lcat Rnor_5.0 19 48780364 48783830 - Lcatm5Mcwi
1642438 Lcatm5Mcwi lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y297Stop mutation is generated from the codon change TAC/TAA 2007-09-17 2007-09-17 2993 Lcat Rnor_6.0 19 37913333 37916799 - Lcatm5Mcwi
12910102 Ldlrem1 low density lipoprotein receptor; ZFN induced mutant 1 This allele possesses a 19-bp deletion in the seventh exon of the ldlr gene 2017-06-08 2017-06-08 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlrem1;Ldlrem1
12910102 Ldlrem1 low density lipoprotein receptor; ZFN induced mutant 1 This allele possesses a 19-bp deletion in the seventh exon of the ldlr gene 2017-06-08 2017-06-08 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlrem1;Ldlrem1
12910102 Ldlrem1 low density lipoprotein receptor; ZFN induced mutant 1 This allele possesses a 19-bp deletion in the seventh exon of the ldlr gene 2017-06-08 2017-06-08 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlrem1;Ldlrem1
150520193 Ldlrem1Dlli low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr. 2021-11-04 2021-11-04 2998 Ldlr RGSC 3.4 8 20824040 20846920 +
150520193 Ldlrem1Dlli low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr. 2021-11-04 2021-11-04 2998 Ldlr Rnor_5.0 8 22804325 22827199 +
150520193 Ldlrem1Dlli low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr. 2021-11-04 2021-11-04 2998 Ldlr Rnor_6.0 8 22750425 22773305 +
5144090 Ldlrem1Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlrem1Mcwi
5144090 Ldlrem1Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlrem1Mcwi
5144090 Ldlrem1Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlrem1Mcwi
12904909 Ldlrem1Sage low density lipoprotein receptor; ZFN induced mutant 1, Sage This allele possesses a 337 bp deletion and 4 bp insertion within Exon 4 of rat Ldlr gene 2017-05-24 2017-05-24 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlr tm1sage;low density lipoprotein receptor; endonuclease induced mutant 1, Sage;Ldlrem1Sage
12904909 Ldlrem1Sage low density lipoprotein receptor; ZFN induced mutant 1, Sage This allele possesses a 337 bp deletion and 4 bp insertion within Exon 4 of rat Ldlr gene 2017-05-24 2017-05-24 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlr tm1sage;low density lipoprotein receptor; endonuclease induced mutant 1, Sage;Ldlrem1Sage
12904909 Ldlrem1Sage low density lipoprotein receptor; ZFN induced mutant 1, Sage This allele possesses a 337 bp deletion and 4 bp insertion within Exon 4 of rat Ldlr gene 2017-05-24 2017-05-24 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlr tm1sage;low density lipoprotein receptor; endonuclease induced mutant 1, Sage;Ldlrem1Sage
5144094 Ldlrem2Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 123-bp frameshift deletion in exon 4 (del 536-658) 2011-07-29 2011-07-29 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlrem2Mcwi
5144094 Ldlrem2Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 123-bp frameshift deletion in exon 4 (del 536-658) 2011-07-29 2011-07-29 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlrem2Mcwi
5144094 Ldlrem2Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 123-bp frameshift deletion in exon 4 (del 536-658) 2011-07-29 2011-07-29 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlrem2Mcwi
5144082 Ldlrem3Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlrem3Mcwi
5144082 Ldlrem3Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlrem3Mcwi
5144082 Ldlrem3Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp frameshift deletion in exon 4 (del 647-659) 2011-07-29 2011-07-29 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlrem3Mcwi
5144075 Ldlrem4Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 653-665) 2011-07-29 2011-07-29 2998 Ldlr RGSC 3.4 8 20824040 20846920 + Ldlrem4Mcwi
5144075 Ldlrem4Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 653-665) 2011-07-29 2011-07-29 2998 Ldlr Rnor_5.0 8 22804325 22827199 + Ldlrem4Mcwi
5144075 Ldlrem4Mcwi low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 653-665) 2011-07-29 2011-07-29 2998 Ldlr Rnor_6.0 8 22750425 22773305 + Ldlrem4Mcwi
13210580 Lepem1 leptin; CRISPR/Cas9 induced mutant 1 This allele possesses a 3 bp deletion resulting in the deletion of isoleucine at position 14. 2017-09-05 2017-09-05 3000 Lep RGSC 3.4 4 55943837 55945938 + Lepem1
13210580 Lepem1 leptin; CRISPR/Cas9 induced mutant 1 This allele possesses a 3 bp deletion resulting in the deletion of isoleucine at position 14. 2017-09-05 2017-09-05 3000 Lep Rnor_5.0 4 56085079 56099209 + Lepem1
13210580 Lepem1 leptin; CRISPR/Cas9 induced mutant 1 This allele possesses a 3 bp deletion resulting in the deletion of isoleucine at position 14. 2017-09-05 2017-09-05 3000 Lep Rnor_6.0 4 56337695 56351818 + Lepem1
12904927 Lepem1Sage leptin; zinc finger nuclease induced mutant1, Sage This allele possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. 2017-05-26 2017-05-26 3000 Lep RGSC 3.4 4 55943837 55945938 + Lep tm1sage;Lepem1Sage
12904927 Lepem1Sage leptin; zinc finger nuclease induced mutant1, Sage This allele possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. 2017-05-26 2017-05-26 3000 Lep Rnor_5.0 4 56085079 56099209 + Lep tm1sage;Lepem1Sage
12904927 Lepem1Sage leptin; zinc finger nuclease induced mutant1, Sage This allele possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. 2017-05-26 2017-05-26 3000 Lep Rnor_6.0 4 56337695 56351818 + Lep tm1sage;Lepem1Sage
6484700 Lepem5Mcwi leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 118-130) 2012-07-02 2012-07-02 3000 Lep RGSC 3.4 4 55943837 55945938 + Lepem5Mcwi
6484700 Lepem5Mcwi leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 118-130) 2012-07-02 2012-07-02 3000 Lep Rnor_5.0 4 56085079 56099209 + Lepem5Mcwi
6484700 Lepem5Mcwi leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 118-130) 2012-07-02 2012-07-02 3000 Lep Rnor_6.0 4 56337695 56351818 + Lepem5Mcwi
12792963 Lepm1Kyo leptin; ENU induced mutant1, Kyo A nonsense mutation (Q92X) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc rats. 2017-03-17 2017-03-17 3000 Lep RGSC 3.4 4 55943837 55945938 + Lepm1Kyo
12792963 Lepm1Kyo leptin; ENU induced mutant1, Kyo A nonsense mutation (Q92X) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc rats. 2017-03-17 2017-03-17 3000 Lep Rnor_5.0 4 56085079 56099209 + Lepm1Kyo
12792963 Lepm1Kyo leptin; ENU induced mutant1, Kyo A nonsense mutation (Q92X) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc rats. 2017-03-17 2017-03-17 3000 Lep Rnor_6.0 4 56337695 56351818 + Lepm1Kyo
11570565 Leprcp leptin receptor;corpulent Nonsense mutation of leptin receptor gene identified in the obese spontaneously hypertensive Koletsky rat. The T to A transversion at 2289 results in premature stop at position 763. 2016-12-20 2016-12-20 3001 Lepr RGSC 3.4 5 122320075 122503449 fak;Leprcp
11570565 Leprcp leptin receptor;corpulent Nonsense mutation of leptin receptor gene identified in the obese spontaneously hypertensive Koletsky rat. The T to A transversion at 2289 results in premature stop at position 763. 2016-12-20 2016-12-20 3001 Lepr Rnor_5.0 5 124555678 124556585 + fak;Leprcp
11570565 Leprcp leptin receptor;corpulent Nonsense mutation of leptin receptor gene identified in the obese spontaneously hypertensive Koletsky rat. The T to A transversion at 2289 results in premature stop at position 763. 2016-12-20 2016-12-20 3001 Lepr Rnor_5.0 5 124380327 124525200 + fak;Leprcp
11570565 Leprcp leptin receptor;corpulent Nonsense mutation of leptin receptor gene identified in the obese spontaneously hypertensive Koletsky rat. The T to A transversion at 2289 results in premature stop at position 763. 2016-12-20 2016-12-20 3001 Lepr Rnor_6.0 5 120503475 120682281 + fak;Leprcp
12910515 Leprem1 leptin receptor; TALEN induced mutant 1 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. 2017-06-16 2017-06-16 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprem1
12910515 Leprem1 leptin receptor; TALEN induced mutant 1 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprem1
12910515 Leprem1 leptin receptor; TALEN induced mutant 1 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprem1
12910515 Leprem1 leptin receptor; TALEN induced mutant 1 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprem1
12910518 Leprem2 leptin receptor; TALEN induced mutant 2 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. 2017-06-16 2017-06-16 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprem2
12910518 Leprem2 leptin receptor; TALEN induced mutant 2 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprem2
12910518 Leprem2 leptin receptor; TALEN induced mutant 2 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprem2
12910518 Leprem2 leptin receptor; TALEN induced mutant 2 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. 2017-06-16 2017-06-16 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprem2
6484701 Leprem2Mcwi leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp deletion in exon 11 (del 2130-2145) 2012-07-02 2012-07-02 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprem2Mcwi
6484701 Leprem2Mcwi leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp deletion in exon 11 (del 2130-2145) 2012-07-02 2012-07-02 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprem2Mcwi
6484701 Leprem2Mcwi leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp deletion in exon 11 (del 2130-2145) 2012-07-02 2012-07-02 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprem2Mcwi
6484701 Leprem2Mcwi leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp deletion in exon 11 (del 2130-2145) 2012-07-02 2012-07-02 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprem2Mcwi
12910546 Leprem3 leptin receptor; TALEN induced mutant 3 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. 2017-06-19 2017-06-19 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprem3
12910546 Leprem3 leptin receptor; TALEN induced mutant 3 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. 2017-06-19 2017-06-19 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprem3
12910546 Leprem3 leptin receptor; TALEN induced mutant 3 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. 2017-06-19 2017-06-19 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprem3
12910546 Leprem3 leptin receptor; TALEN induced mutant 3 This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. 2017-06-19 2017-06-19 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprem3
21079476 Leprem4Lizh leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh The Lepr knockout mutation were generated by CRISPR/Cas9. The resulting mutaion is a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. 2020-02-18 2020-02-18 3001 Lepr RGSC 3.4 5 122320075 122503449
21079476 Leprem4Lizh leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh The Lepr knockout mutation were generated by CRISPR/Cas9. The resulting mutaion is a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. 2020-02-18 2020-02-18 3001 Lepr Rnor_5.0 5 124555678 124556585 +
21079476 Leprem4Lizh leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh The Lepr knockout mutation were generated by CRISPR/Cas9. The resulting mutaion is a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. 2020-02-18 2020-02-18 3001 Lepr Rnor_5.0 5 124380327 124525200 +
21079476 Leprem4Lizh leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh The Lepr knockout mutation were generated by CRISPR/Cas9. The resulting mutaion is a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. 2020-02-18 2020-02-18 3001 Lepr Rnor_6.0 5 120503475 120682281 +
13432153 Leprfa leptin receptor; fa mutant A missense mutation (an A to C conversion at nucleotide position 806) was found in the extracellular domain of all the isoforms in Zucker fatty (fa/fa) rats, which resulted in an amino acid change from Gln to Pro at + 269 (the Gln269Pro mutation). 2017-09-21 2017-09-21 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprfa
13432153 Leprfa leptin receptor; fa mutant A missense mutation (an A to C conversion at nucleotide position 806) was found in the extracellular domain of all the isoforms in Zucker fatty (fa/fa) rats, which resulted in an amino acid change from Gln to Pro at + 269 (the Gln269Pro mutation). 2017-09-21 2017-09-21 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprfa
13432153 Leprfa leptin receptor; fa mutant A missense mutation (an A to C conversion at nucleotide position 806) was found in the extracellular domain of all the isoforms in Zucker fatty (fa/fa) rats, which resulted in an amino acid change from Gln to Pro at + 269 (the Gln269Pro mutation). 2017-09-21 2017-09-21 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprfa
13432153 Leprfa leptin receptor; fa mutant A missense mutation (an A to C conversion at nucleotide position 806) was found in the extracellular domain of all the isoforms in Zucker fatty (fa/fa) rats, which resulted in an amino acid change from Gln to Pro at + 269 (the Gln269Pro mutation). 2017-09-21 2017-09-21 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprfa
9835400 Leprm1Rll leptin receptor; mutant 1, Rudolph L. Leibel This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 2015-03-24 2015-03-24 3001 Lepr RGSC 3.4 5 122320075 122503449 Leprm1Rll
9835400 Leprm1Rll leptin receptor; mutant 1, Rudolph L. Leibel This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 2015-03-24 2015-03-24 3001 Lepr Rnor_5.0 5 124555678 124556585 + Leprm1Rll
9835400 Leprm1Rll leptin receptor; mutant 1, Rudolph L. Leibel This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 2015-03-24 2015-03-24 3001 Lepr Rnor_5.0 5 124380327 124525200 + Leprm1Rll
9835400 Leprm1Rll leptin receptor; mutant 1, Rudolph L. Leibel This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 2015-03-24 2015-03-24 3001 Lepr Rnor_6.0 5 120503475 120682281 + Leprm1Rll
626419691 Lgals3em1Dfult galectin 3; endonuclease induced mutant 1, Dfult CRISPR technology was used on the Sprague-Dawley background (Sage) to edit Lgals3 genome. CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue 2025-09-05 2025-09-05 69356 Lgals3 RGSC 3.4 15 23327071 23339006
626419691 Lgals3em1Dfult galectin 3; endonuclease induced mutant 1, Dfult CRISPR technology was used on the Sprague-Dawley background (Sage) to edit Lgals3 genome. CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue 2025-09-05 2025-09-05 69356 Lgals3 Rnor_5.0 15 28094344 28106281 +
626419691 Lgals3em1Dfult galectin 3; endonuclease induced mutant 1, Dfult CRISPR technology was used on the Sprague-Dawley background (Sage) to edit Lgals3 genome. CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue 2025-09-05 2025-09-05 69356 Lgals3 Rnor_6.0 15 24153602 24165537 +
12792970 Lgi1m1Kyo leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo A missense mutation (c.1154 T > G,L385R) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc. 2017-03-17 2017-03-17 628742 Lgi1 RGSC 3.4 1 242593236 242634141 + Lgi1m1Kyo
12792970 Lgi1m1Kyo leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo A missense mutation (c.1154 T > G,L385R) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc. 2017-03-17 2017-03-17 628742 Lgi1 Rnor_5.0 1 264436441 264477332 + Lgi1m1Kyo
12792970 Lgi1m1Kyo leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo A missense mutation (c.1154 T > G,L385R) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc. 2017-03-17 2017-03-17 628742 Lgi1 Rnor_6.0 1 256955944 256996835 + Lgi1m1Kyo
2290096 Lims1Tn(sb-T2/Bart3)2.169Mcwi LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. 2008-02-26 2008-02-26 1560732 Lims1 RGSC 3.4 20 37349188 37397427 - transposon insertion 2.169, Medical College of Wisconsin;RGD1560732Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1;Lims1Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1 ; transposon insertion 2.169, Medical College of Wisconsin
2290096 Lims1Tn(sb-T2/Bart3)2.169Mcwi LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. 2008-02-26 2008-02-26 1560732 Lims1 Rnor_5.0 20 29715580 29824252 + transposon insertion 2.169, Medical College of Wisconsin;RGD1560732Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1;Lims1Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1 ; transposon insertion 2.169, Medical College of Wisconsin
2290096 Lims1Tn(sb-T2/Bart3)2.169Mcwi LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. 2008-02-26 2008-02-26 1560732 Lims1 Rnor_6.0 20 27895981 28004767 + transposon insertion 2.169, Medical College of Wisconsin;RGD1560732Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1;Lims1Tn(sb-T2/Bart3)2.169Mcwi;similar to LIM and senescent cell antigen-like domains 1 ; transposon insertion 2.169, Medical College of Wisconsin
150519893 Lipam1Hyo lipase A, lysosomal acid type; mutant1, Hyo This spontaneous mutant allele was identified in the ALD/Hyo rat which is a rat model for Wolman's disease.The Wolman rat Lipa cDNA had the same sequence as the wild type cDNA from the 5'-untranslated region to nt 1101, followed by a 60 bp replacement from nt 1102 to nt 1161 with poly A signal and a 3' 1.8 kb deletion. 2021-10-14 2021-10-14 3008 Lipa RGSC 3.4 1 238466493 238500195 - WRLAL
150519893 Lipam1Hyo lipase A, lysosomal acid type; mutant1, Hyo This spontaneous mutant allele was identified in the ALD/Hyo rat which is a rat model for Wolman's disease.The Wolman rat Lipa cDNA had the same sequence as the wild type cDNA from the 5'-untranslated region to nt 1101, followed by a 60 bp replacement from nt 1102 to nt 1161 with poly A signal and a 3' 1.8 kb deletion. 2021-10-14 2021-10-14 3008 Lipa Rnor_5.0 1 260038180 260091819 - WRLAL
150519893 Lipam1Hyo lipase A, lysosomal acid type; mutant1, Hyo This spontaneous mutant allele was identified in the ALD/Hyo rat which is a rat model for Wolman's disease.The Wolman rat Lipa cDNA had the same sequence as the wild type cDNA from the 5'-untranslated region to nt 1101, followed by a 60 bp replacement from nt 1102 to nt 1161 with poly A signal and a 3' 1.8 kb deletion. 2021-10-14 2021-10-14 3008 Lipa Rnor_6.0 1 252816536 252959348 - WRLAL
1581495 Lipem1Mcwi lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L347P mutation is generated from the codon change CTA/CCA 2006-10-06 2006-10-06 3010 Lipe RGSC 3.4 1 80663791 80682480 - Lipem1Mcwi
1581495 Lipem1Mcwi lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L347P mutation is generated from the codon change CTA/CCA 2006-10-06 2006-10-06 3010 Lipe Rnor_5.0 1 83511504 83530200 - Lipem1Mcwi
1581495 Lipem1Mcwi lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L347P mutation is generated from the codon change CTA/CCA 2006-10-06 2006-10-06 3010 Lipe Rnor_6.0 1 82248031 82266727 - Lipem1Mcwi
1642169 Lipem2Mcwi lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q52L mutation is generated from the codon change CTG/CAG 2007-09-06 2007-09-06 3010 Lipe RGSC 3.4 1 80663791 80682480 - Lipem2Mcwi
1642169 Lipem2Mcwi lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q52L mutation is generated from the codon change CTG/CAG 2007-09-06 2007-09-06 3010 Lipe Rnor_5.0 1 83511504 83530200 - Lipem2Mcwi
1642169 Lipem2Mcwi lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Q52L mutation is generated from the codon change CTG/CAG 2007-09-06 2007-09-06 3010 Lipe Rnor_6.0 1 82248031 82266727 - Lipem2Mcwi
2306701 LmlnTn(sb-T2/Bart3)2.322Mcwi leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene 2009-04-30 2009-04-30 1311465 Lmln RGSC 3.4 11 69481117 69547133 - LmlnTn(sb-T2/Bart3)2.322Mcwi
2306701 LmlnTn(sb-T2/Bart3)2.322Mcwi leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene 2009-04-30 2009-04-30 1311465 Lmln Rnor_5.0 11 73980288 74048100 - LmlnTn(sb-T2/Bart3)2.322Mcwi
2306701 LmlnTn(sb-T2/Bart3)2.322Mcwi leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene 2009-04-30 2009-04-30 1311465 Lmln Rnor_6.0 11 70895141 70963121 - LmlnTn(sb-T2/Bart3)2.322Mcwi
126848739 Lpar1m1Hubr lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr This allele carried an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. This allele was identified from target-selected ENU-driven mutagenesis of male MSH6 knockout rats. 2021-04-28 2021-04-28 620563 Lpar1 RGSC 3.4 5 76449470 76571458 -
126848739 Lpar1m1Hubr lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr This allele carried an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. This allele was identified from target-selected ENU-driven mutagenesis of male MSH6 knockout rats. 2021-04-28 2021-04-28 620563 Lpar1 Rnor_5.0 5 79707131 79825313 -
126848739 Lpar1m1Hubr lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr This allele carried an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. This allele was identified from target-selected ENU-driven mutagenesis of male MSH6 knockout rats. 2021-04-28 2021-04-28 620563 Lpar1 Rnor_6.0 5 75557038 75678067 -
6484709 Lpin1em1Mcwi lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp deletion in exon 3 (del 719-722) 2012-07-02 2012-07-02 1307646 Lpin1 RGSC 3.4 6 40253664 40297195 - Lpin1em1Mcwi
6484709 Lpin1em1Mcwi lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp deletion in exon 3 (del 719-722) 2012-07-02 2012-07-02 1307646 Lpin1 Rnor_5.0 6 51532422 51638090 - Lpin1em1Mcwi
6484709 Lpin1em1Mcwi lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp deletion in exon 3 (del 719-722) 2012-07-02 2012-07-02 1307646 Lpin1 Rnor_6.0 6 41796214 41905149 - Lpin1em1Mcwi
38599153 Lpin1m1Hubr lipin 1; ENU induced mutant 1, Hubr The mutation in Crl: Wistar was created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5′-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. 2020-09-11 2020-09-11 1307646 Lpin1 RGSC 3.4 6 40253664 40297195 -
38599153 Lpin1m1Hubr lipin 1; ENU induced mutant 1, Hubr The mutation in Crl: Wistar was created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5′-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. 2020-09-11 2020-09-11 1307646 Lpin1 Rnor_5.0 6 51532422 51638090 -
38599153 Lpin1m1Hubr lipin 1; ENU induced mutant 1, Hubr The mutation in Crl: Wistar was created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5′-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. 2020-09-11 2020-09-11 1307646 Lpin1 Rnor_6.0 6 41796214 41905149 -
11561896 Lrapem1Geh locus regulating alcohol preference; CRISPR/Cas9 system induced mutant 1,Geh The CRISPR/Cas9 genome editing system was used to create a 618-bp deletion in rat Lrap (RGD:7734862) gene. 2016-11-10 2016-11-10 7734862 Lrap Rnor_5.0 12 40910874 40918231 - locus regulating alcohol preference, CRISPR/Cas9 system induced mutant 1,Geh;Lrapem1Geh
11561896 Lrapem1Geh locus regulating alcohol preference; CRISPR/Cas9 system induced mutant 1,Geh The CRISPR/Cas9 genome editing system was used to create a 618-bp deletion in rat Lrap (RGD:7734862) gene. 2016-11-10 2016-11-10 7734862 Lrap Rnor_6.0 12 39016258 39017876 - locus regulating alcohol preference, CRISPR/Cas9 system induced mutant 1,Geh;Lrapem1Geh
41404647 Lrp5em1Vari LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 RGSC 3.4 1 206102750 206206350 -
41404647 Lrp5em1Vari LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_5.0 1 225689353 225793075 -
41404647 Lrp5em1Vari LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_6.0 1 218816833 218920147 -
41404650 Lrp5em2Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 RGSC 3.4 1 206102750 206206350 - LDL receptor related protein 5;CRISPR/Cas9 induced mutant 2, Vari
41404650 Lrp5em2Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_5.0 1 225689353 225793075 - LDL receptor related protein 5;CRISPR/Cas9 induced mutant 2, Vari
41404650 Lrp5em2Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_6.0 1 218816833 218920147 - LDL receptor related protein 5;CRISPR/Cas9 induced mutant 2, Vari
41404652 Lrp5em3Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 RGSC 3.4 1 206102750 206206350 -
41404652 Lrp5em3Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_5.0 1 225689353 225793075 -
41404652 Lrp5em3Vari LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 2021-01-29 2021-01-29 1309329 Lrp5 Rnor_6.0 1 218816833 218920147 -
2299107 Lrrc4cTn(sb-T2/Bart3)2.224Mcwi leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene 2008-08-12 2008-08-12 1311013 Lrrc4c RGSC 3.4 3 80921606 82413671 + Lrrc4cTn(sb-T2/Bart3)2.224Mcwi
2299107 Lrrc4cTn(sb-T2/Bart3)2.224Mcwi leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene 2008-08-12 2008-08-12 1311013 Lrrc4c Rnor_5.0 3 92537591 92682037 + Lrrc4cTn(sb-T2/Bart3)2.224Mcwi
2299107 Lrrc4cTn(sb-T2/Bart3)2.224Mcwi leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene 2008-08-12 2008-08-12 1311013 Lrrc4c Rnor_5.0 3 93268661 93502229 + Lrrc4cTn(sb-T2/Bart3)2.224Mcwi
2299107 Lrrc4cTn(sb-T2/Bart3)2.224Mcwi leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene 2008-08-12 2008-08-12 1311013 Lrrc4c Rnor_5.0 3 92119546 92392069 + Lrrc4cTn(sb-T2/Bart3)2.224Mcwi
2299107 Lrrc4cTn(sb-T2/Bart3)2.224Mcwi leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene 2008-08-12 2008-08-12 1311013 Lrrc4c Rnor_6.0 3 85421169 86821783 + Lrrc4cTn(sb-T2/Bart3)2.224Mcwi
2301076 Lrrc4cTn(sb-T2/Bart3)2.254Mcwi leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene 2008-09-25 2008-09-25 1311013 Lrrc4c RGSC 3.4 3 80921606 82413671 + Lrrc4cTn(sb-T2/Bart3)2.254Mcwi
2301076 Lrrc4cTn(sb-T2/Bart3)2.254Mcwi leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene 2008-09-25 2008-09-25 1311013 Lrrc4c Rnor_5.0 3 92119546 92392069 + Lrrc4cTn(sb-T2/Bart3)2.254Mcwi
2301076 Lrrc4cTn(sb-T2/Bart3)2.254Mcwi leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene 2008-09-25 2008-09-25 1311013 Lrrc4c Rnor_5.0 3 93268661 93502229 + Lrrc4cTn(sb-T2/Bart3)2.254Mcwi
2301076 Lrrc4cTn(sb-T2/Bart3)2.254Mcwi leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene 2008-09-25 2008-09-25 1311013 Lrrc4c Rnor_5.0 3 92537591 92682037 + Lrrc4cTn(sb-T2/Bart3)2.254Mcwi
2301076 Lrrc4cTn(sb-T2/Bart3)2.254Mcwi leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene 2008-09-25 2008-09-25 1311013 Lrrc4c Rnor_6.0 3 85421169 86821783 + Lrrc4cTn(sb-T2/Bart3)2.254Mcwi
2301078 Lrrc7Tn(sb-T2/Bart3)2.253Mcwi leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7 gene 2008-09-25 2008-09-25 708527 Lrrc7 RGSC 3.4 2 256228792 256644029 - Lrrc7Tn(sb-T2/Bart3)2.253Mcwi
2301078 Lrrc7Tn(sb-T2/Bart3)2.253Mcwi leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7 gene 2008-09-25 2008-09-25 708527 Lrrc7 Rnor_5.0 2 283549882 283934360 - Lrrc7Tn(sb-T2/Bart3)2.253Mcwi
2301078 Lrrc7Tn(sb-T2/Bart3)2.253Mcwi leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7 gene 2008-09-25 2008-09-25 708527 Lrrc7 Rnor_6.0 2 264910594 265300860 - Lrrc7Tn(sb-T2/Bart3)2.253Mcwi
7241044 Lrrk1em1Sage leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 4 (TGCCTCGCAGCGGCTGCTG) 2013-02-25 2013-02-25 1308000 Lrrk1 RGSC 3.4 1 120695657 120836324 - Lrrk1em1Sage
7241044 Lrrk1em1Sage leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 4 (TGCCTCGCAGCGGCTGCTG) 2013-02-25 2013-02-25 1308000 Lrrk1 Rnor_5.0 1 128248473 128372456 - Lrrk1em1Sage
7241044 Lrrk1em1Sage leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 4 (TGCCTCGCAGCGGCTGCTG) 2013-02-25 2013-02-25 1308000 Lrrk1 Rnor_6.0 1 127166866 127301053 - Lrrk1em1Sage
7241045 Lrrk2em1Sage leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 30 (CCCAGAGAGC) 2013-02-25 2013-02-25 1561168 Lrrk2 RGSC 3.4 7 130105902 130267747 + Lrrk2em1Sage
7241045 Lrrk2em1Sage leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 30 (CCCAGAGAGC) 2013-02-25 2013-02-25 1561168 Lrrk2 Rnor_5.0 7 132531591 132694226 + Lrrk2em1Sage
7241045 Lrrk2em1Sage leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 30 (CCCAGAGAGC) 2013-02-25 2013-02-25 1561168 Lrrk2 Rnor_6.0 7 132857311 133018549 + Lrrk2em1Sage
6484706 Lssem2Mcwi lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg) 2012-07-02 2012-07-02 620955 Lss RGSC 3.4 20 12507575 12534612 - Lssem2Mcwi
6484706 Lssem2Mcwi lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg) 2012-07-02 2012-07-02 620955 Lss Rnor_5.0 20 15337114 15338473 - Lssem2Mcwi
6484706 Lssem2Mcwi lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg) 2012-07-02 2012-07-02 620955 Lss Rnor_5.0 20 15000298 15027581 - Lssem2Mcwi
6484706 Lssem2Mcwi lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg) 2012-07-02 2012-07-02 620955 Lss Rnor_6.0 20 12844522 12870474 - Lssem2Mcwi
2304196 LzicTn(sb-T2/Bart3)2.309Mcwi leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene 2009-03-10 2009-03-10 1309253 Lzic RGSC 3.4 5 166567412 166579423 + LzicTn(sb-T2/Bart3)2.309Mcwi
2304196 LzicTn(sb-T2/Bart3)2.309Mcwi leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene 2009-03-10 2009-03-10 1309253 Lzic Rnor_5.0 5 170076617 170089776 + LzicTn(sb-T2/Bart3)2.309Mcwi
2304196 LzicTn(sb-T2/Bart3)2.309Mcwi leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene 2009-03-10 2009-03-10 1309253 Lzic Rnor_6.0 5 166430305 166443485 + LzicTn(sb-T2/Bart3)2.309Mcwi
1578796 Maddm1Mcwi MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G120R mutation is generated 2006-05-02 2006-05-02 619922 Madd RGSC 3.4 3 75498321 75541073 - Maddm1Mcwi
1578796 Maddm1Mcwi MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G120R mutation is generated 2006-05-02 2006-05-02 619922 Madd Rnor_5.0 3 86669054 86711776 - Maddm1Mcwi
1578796 Maddm1Mcwi MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G120R mutation is generated 2006-05-02 2006-05-02 619922 Madd Rnor_6.0 3 79960301 80003023 - Maddm1Mcwi
2290117 Map2k5Tn(sb-T2/Bart3)2.150Mcwi mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. 2008-02-26 2008-02-26 61890 Map2k5 RGSC 3.4 8 67313472 67542723 - Map2k5Tn(sb-T2/Bart3)2.150Mcwi
2290117 Map2k5Tn(sb-T2/Bart3)2.150Mcwi mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. 2008-02-26 2008-02-26 61890 Map2k5 Rnor_5.0 8 67784868 68010809 - Map2k5Tn(sb-T2/Bart3)2.150Mcwi
2290117 Map2k5Tn(sb-T2/Bart3)2.150Mcwi mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. 2008-02-26 2008-02-26 61890 Map2k5 Rnor_6.0 8 68055976 68282656 - Map2k5Tn(sb-T2/Bart3)2.150Mcwi
5131946 Mas1em1Mcwi MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 601-610). 2011-05-17 2011-05-17 3049 Mas1 RGSC 3.4 1 42154786 42185750 + Mas1em1Mcwi
5131946 Mas1em1Mcwi MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 601-610). 2011-05-17 2011-05-17 3049 Mas1 Rnor_5.0 1 51644462 51675365 - Mas1em1Mcwi
5131946 Mas1em1Mcwi MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 601-610). 2011-05-17 2011-05-17 3049 Mas1 Rnor_6.0 1 48076761 48108218 + Mas1em1Mcwi
12790663 Mbem6Mcwi myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in exon 2 of the Mb gene. 2017-02-20 2017-02-20 620411 Mb RGSC 3.4 7 115087558 115094789 - Mbem6Mcwi
12790663 Mbem6Mcwi myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in exon 2 of the Mb gene. 2017-02-20 2017-02-20 620411 Mb Rnor_5.0 7 118094391 118101622 - Mbem6Mcwi
12790663 Mbem6Mcwi myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in exon 2 of the Mb gene. 2017-02-20 2017-02-20 620411 Mb Rnor_6.0 7 118101633 118108864 - Mbem6Mcwi
12802351 Mbpmd myelin basic protein; myelin deficient A naturally occurring Mbp insertion mutation found in the Long Evans shaker rats. It is caused by the insertion of an endogenous retrotransposon [early transposons (ETn) element] into a noncoding region (intron 3) of the gene. The ETn element alters the normal splicing dynamics of MBP mRNA, leading to a dramatic reduction in the levels of full-length isoforms and the appearance of improperly spliced, chimeric transcripts. 2017-04-05 2017-04-05 3054 Mbp RGSC 3.4 18 78943608 79057329 + Mbpmd
12802351 Mbpmd myelin basic protein; myelin deficient A naturally occurring Mbp insertion mutation found in the Long Evans shaker rats. It is caused by the insertion of an endogenous retrotransposon [early transposons (ETn) element] into a noncoding region (intron 3) of the gene. The ETn element alters the normal splicing dynamics of MBP mRNA, leading to a dramatic reduction in the levels of full-length isoforms and the appearance of improperly spliced, chimeric transcripts. 2017-04-05 2017-04-05 3054 Mbp Rnor_5.0 18 78385304 78504226 + Mbpmd
12802351 Mbpmd myelin basic protein; myelin deficient A naturally occurring Mbp insertion mutation found in the Long Evans shaker rats. It is caused by the insertion of an endogenous retrotransposon [early transposons (ETn) element] into a noncoding region (intron 3) of the gene. The ETn element alters the normal splicing dynamics of MBP mRNA, leading to a dramatic reduction in the levels of full-length isoforms and the appearance of improperly spliced, chimeric transcripts. 2017-04-05 2017-04-05 3054 Mbp Rnor_6.0 18 79326738 79437310 + Mbpmd
13825200 Mc4rm1Hubr melanocortin 4 receptor; ENU induced mutation 1, Hubr The Mc4r mutation was generated by target-selected ENU-driven mutagenesis and high-throughput resequencing of genomic sequences in Crl:Wistar background. The mutation was identified as revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. 2018-11-29 2018-11-29 3057 Mc4r RGSC 3.4 18 63390922 63392809 -
13825200 Mc4rm1Hubr melanocortin 4 receptor; ENU induced mutation 1, Hubr The Mc4r mutation was generated by target-selected ENU-driven mutagenesis and high-throughput resequencing of genomic sequences in Crl:Wistar background. The mutation was identified as revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. 2018-11-29 2018-11-29 3057 Mc4r Rnor_5.0 18 61799166 61801053 -
13825200 Mc4rm1Hubr melanocortin 4 receptor; ENU induced mutation 1, Hubr The Mc4r mutation was generated by target-selected ENU-driven mutagenesis and high-throughput resequencing of genomic sequences in Crl:Wistar background. The mutation was identified as revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. 2018-11-29 2018-11-29 3057 Mc4r Rnor_6.0 18 62612838 62614725 -
11568035 Mecp2em1Sage methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. The resulting mutation was a knockout of the methyl CpG binding protein 2 (Mecp2) demonstrated by western blot. 2016-12-06 2016-12-06 3075 Mecp2 RGSC 3.4 X 159980599 160035260 - methyl CpG binding protein 2;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Mecp2em1Sage
11568035 Mecp2em1Sage methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. The resulting mutation was a knockout of the methyl CpG binding protein 2 (Mecp2) demonstrated by western blot. 2016-12-06 2016-12-06 3075 Mecp2 Rnor_5.0 1 152390961 152461647 + methyl CpG binding protein 2;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Mecp2em1Sage
11568035 Mecp2em1Sage methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. The resulting mutation was a knockout of the methyl CpG binding protein 2 (Mecp2) demonstrated by western blot. 2016-12-06 2016-12-06 3075 Mecp2 Rnor_6.0 X 156650389 156713813 + methyl CpG binding protein 2;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs;Mecp2em1Sage
40902839 Mertkrdy MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant A small deletion of DNA that disrupts the gene encoding the receptor tyrosine kinase Mertk was detected in the retinal dystrophy RCS/LavRrrc. The deletion includes the splice acceptor site upstream of the second coding exon of Mertk and results in a shortened transcript that lacks this exon. The aberrant transcript joins the first and third coding exons, leading to a frameshift and a translation termination signal 20 codons after the AUG. 2020-12-14 2020-12-14 69283 Mertk RGSC 3.4 3 116308387 116416414 +
40902839 Mertkrdy MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant A small deletion of DNA that disrupts the gene encoding the receptor tyrosine kinase Mertk was detected in the retinal dystrophy RCS/LavRrrc. The deletion includes the splice acceptor site upstream of the second coding exon of Mertk and results in a shortened transcript that lacks this exon. The aberrant transcript joins the first and third coding exons, leading to a frameshift and a translation termination signal 20 codons after the AUG. 2020-12-14 2020-12-14 69283 Mertk Rnor_5.0 3 128669534 128777078 -
40902839 Mertkrdy MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant A small deletion of DNA that disrupts the gene encoding the receptor tyrosine kinase Mertk was detected in the retinal dystrophy RCS/LavRrrc. The deletion includes the splice acceptor site upstream of the second coding exon of Mertk and results in a shortened transcript that lacks this exon. The aberrant transcript joins the first and third coding exons, leading to a frameshift and a translation termination signal 20 codons after the AUG. 2020-12-14 2020-12-14 69283 Mertk Rnor_6.0 3 121235230 121340932 +
11568072 Metem1Sage MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. 2016-12-07 2016-12-07 3082 Met RGSC 3.4 4 43134183 43211355 + Mettm1Sage;Metem1Sage
11568072 Metem1Sage MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. 2016-12-07 2016-12-07 3082 Met Rnor_5.0 4 45354290 45461638 + Mettm1Sage;Metem1Sage
11568072 Metem1Sage MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. 2016-12-07 2016-12-07 3082 Met Rnor_6.0 4 44747467 44854628 + Mettm1Sage;Metem1Sage
2299106 Mgat4cTn(sb-T2/Bart3)2.244Mcwi mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. 2008-08-12 2008-08-12 1307871 Mgat4c RGSC 3.4 7 40171454 40383441 + Mgat4cTn(sb-T2/Bart3)2.244Mcwi
2299106 Mgat4cTn(sb-T2/Bart3)2.244Mcwi mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. 2008-08-12 2008-08-12 1307871 Mgat4c Rnor_5.0 7 43829446 44052611 + Mgat4cTn(sb-T2/Bart3)2.244Mcwi
2299106 Mgat4cTn(sb-T2/Bart3)2.244Mcwi mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. 2008-08-12 2008-08-12 1307871 Mgat4c Rnor_6.0 7 43249369 44024278 + Mgat4cTn(sb-T2/Bart3)2.244Mcwi
152600899 Mir146bem1Mcwi microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. 2022-05-25 2022-05-25 2314885 Mir146b RGSC 3.4 1 251558047 251558134 +
152600899 Mir146bem1Mcwi microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. 2022-05-25 2022-05-25 2314885 Mir146b Rnor_5.0 1 273520429 273520516 +
152600899 Mir146bem1Mcwi microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. 2022-05-25 2022-05-25 2314885 Mir146b Rnor_6.0 1 266089488 266089575 +
11073608 Mir29b1em1Mcwi microRNA 29b-1; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagenesis. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence 2016-04-29 2016-04-29 2325591 Mir29b1 Rnor_5.0 4 58100053 58100133 - Mir29b1em1Mcwi
11073608 Mir29b1em1Mcwi microRNA 29b-1; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagenesis. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence 2016-04-29 2016-04-29 2325591 Mir29b1 Rnor_6.0 4 58344310 58344390 - Mir29b1em1Mcwi
405850242 Mir500 em1Cgen microRNA 500 This Mir500 allele carrying a 8-bp deletion (GCACCTGG) was generated in the Sprague Dawley embryo using TALENs system. 2024-06-04 2024-06-04 2325495 Mir500 Rnor_5.0 X 16906456 16906535 +
405850242 Mir500 em1Cgen microRNA 500 This Mir500 allele carrying a 8-bp deletion (GCACCTGG) was generated in the Sprague Dawley embryo using TALENs system. 2024-06-04 2024-06-04 2325495 Mir500 Rnor_6.0 X 16121332 16121411 +
126777685 Mkxem1Asah mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out allele with 14- bp deletion causing frameshift mutation in the gene. 2021-04-07 2021-04-07 1305652 Mkx RGSC 3.4 17 63631540 63710138 -
126777685 Mkxem1Asah mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out allele with 14- bp deletion causing frameshift mutation in the gene. 2021-04-07 2021-04-07 1305652 Mkx Rnor_5.0 17 62321329 62332471 +
126777685 Mkxem1Asah mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out allele with 14- bp deletion causing frameshift mutation in the gene. 2021-04-07 2021-04-07 1305652 Mkx Rnor_6.0 17 60537615 60553284 +
2301077 Mmel1Tn(sb-T2/Bart3)2.255Mcwi membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1 gene 2008-09-25 2008-09-25 1309299 Mmel1 RGSC 3.4 5 171675007 171703353 + Mmel1Tn(sb-T2/Bart3)2.255Mcwi
2301077 Mmel1Tn(sb-T2/Bart3)2.255Mcwi membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1 gene 2008-09-25 2008-09-25 1309299 Mmel1 Rnor_5.0 5 175729143 175759868 + Mmel1Tn(sb-T2/Bart3)2.255Mcwi
2301077 Mmel1Tn(sb-T2/Bart3)2.255Mcwi membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1 gene 2008-09-25 2008-09-25 1309299 Mmel1 Rnor_6.0 5 172273450 172303905 + Mmel1Tn(sb-T2/Bart3)2.255Mcwi
12910500 Mmp12em1Soar matrix metallopeptidase 12; TALEN induced mutant 1,Soar The TALEN genome editing system caused a 664-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 RGSC 3.4 8 4249938 4259675 + Mmp12em1Soar
12910500 Mmp12em1Soar matrix metallopeptidase 12; TALEN induced mutant 1,Soar The TALEN genome editing system caused a 664-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 Rnor_5.0 8 5610392 5620294 + Mmp12em1Soar
12910500 Mmp12em1Soar matrix metallopeptidase 12; TALEN induced mutant 1,Soar The TALEN genome editing system caused a 664-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 Rnor_6.0 8 5594717 5616494 + Mmp12em1Soar
12910506 Mmp12em2Soar matrix metallopeptidase 12; TALEN induced mutant 2,Soar The TALEN genome editing system caused a 607-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 RGSC 3.4 8 4249938 4259675 + Mmp12em2Soar
12910506 Mmp12em2Soar matrix metallopeptidase 12; TALEN induced mutant 2,Soar The TALEN genome editing system caused a 607-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 Rnor_5.0 8 5610392 5620294 + Mmp12em2Soar
12910506 Mmp12em2Soar matrix metallopeptidase 12; TALEN induced mutant 2,Soar The TALEN genome editing system caused a 607-bp deletion in the exon 2 of rat Mmp12 2017-06-16 2017-06-16 620195 Mmp12 Rnor_6.0 8 5594717 5616494 + Mmp12em2Soar
4139860 Mmp2em1Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1434-1443). 2010-08-19 2025-08-14 621316 Mmp2 RGSC 3.4 19 15246036 15275061 - Mmp2em1Mcwi
4139860 Mmp2em1Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1434-1443). 2010-08-19 2025-08-14 621316 Mmp2 Rnor_5.0 19 26629728 26658966 - Mmp2em1Mcwi
4139860 Mmp2em1Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1434-1443). 2010-08-19 2025-08-14 621316 Mmp2 Rnor_6.0 19 15542771 15570589 - Mmp2em1Mcwi
4139869 Mmp2em2Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 8-bp frameshift deletion in exon 7 (del 1433-1440). 2010-08-19 2020-11-16 621316 Mmp2 RGSC 3.4 19 15246036 15275061 - Mmp2em2Mcwi
4139869 Mmp2em2Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 8-bp frameshift deletion in exon 7 (del 1433-1440). 2010-08-19 2020-11-16 621316 Mmp2 Rnor_5.0 19 26629728 26658966 - Mmp2em2Mcwi
4139869 Mmp2em2Mcwi matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 8-bp frameshift deletion in exon 7 (del 1433-1440). 2010-08-19 2020-11-16 621316 Mmp2 Rnor_6.0 19 15542771 15570589 - Mmp2em2Mcwi
12743378 Mmp9em4Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. 2017-02-07 2017-02-07 621320 Mmp9 RGSC 3.4 3 155985473 155993433 +
12743378 Mmp9em4Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. 2017-02-07 2017-02-07 621320 Mmp9 Rnor_5.0 3 167578904 167605890 +
12743378 Mmp9em4Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. 2017-02-07 2017-02-07 621320 Mmp9 Rnor_6.0 3 161413410 161421473 +
10054415 Mmp9em6Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This delins allele was made by CRISPR/Cas9 system.The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8. 2015-08-05 2016-10-06 621320 Mmp9 RGSC 3.4 3 155985473 155993433 + Mmp9em6Mcwi
10054415 Mmp9em6Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This delins allele was made by CRISPR/Cas9 system.The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8. 2015-08-05 2016-10-06 621320 Mmp9 Rnor_5.0 3 167578904 167605890 + Mmp9em6Mcwi
10054415 Mmp9em6Mcwi matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This delins allele was made by CRISPR/Cas9 system.The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8. 2015-08-05 2016-10-06 621320 Mmp9 Rnor_6.0 3 161413410 161421473 + Mmp9em6Mcwi
2302647 Mov10Tn(sb-T2/Bart3)2.281Mcwi Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene 2009-01-06 2009-01-06 1598327 Mov10 RGSC 3.4 2 200053185 200075536 - Mov10Tn(sb-T2/Bart3)2.281Mcwi
2302647 Mov10Tn(sb-T2/Bart3)2.281Mcwi Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene 2009-01-06 2009-01-06 1598327 Mov10 Rnor_5.0 2 226696252 226717551 - Mov10Tn(sb-T2/Bart3)2.281Mcwi
2302647 Mov10Tn(sb-T2/Bart3)2.281Mcwi Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene 2009-01-06 2009-01-06 1598327 Mov10 Rnor_6.0 2 207277088 207301245 - Mov10Tn(sb-T2/Bart3)2.281Mcwi
632518399 Mpoem1Lempo myeloperoxidase; CRISPR/SpCas9 induced mutant1, Lempo The CRISPR/Cas9 system was multiplexed to introduce a double strand brake at exon 3 and 14 to promote the removal of majority of the MPO gene in rat embryos. 2026-02-12 2026-02-12 1592081 Mpo RGSC 3.4 10 76085872 76097012 +
632518399 Mpoem1Lempo myeloperoxidase; CRISPR/SpCas9 induced mutant1, Lempo The CRISPR/Cas9 system was multiplexed to introduce a double strand brake at exon 3 and 14 to promote the removal of majority of the MPO gene in rat embryos. 2026-02-12 2026-02-12 1592081 Mpo Rnor_5.0 10 75004128 75014496 -
632518399 Mpoem1Lempo myeloperoxidase; CRISPR/SpCas9 induced mutant1, Lempo The CRISPR/Cas9 system was multiplexed to introduce a double strand brake at exon 3 and 14 to promote the removal of majority of the MPO gene in rat embryos. 2026-02-12 2026-02-12 1592081 Mpo Rnor_6.0 10 75087892 75098260 +
401717573 Mpoem1Mcwi myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi CRISPR/SpCas9 system was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in the Crl:SD embryo. 2023-08-07 2023-08-07 1592081 Mpo RGSC 3.4 10 76085872 76097012 + Mpo em1Mcwi
401717573 Mpoem1Mcwi myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi CRISPR/SpCas9 system was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in the Crl:SD embryo. 2023-08-07 2023-08-07 1592081 Mpo Rnor_5.0 10 75004128 75014496 - Mpo em1Mcwi
401717573 Mpoem1Mcwi myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi CRISPR/SpCas9 system was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in the Crl:SD embryo. 2023-08-07 2023-08-07 1592081 Mpo Rnor_6.0 10 75087892 75098260 + Mpo em1Mcwi
10054418 Mrpl28em1Mcwi mitochondrial ribosomal protein L28; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene 2015-08-05 2016-10-19 1583741 Mrpl28 RGSC 3.4 10 15394360 15397270 + Mrpl28em1Mcwi
10054418 Mrpl28em1Mcwi mitochondrial ribosomal protein L28; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene 2015-08-05 2016-10-19 1583741 Mrpl28 Rnor_5.0 10 15309316 15312227 + Mrpl28em1Mcwi
10054418 Mrpl28em1Mcwi mitochondrial ribosomal protein L28; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene 2015-08-05 2016-10-19 1583741 Mrpl28 Rnor_6.0 10 15495616 15498527 + Mrpl28em1Mcwi
12793071 Mrs2dmyKyo MRS2 magnesium transporter; demyelination mutant, Kyo This allele is a spontaneous missense mutation found in a closed colony of Sprague Dawley (SD) rats. A G-to-A mutation in intron was very likely causative of the mutant phenotype. 2017-03-20 2018-05-24 708529 Mrs2 RGSC 3.4 17 47124915 47142840 + Mrs2DMYKyo
12793071 Mrs2dmyKyo MRS2 magnesium transporter; demyelination mutant, Kyo This allele is a spontaneous missense mutation found in a closed colony of Sprague Dawley (SD) rats. A G-to-A mutation in intron was very likely causative of the mutant phenotype. 2017-03-20 2018-05-24 708529 Mrs2 Rnor_5.0 17 43932146 43951399 + Mrs2DMYKyo
12793071 Mrs2dmyKyo MRS2 magnesium transporter; demyelination mutant, Kyo This allele is a spontaneous missense mutation found in a closed colony of Sprague Dawley (SD) rats. A G-to-A mutation in intron was very likely causative of the mutant phenotype. 2017-03-20 2018-05-24 708529 Mrs2 Rnor_6.0 17 42064271 42083602 + Mrs2DMYKyo
126848738 Msh6m1Hubr mutS homolog 6; ENU induced mutant 1, Hubr The Msh6 knockout allele was generated by ENU-driven mutagenesis on Crl:WI rats. The allele carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene. 2021-04-28 2021-04-28 2322311 Msh6 RGSC 3.4 6 11525292 11542592 +
126848738 Msh6m1Hubr mutS homolog 6; ENU induced mutant 1, Hubr The Msh6 knockout allele was generated by ENU-driven mutagenesis on Crl:WI rats. The allele carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene. 2021-04-28 2021-04-28 2322311 Msh6 Rnor_5.0 6 21616672 21634338 +
126848738 Msh6m1Hubr mutS homolog 6; ENU induced mutant 1, Hubr The Msh6 knockout allele was generated by ENU-driven mutagenesis on Crl:WI rats. The allele carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene. 2021-04-28 2021-04-28 2322311 Msh6 Rnor_6.0 6 11644565 11662389 +
5131945 Msraem3Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 1 (del 85-102). 2011-05-17 2011-05-17 70979 Msra RGSC 3.4 15 43509775 43756283 - Msraem1Mcwi;Msraem3Mcwi
5131945 Msraem3Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 1 (del 85-102). 2011-05-17 2011-05-17 70979 Msra Rnor_5.0 15 51307920 51550758 - Msraem1Mcwi;Msraem3Mcwi
5131945 Msraem3Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 1 (del 85-102). 2011-05-17 2011-05-17 70979 Msra Rnor_6.0 15 47488333 47800662 - Msraem1Mcwi;Msraem3Mcwi
5509977 Msraem4Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 1-bp frameshift deletion in exon 1 (del 95-99, ins cttc) 2011-11-16 2011-11-16 70979 Msra RGSC 3.4 15 43509775 43756283 - Msraem4Mcwi
5509977 Msraem4Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 1-bp frameshift deletion in exon 1 (del 95-99, ins cttc) 2011-11-16 2011-11-16 70979 Msra Rnor_5.0 15 51307920 51550758 - Msraem4Mcwi
5509977 Msraem4Mcwi methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 1-bp frameshift deletion in exon 1 (del 95-99, ins cttc) 2011-11-16 2011-11-16 70979 Msra Rnor_6.0 15 47488333 47800662 - Msraem4Mcwi
151347430 Mstnem1Cqin myostatin; ZFN induced mutant 1, Cqin A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). 2022-01-20 2022-01-20 3115 Mstn RGSC 3.4 9 45426831 45431658 -
151347430 Mstnem1Cqin myostatin; ZFN induced mutant 1, Cqin A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). 2022-01-20 2022-01-20 3115 Mstn Rnor_5.0 9 52977371 52982198 -
151347430 Mstnem1Cqin myostatin; ZFN induced mutant 1, Cqin A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). 2022-01-20 2022-01-20 3115 Mstn Rnor_6.0 9 53310977 53315804 -
5143964 Mstnem1Mcwi myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation deletes part of exon 2 and its splice acceptor (v3.4 del 45429512-45429528) 2011-07-27 2011-07-27 3115 Mstn RGSC 3.4 9 45426831 45431658 - Mstnem1Mcwi
5143964 Mstnem1Mcwi myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation deletes part of exon 2 and its splice acceptor (v3.4 del 45429512-45429528) 2011-07-27 2011-07-27 3115 Mstn Rnor_5.0 9 52977371 52982198 - Mstnem1Mcwi
5143964 Mstnem1Mcwi myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation deletes part of exon 2 and its splice acceptor (v3.4 del 45429512-45429528) 2011-07-27 2011-07-27 3115 Mstn Rnor_6.0 9 53310977 53315804 - Mstnem1Mcwi
5131949 Mstnem2Mcwi myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 2 (del 381-398). 2011-05-17 2011-05-17 3115 Mstn RGSC 3.4 9 45426831 45431658 - Mstnem2Mcwi
5131949 Mstnem2Mcwi myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 2 (del 381-398). 2011-05-17 2011-05-17 3115 Mstn Rnor_5.0 9 52977371 52982198 - Mstnem2Mcwi
5131949 Mstnem2Mcwi myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 2 (del 381-398). 2011-05-17 2011-05-17 3115 Mstn Rnor_6.0 9 53310977 53315804 - Mstnem2Mcwi
5131962 Mstnem3Mcwi myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 381-388). 2011-05-17 2011-05-17 3115 Mstn RGSC 3.4 9 45426831 45431658 - Mstnem3Mcwi
5131962 Mstnem3Mcwi myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 381-388). 2011-05-17 2011-05-17 3115 Mstn Rnor_5.0 9 52977371 52982198 - Mstnem3Mcwi
5131962 Mstnem3Mcwi myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 381-388). 2011-05-17 2011-05-17 3115 Mstn Rnor_6.0 9 53310977 53315804 - Mstnem3Mcwi
5131961 Mthfrem1Mcwi methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192). 2011-05-17 2011-05-17 1309952 Mthfr RGSC 3.4 5 165112850 165126885 + Mthfrem1Mcwi
5131961 Mthfrem1Mcwi methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192). 2011-05-17 2011-05-17 1309952 Mthfr Rnor_5.0 5 168502556 168522350 + Mthfrem1Mcwi
5131961 Mthfrem1Mcwi methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192). 2011-05-17 2011-05-17 1309952 Mthfr Rnor_6.0 5 164844642 164864360 + Mthfrem1Mcwi
127345099 Muc1em1Cgen mucin 1, cell surface associated; TALEN induced mutant 1, Cgen This Muc1 allele carrying a deletion in exon 1 of rat Muc1 was created by injecting TALENs to Sprague Dawley embryos. Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5â²-CTAGCAAGCCTAAAAGGTGAGAGGT-3â² and reverse primer 5â²-ACGAAGAGCATTTGCCTACTC-3â², followed by DNA sequencing analysis. 2021-07-09 2021-07-09 3122 Muc1 RGSC 3.4 2 181399482 181403640 +
127345099 Muc1em1Cgen mucin 1, cell surface associated; TALEN induced mutant 1, Cgen This Muc1 allele carrying a deletion in exon 1 of rat Muc1 was created by injecting TALENs to Sprague Dawley embryos. Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5â²-CTAGCAAGCCTAAAAGGTGAGAGGT-3â² and reverse primer 5â²-ACGAAGAGCATTTGCCTACTC-3â², followed by DNA sequencing analysis. 2021-07-09 2021-07-09 3122 Muc1 Rnor_5.0 2 207957206 207962396 +
127345099 Muc1em1Cgen mucin 1, cell surface associated; TALEN induced mutant 1, Cgen This Muc1 allele carrying a deletion in exon 1 of rat Muc1 was created by injecting TALENs to Sprague Dawley embryos. Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5â²-CTAGCAAGCCTAAAAGGTGAGAGGT-3â² and reverse primer 5â²-ACGAAGAGCATTTGCCTACTC-3â², followed by DNA sequencing analysis. 2021-07-09 2021-07-09 3122 Muc1 Rnor_6.0 2 188543137 188547874 +
13800827 Muc1em1Mcwi mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi. CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 3122 Muc1 RGSC 3.4 2 181399482 181403640 +
13800827 Muc1em1Mcwi mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi. CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 3122 Muc1 Rnor_5.0 2 207957206 207962396 +
13800827 Muc1em1Mcwi mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi. CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 3122 Muc1 Rnor_6.0 2 188543137 188547874 +
5508317 Myadml2em1Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1(del 161-173) 2011-10-13 2011-10-13 1311499 Myadml2 RGSC 3.4 10 110039330 110040967 - Myadml2em1Mcwi
5508317 Myadml2em1Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1(del 161-173) 2011-10-13 2011-10-13 1311499 Myadml2 Rnor_5.0 10 109418559 109420196 - Myadml2em1Mcwi
5508317 Myadml2em1Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1(del 161-173) 2011-10-13 2011-10-13 1311499 Myadml2 Rnor_6.0 10 109822170 109827328 - Myadml2em1Mcwi
5687726 Myadml2em5Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 31-bp frameshift deletion in exon 1 (del 161-191) 2012-02-09 2012-02-09 1311499 Myadml2 RGSC 3.4 10 110039330 110040967 - Myadml2em5Mcwi
5687726 Myadml2em5Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 31-bp frameshift deletion in exon 1 (del 161-191) 2012-02-09 2012-02-09 1311499 Myadml2 Rnor_5.0 10 109418559 109420196 - Myadml2em5Mcwi
5687726 Myadml2em5Mcwi myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 31-bp frameshift deletion in exon 1 (del 161-191) 2012-02-09 2012-02-09 1311499 Myadml2 Rnor_6.0 10 109822170 109827328 - Myadml2em5Mcwi
13800841 Mybphlem1Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl RGSC 3.4 2 203934530 203948031 +
13800841 Mybphlem1Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl Rnor_5.0 2 230628901 230643002 +
13800841 Mybphlem1Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl Rnor_6.0 2 211158902 211173036 +
13800846 Mybphlem2Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl RGSC 3.4 2 203934530 203948031 +
13800846 Mybphlem2Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl Rnor_5.0 2 230628901 230643002 +
13800846 Mybphlem2Mcwi myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 2018-10-18 2018-10-18 1310511 Mybphl Rnor_6.0 2 211158902 211173036 +
126925953 Myh7bem1Blar myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar The Myh7b knockout allele was generated using the CRISPR/Cas9 system targeting exon 2 in SD embryos, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. 2021-05-20 2021-05-20 1307994 Myh7b RGSC 3.4 3 146115687 146139441 + Myh7bem1Blar-/-
126925953 Myh7bem1Blar myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar The Myh7b knockout allele was generated using the CRISPR/Cas9 system targeting exon 2 in SD embryos, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. 2021-05-20 2021-05-20 1307994 Myh7b Rnor_5.0 3 157472519 157518151 + Myh7bem1Blar-/-
126925953 Myh7bem1Blar myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar The Myh7b knockout allele was generated using the CRISPR/Cas9 system targeting exon 2 in SD embryos, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. 2021-05-20 2021-05-20 1307994 Myh7b Rnor_6.0 3 151105038 151150621 + Myh7bem1Blar-/-
5508347 Mylipem1Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 195-241) 2011-10-13 2011-10-13 1305761 Mylip RGSC 3.4 17 25308147 25329887 - Mylipem1Mcwi
5508347 Mylipem1Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 195-241) 2011-10-13 2011-10-13 1305761 Mylip Rnor_5.0 17 21703590 21725205 - Mylipem1Mcwi
5508347 Mylipem1Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 195-241) 2011-10-13 2011-10-13 1305761 Mylip Rnor_6.0 17 19682040 19703681 - Mylipem1Mcwi
5508333 Mylipem2Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 49-bp deletion in the genome and a G insertion at the deletion site. 2011-10-13 2012-08-28 1305761 Mylip RGSC 3.4 17 25308147 25329887 - Mylipem2Mcwi
5508333 Mylipem2Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 49-bp deletion in the genome and a G insertion at the deletion site. 2011-10-13 2012-08-28 1305761 Mylip Rnor_5.0 17 21703590 21725205 - Mylipem2Mcwi
5508333 Mylipem2Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 49-bp deletion in the genome and a G insertion at the deletion site. 2011-10-13 2012-08-28 1305761 Mylip Rnor_6.0 17 19682040 19703681 - Mylipem2Mcwi
5508336 Mylipem3Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 51-bp frameshift deletion in exon 1 (del 206-256) 2011-10-13 2011-10-13 1305761 Mylip RGSC 3.4 17 25308147 25329887 - Mylipem3Mcwi
5508336 Mylipem3Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 51-bp frameshift deletion in exon 1 (del 206-256) 2011-10-13 2011-10-13 1305761 Mylip Rnor_5.0 17 21703590 21725205 - Mylipem3Mcwi
5508336 Mylipem3Mcwi myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 51-bp frameshift deletion in exon 1 (del 206-256) 2011-10-13 2011-10-13 1305761 Mylip Rnor_6.0 17 19682040 19703681 - Mylipem3Mcwi
150404269 Myo15aci2 myosin XVA; ci2 mutant This allele is a spontaneous mutation of Myo15a containing a base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region. 2021-09-03 2021-09-03 1561873 Myo15a RGSC 3.4 10 46742535 46798928 +
150404269 Myo15aci2 myosin XVA; ci2 mutant This allele is a spontaneous mutation of Myo15a containing a base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region. 2021-09-03 2021-09-03 1561873 Myo15a Rnor_5.0 10 46595676 46660835 +
150404269 Myo15aci2 myosin XVA; ci2 mutant This allele is a spontaneous mutation of Myo15a containing a base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region. 2021-09-03 2021-09-03 1561873 Myo15a Rnor_6.0 10 46840098 46897362 +
2311691 Myo1dTn(sb-T2/Bart3)2.334Mcwi myosin ID; transposon insertion 2.334, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene 2009-07-30 2009-07-30 621321 Myo1d RGSC 3.4 10 68720729 68997721 - Myo1dTn(sb-T2/Bart3)2.334Mcwi
2311691 Myo1dTn(sb-T2/Bart3)2.334Mcwi myosin ID; transposon insertion 2.334, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene 2009-07-30 2009-07-30 621321 Myo1d Rnor_5.0 10 67520649 67811744 - Myo1dTn(sb-T2/Bart3)2.334Mcwi
2311691 Myo1dTn(sb-T2/Bart3)2.334Mcwi myosin ID; transposon insertion 2.334, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene 2009-07-30 2009-07-30 621321 Myo1d Rnor_6.0 10 67866939 68142864 - Myo1dTn(sb-T2/Bart3)2.334Mcwi
42721971 Myo5am1Stc myosin VA; mutant 1, Stc Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats 2021-02-25 2021-02-25 3143 Myo5a RGSC 3.4 8 79909224 80027290 +
42721971 Myo5am1Stc myosin VA; mutant 1, Stc Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats 2021-02-25 2021-02-25 3143 Myo5a Rnor_5.0 8 81641953 81759995 +
42721971 Myo5am1Stc myosin VA; mutant 1, Stc Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats 2021-02-25 2021-02-25 3143 Myo5a Rnor_6.0 8 82038966 82156507 +
13204705 Myo7atnd/Hubr myosin VIIA; ENU induced tornado mutant, Hubr ENU induced an A-to-T transversion at position 362 caused a premature stopcodon in exon 5 in the middle of the myosin head encoding sequence and thereby most likely results in a complete loss of function of the rat Myo7a gene. 2017-07-13 2017-07-13 628830 Myo7a RGSC 3.4 1 155292620 155362698 - Myo7atnd-1Hubr;Myo7atnd /Hubr;Myo7atnd /Hubr
13204705 Myo7atnd/Hubr myosin VIIA; ENU induced tornado mutant, Hubr ENU induced an A-to-T transversion at position 362 caused a premature stopcodon in exon 5 in the middle of the myosin head encoding sequence and thereby most likely results in a complete loss of function of the rat Myo7a gene. 2017-07-13 2017-07-13 628830 Myo7a Rnor_5.0 1 169206150 169276706 - Myo7atnd-1Hubr;Myo7atnd /Hubr;Myo7atnd /Hubr
13204705 Myo7atnd/Hubr myosin VIIA; ENU induced tornado mutant, Hubr ENU induced an A-to-T transversion at position 362 caused a premature stopcodon in exon 5 in the middle of the myosin head encoding sequence and thereby most likely results in a complete loss of function of the rat Myo7a gene. 2017-07-13 2017-07-13 628830 Myo7a Rnor_6.0 1 163001313 163071545 - Myo7atnd-1Hubr;Myo7atnd /Hubr;Myo7atnd /Hubr
2290068 Myo9aTn(sb-T2/Bart3)2.186Mcwi myosin IXA; transposon insertion 2.186, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene 2008-02-26 2008-02-26 621395 Myo9a RGSC 3.4 8 63578001 63783813 + Myo9aTn(sb-T2/Bart3)2.186Mcwi
2290068 Myo9aTn(sb-T2/Bart3)2.186Mcwi myosin IXA; transposon insertion 2.186, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene 2008-02-26 2008-02-26 621395 Myo9a Rnor_5.0 8 64335907 64534890 + Myo9aTn(sb-T2/Bart3)2.186Mcwi
2290068 Myo9aTn(sb-T2/Bart3)2.186Mcwi myosin IXA; transposon insertion 2.186, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene 2008-02-26 2008-02-26 621395 Myo9a Rnor_6.0 8 64573248 64777607 + Myo9aTn(sb-T2/Bart3)2.186Mcwi
401795483 Nanos3em1(tdTomato)Nips nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. 2023-09-11 2023-09-11 1306672 Nanos3 RGSC 3.4 19 25669353 25672779 +
401795483 Nanos3em1(tdTomato)Nips nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. 2023-09-11 2023-09-11 1306672 Nanos3 Rnor_5.0 19 36262007 36265766 -
401795483 Nanos3em1(tdTomato)Nips nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. 2023-09-11 2023-09-11 1306672 Nanos3 Rnor_6.0 19 25284907 25288680 -
2290116 NapbTn(sb-T2/Bart3)2.162Mcwi similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. 2008-02-26 2008-02-26 1589649 Napb RGSC 3.4 3 137447072 137490500 - LOC499903Tn(sb-T2/Bart3)2.162Mcwi;NapbTn(sb-T2/Bart3)2.162Mcwi
2290116 NapbTn(sb-T2/Bart3)2.162Mcwi similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. 2008-02-26 2008-02-26 1589649 Napb Rnor_5.0 3 149431212 149473190 - LOC499903Tn(sb-T2/Bart3)2.162Mcwi;NapbTn(sb-T2/Bart3)2.162Mcwi
2290116 NapbTn(sb-T2/Bart3)2.162Mcwi similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. 2008-02-26 2008-02-26 1589649 Napb Rnor_6.0 3 143017571 143063904 - LOC499903Tn(sb-T2/Bart3)2.162Mcwi;NapbTn(sb-T2/Bart3)2.162Mcwi
6893413 Nat8em4Mcwi N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 1 (del 46-52) 2012-08-28 2012-08-28 621609 Nat8 RGSC 3.4 4 120001277 120002055 - Nat8em4Mcwi
6893413 Nat8em4Mcwi N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 1 (del 46-52) 2012-08-28 2012-08-28 621609 Nat8 Rnor_5.0 4 182101688 182103119 - Nat8em4Mcwi
6893413 Nat8em4Mcwi N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 1 (del 46-52) 2012-08-28 2012-08-28 621609 Nat8 Rnor_6.0 4 117525963 117527443 - Nat8em4Mcwi
41404724 Ncf1W neutrophil cytosolic factor 1, wistar mutant , Rhd The Wistar Ncf1 (Ncf1W) allele identified with M153T missense mutation. 2021-02-08 2021-02-08 61307 Ncf1 RGSC 3.4 12 23578097 23587292 +
41404724 Ncf1W neutrophil cytosolic factor 1, wistar mutant , Rhd The Wistar Ncf1 (Ncf1W) allele identified with M153T missense mutation. 2021-02-08 2021-02-08 61307 Ncf1 Rnor_5.0 12 27505793 27514989 +
41404724 Ncf1W neutrophil cytosolic factor 1, wistar mutant , Rhd The Wistar Ncf1 (Ncf1W) allele identified with M153T missense mutation. 2021-02-08 2021-02-08 61307 Ncf1 Rnor_6.0 12 25497104 25506300 +
5144089 Ncf2em1Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 253-257) 2011-07-29 2011-07-29 1309424 Ncf2 RGSC 3.4 13 67806516 67834105 + Ncf2em1Mcwi;neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5144089 Ncf2em1Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 253-257) 2011-07-29 2011-07-29 1309424 Ncf2 Rnor_5.0 13 75197561 75229600 + Ncf2em1Mcwi;neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5144089 Ncf2em1Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 253-257) 2011-07-29 2011-07-29 1309424 Ncf2 Rnor_6.0 13 70226441 70259019 + Ncf2em1Mcwi;neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5508342 Ncf2em4Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2 (v3.4 del 67808926-67809069, ins atctt) 2011-10-13 2011-10-13 1309424 Ncf2 RGSC 3.4 13 67806516 67834105 + Ncf2em4Mcwi
5508342 Ncf2em4Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2 (v3.4 del 67808926-67809069, ins atctt) 2011-10-13 2011-10-13 1309424 Ncf2 Rnor_5.0 13 75197561 75229600 + Ncf2em4Mcwi
5508342 Ncf2em4Mcwi neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2 (v3.4 del 67808926-67809069, ins atctt) 2011-10-13 2011-10-13 1309424 Ncf2 Rnor_6.0 13 70226441 70259019 + Ncf2em4Mcwi
4139859 Nckap5em1Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 1559-1568). 2010-08-19 2010-08-19 1564507 Nckap5 RGSC 3.4 13 38444115 39275959 - Nap5em1Mcwi;Nckap5em1Mcwi
4139859 Nckap5em1Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 1559-1568). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_5.0 13 47369687 48273649 - Nap5em1Mcwi;Nckap5em1Mcwi
4139859 Nckap5em1Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 1559-1568). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_6.0 13 42265875 43049232 - Nap5em1Mcwi;Nckap5em1Mcwi
4139862 Nckap5em2Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 6 (del 1560-1563). 2010-08-19 2010-08-19 1564507 Nckap5 RGSC 3.4 13 38444115 39275959 - Nap5em2Mcwi;Nckap5em2Mcwi
4139862 Nckap5em2Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 6 (del 1560-1563). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_5.0 13 47369687 48273649 - Nap5em2Mcwi;Nckap5em2Mcwi
4139862 Nckap5em2Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 6 (del 1560-1563). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_6.0 13 42265875 43049232 - Nap5em2Mcwi;Nckap5em2Mcwi
4139861 Nckap5em3Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568). 2010-08-19 2010-08-19 1564507 Nckap5 RGSC 3.4 13 38444115 39275959 - Nap5em3Mcwi;Nckap5em3Mcwi
4139861 Nckap5em3Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_5.0 13 47369687 48273649 - Nap5em3Mcwi;Nckap5em3Mcwi
4139861 Nckap5em3Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568). 2010-08-19 2010-08-19 1564507 Nckap5 Rnor_6.0 13 42265875 43049232 - Nap5em3Mcwi;Nckap5em3Mcwi
5509975 Nckap5em4Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568) 2011-11-16 2011-11-16 1564507 Nckap5 RGSC 3.4 13 38444115 39275959 - Nckap5em4Mcwi
5509975 Nckap5em4Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568) 2011-11-16 2011-11-16 1564507 Nckap5 Rnor_5.0 13 47369687 48273649 - Nckap5em4Mcwi
5509975 Nckap5em4Mcwi NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568) 2011-11-16 2011-11-16 1564507 Nckap5 Rnor_6.0 13 42265875 43049232 - Nckap5em4Mcwi
9588537 Ndufc2em1Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 RGSC 3.4 1 154635889 154642112 + Ndufc2em1Mcwi
9588537 Ndufc2em1Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 Rnor_5.0 1 168576274 168582497 + Ndufc2em1Mcwi
9588537 Ndufc2em1Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 Rnor_6.0 1 162369801 162376024 + Ndufc2em1Mcwi
9588541 Ndufc2em2Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 RGSC 3.4 1 154635889 154642112 + Ndufc2em2Mcwi
9588541 Ndufc2em2Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 Rnor_5.0 1 168576274 168582497 + Ndufc2em2Mcwi
9588541 Ndufc2em2Mcwi NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1. 2014-10-30 2014-10-30 1307511 Ndufc2 Rnor_6.0 1 162369801 162376024 + Ndufc2em2Mcwi
2302639 Nectin1Tn(sb-T2/Bart3)2.284Mcwi nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1 gene 2009-01-06 2009-01-06 620791 Nectin1 RGSC 3.4 8 46739657 46799051 + Pvrl1Tn(sb-T2/Bart3)2.284Mcwi;poliovirus receptor-related 1; transposon insertion 2.284, Medical College of Wisconsin;Nectin1Tn(sb-T2/Bart3)2.284Mcwi
2302639 Nectin1Tn(sb-T2/Bart3)2.284Mcwi nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1 gene 2009-01-06 2009-01-06 620791 Nectin1 Rnor_5.0 8 46714981 46777484 + Pvrl1Tn(sb-T2/Bart3)2.284Mcwi;poliovirus receptor-related 1; transposon insertion 2.284, Medical College of Wisconsin;Nectin1Tn(sb-T2/Bart3)2.284Mcwi
2302639 Nectin1Tn(sb-T2/Bart3)2.284Mcwi nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1 gene 2009-01-06 2009-01-06 620791 Nectin1 Rnor_6.0 8 48094233 48198499 + Pvrl1Tn(sb-T2/Bart3)2.284Mcwi;poliovirus receptor-related 1; transposon insertion 2.284, Medical College of Wisconsin;Nectin1Tn(sb-T2/Bart3)2.284Mcwi
42721975 Nek8lpkArc NIMA-related kinase 8; lpk mutant, Arc The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. 2021-02-25 2021-02-25 1306897 Nek8 RGSC 3.4 10 64458886 64470044 + NIMA-related kinase 8; lpk mutant ,Arc
42721975 Nek8lpkArc NIMA-related kinase 8; lpk mutant, Arc The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. 2021-02-25 2021-02-25 1306897 Nek8 Rnor_5.0 10 66196993 66230588 + NIMA-related kinase 8; lpk mutant ,Arc
42721975 Nek8lpkArc NIMA-related kinase 8; lpk mutant, Arc The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. 2021-02-25 2021-02-25 1306897 Nek8 Rnor_6.0 10 65404489 65439059 - NIMA-related kinase 8; lpk mutant ,Arc
2290061 Nell1Tn(sb-T2/Bart3)2.195Mcwi NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Nell1 gene 2008-02-26 2008-02-26 620998 Nell1 RGSC 3.4 1 99805922 100758002 + Nell1Tn(sb-T2/Bart3)2.195Mcwi
2290061 Nell1Tn(sb-T2/Bart3)2.195Mcwi NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Nell1 gene 2008-02-26 2008-02-26 620998 Nell1 Rnor_5.0 1 106397933 107260905 + Nell1Tn(sb-T2/Bart3)2.195Mcwi
2290061 Nell1Tn(sb-T2/Bart3)2.195Mcwi NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Nell1 gene 2008-02-26 2008-02-26 620998 Nell1 Rnor_6.0 1 105348577 106218970 + Nell1Tn(sb-T2/Bart3)2.195Mcwi
10045594 Nfe2l2em1Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 RGSC 3.4 3 58366693 58394116 - Nfe2l2em1Kyo
10045594 Nfe2l2em1Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 Rnor_5.0 3 69041641 69069190 - Nfe2l2em1Kyo
10045594 Nfe2l2em1Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 Rnor_6.0 3 62497568 62525146 - Nfe2l2em1Kyo
9588549 Nfe2l2em1Mcwi nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagenesis. The resulting mutation is a 41-bp deletion in exon 1. 2014-10-30 2014-10-30 620360 Nfe2l2 RGSC 3.4 3 58366693 58394116 - nuclear factor, erythroid 2-like 2;Nfe2l2em1Mcwi;zinc finger nuclease induced mutant 1, Medical College of Wisconsin
9588549 Nfe2l2em1Mcwi nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagenesis. The resulting mutation is a 41-bp deletion in exon 1. 2014-10-30 2014-10-30 620360 Nfe2l2 Rnor_5.0 3 69041641 69069190 - nuclear factor, erythroid 2-like 2;Nfe2l2em1Mcwi;zinc finger nuclease induced mutant 1, Medical College of Wisconsin
9588549 Nfe2l2em1Mcwi nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin This allele was made by TALEN mutagenesis. The resulting mutation is a 41-bp deletion in exon 1. 2014-10-30 2014-10-30 620360 Nfe2l2 Rnor_6.0 3 62497568 62525146 - nuclear factor, erythroid 2-like 2;Nfe2l2em1Mcwi;zinc finger nuclease induced mutant 1, Medical College of Wisconsin
10045598 Nfe2l2em2Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 RGSC 3.4 3 58366693 58394116 - Nfe2l2em2Kyo
10045598 Nfe2l2em2Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 Rnor_5.0 3 69041641 69069190 - Nfe2l2em2Kyo
10045598 Nfe2l2em2Kyo nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) 2015-06-12 2015-06-12 620360 Nfe2l2 Rnor_6.0 3 62497568 62525146 - Nfe2l2em2Kyo
149735565 Ngly1em1Ta N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. 2021-07-22 2021-07-22 1308518 Ngly1 RGSC 3.4 15 10704196 10750564 -
149735565 Ngly1em1Ta N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. 2021-07-22 2021-07-22 1308518 Ngly1 Rnor_5.0 15 14450836 14501356 -
149735565 Ngly1em1Ta N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. 2021-07-22 2021-07-22 1308518 Ngly1 Rnor_6.0 15 10405453 10455973 -
150573819 Nkx3-1em1Pjhak NK3 homeobox 1; TALEN induced mutant 1, Pjhak A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. 2022-01-12 2022-01-12 1305369 Nkx3-1 RGSC 3.4 15 49743313 49745905 +
150573819 Nkx3-1em1Pjhak NK3 homeobox 1; TALEN induced mutant 1, Pjhak A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. 2022-01-12 2022-01-12 1305369 Nkx3-1 Rnor_5.0 15 54796102 54798694 +
150573819 Nkx3-1em1Pjhak NK3 homeobox 1; TALEN induced mutant 1, Pjhak A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. 2022-01-12 2022-01-12 1305369 Nkx3-1 Rnor_6.0 15 51065316 51067908 +
11568701 Nlgn3em1Sage neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. The resulting mutation was a 58bp deletion of the exon5/intron 5 junction occurred at 9874bp-9931bp. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-13 2016-12-13 621119 Nlgn3 RGSC 3.4 X 89376193 89398665 + Nlgn3tm1Sage;Nlgn3em1Sage
11568701 Nlgn3em1Sage neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. The resulting mutation was a 58bp deletion of the exon5/intron 5 junction occurred at 9874bp-9931bp. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-13 2016-12-13 621119 Nlgn3 Rnor_5.0 X 72051846 72075119 + Nlgn3tm1Sage;Nlgn3em1Sage
11568701 Nlgn3em1Sage neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. The resulting mutation was a 58bp deletion of the exon5/intron 5 junction occurred at 9874bp-9931bp. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 2016-12-13 2016-12-13 621119 Nlgn3 Rnor_6.0 X 71199390 71227460 + Nlgn3tm1Sage;Nlgn3em1Sage
13207502 Nlrp10em2Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 RGSC 3.4 1 166411647 166419204 + Nlrp10em2Mcwi
13207502 Nlrp10em2Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 Rnor_5.0 1 180511615 180519172 - Nlrp10em2Mcwi
13207502 Nlrp10em2Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 Rnor_6.0 1 173521412 173528969 - Nlrp10em2Mcwi
13207504 Nlrp10em3Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 RGSC 3.4 1 166411647 166419204 + Nlrp10em3Mcwi
13207504 Nlrp10em3Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 Rnor_5.0 1 180511615 180519172 - Nlrp10em3Mcwi
13207504 Nlrp10em3Mcwi NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. 2017-08-03 2017-08-03 1307387 Nlrp10 Rnor_6.0 1 173521412 173528969 - Nlrp10em3Mcwi
13207508 Nlrp12em1Mcwi NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. 2017-08-03 2017-08-03 1309415 Nlrp12 RGSC 3.4 1 64242875 64271212 + Nlrp12em1Mcwi
13207508 Nlrp12em1Mcwi NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. 2017-08-03 2017-08-03 1309415 Nlrp12 Rnor_5.0 1 63493575 63521356 + Nlrp12em1Mcwi
13207508 Nlrp12em1Mcwi NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. 2017-08-03 2017-08-03 1309415 Nlrp12 Rnor_6.0 1 64506750 64543908 + Nlrp12em1Mcwi
13800850 Nlrp3em1Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. 2018-10-18 2018-10-18 1308314 Nlrp3 RGSC 3.4 10 45850224 45874533 +
13800850 Nlrp3em1Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. 2018-10-18 2018-10-18 1308314 Nlrp3 Rnor_5.0 10 45648191 45674617 +
13800850 Nlrp3em1Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. 2018-10-18 2018-10-18 1308314 Nlrp3 Rnor_6.0 10 45884324 45918290 +
13792799 Nlrp3em2Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 14-bp deletion in exon 1 of the Nlrp3 gene. 2018-09-28 2018-09-28 1308314 Nlrp3 RGSC 3.4 10 45850224 45874533 +
13792799 Nlrp3em2Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 14-bp deletion in exon 1 of the Nlrp3 gene. 2018-09-28 2018-09-28 1308314 Nlrp3 Rnor_5.0 10 45648191 45674617 +
13792799 Nlrp3em2Mcwi NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 14-bp deletion in exon 1 of the Nlrp3 gene. 2018-09-28 2018-09-28 1308314 Nlrp3 Rnor_6.0 10 45884324 45918290 +
1578795 Nos1m1Mcwi nitric oxide synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L72Stop mutation is generated. 2006-05-02 2006-05-02 3184 Nos1 RGSC 3.4 12 39812500 39869484 - Nos1m1Mcwi
1578795 Nos1m1Mcwi nitric oxide synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L72Stop mutation is generated. 2006-05-02 2006-05-02 3184 Nos1 Rnor_5.0 12 46049288 46209569 - Nos1m1Mcwi
1578795 Nos1m1Mcwi nitric oxide synthase 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L72Stop mutation is generated. 2006-05-02 2006-05-02 3184 Nos1 Rnor_6.0 12 44214949 44405530 - Nos1m1Mcwi
6893422 Nos3em13Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4. 2012-08-28 2012-08-28 3186 Nos3 RGSC 3.4 4 6158847 6179441 - Nos3em13Mcwi
6893422 Nos3em13Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4. 2012-08-28 2012-08-28 3186 Nos3 Rnor_5.0 4 7333272 7353767 - Nos3em13Mcwi
6893422 Nos3em13Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4. 2012-08-28 2012-08-28 3186 Nos3 Rnor_6.0 4 7321908 7342404 - Nos3em13Mcwi
6893418 Nos3em2Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 399-411) 2012-08-28 2012-08-28 3186 Nos3 RGSC 3.4 4 6158847 6179441 - Nos3em2Mcwi
6893418 Nos3em2Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 399-411) 2012-08-28 2012-08-28 3186 Nos3 Rnor_5.0 4 7333272 7353767 - Nos3em2Mcwi
6893418 Nos3em2Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 399-411) 2012-08-28 2012-08-28 3186 Nos3 Rnor_6.0 4 7321908 7342404 - Nos3em2Mcwi
6893421 Nos3em8Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 109-bp deletion in exon 3 (del 309-417) 2012-08-28 2012-08-28 3186 Nos3 RGSC 3.4 4 6158847 6179441 - Nos3em8Mcwi
6893421 Nos3em8Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 109-bp deletion in exon 3 (del 309-417) 2012-08-28 2012-08-28 3186 Nos3 Rnor_5.0 4 7333272 7353767 - Nos3em8Mcwi
6893421 Nos3em8Mcwi nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 109-bp deletion in exon 3 (del 309-417) 2012-08-28 2012-08-28 3186 Nos3 Rnor_6.0 4 7321908 7342404 - Nos3em8Mcwi
626419688 Nox1em1Shmo NADPH oxidase 1; endonuclease induced mutant 1, Shmo A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620598 Nox1 Rnor_5.0 X 104742161 104765479 -
626419688 Nox1em1Shmo NADPH oxidase 1; endonuclease induced mutant 1, Shmo A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620598 Nox1 Rnor_6.0 X 104909328 104932508 -
5131428 Nox4em1Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590). 2011-04-27 2011-04-27 620600 Nox4 RGSC 3.4 1 143415816 143603554 + Nox4em1Mcwi
5131428 Nox4em1Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590). 2011-04-27 2011-04-27 620600 Nox4 Rnor_5.0 1 157106652 157196482 + Nox4em1Mcwi
5131428 Nox4em1Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590). 2011-04-27 2011-04-27 620600 Nox4 Rnor_5.0 1 157246099 157285107 + Nox4em1Mcwi
5131428 Nox4em1Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590). 2011-04-27 2011-04-27 620600 Nox4 Rnor_6.0 1 150796359 150976186 + Nox4em1Mcwi
626419690 Nox4em1Shmo NADPH oxidase 4; endonuclease induced mutant 1, Shmo A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620600 Nox4 RGSC 3.4 1 143415816 143603554 +
626419690 Nox4em1Shmo NADPH oxidase 4; endonuclease induced mutant 1, Shmo A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620600 Nox4 Rnor_5.0 1 157106652 157196482 +
626419690 Nox4em1Shmo NADPH oxidase 4; endonuclease induced mutant 1, Shmo A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620600 Nox4 Rnor_5.0 1 157246099 157285107 +
626419690 Nox4em1Shmo NADPH oxidase 4; endonuclease induced mutant 1, Shmo A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. 2025-09-05 2025-09-05 620600 Nox4 Rnor_6.0 1 150796359 150976186 +
4139868 Nox4em2Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 7 (del 586-593). 2010-08-19 2010-08-19 620600 Nox4 RGSC 3.4 1 143415816 143603554 + Nox4em2Mcwi
4139868 Nox4em2Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 7 (del 586-593). 2010-08-19 2010-08-19 620600 Nox4 Rnor_5.0 1 157106652 157196482 + Nox4em2Mcwi
4139868 Nox4em2Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 7 (del 586-593). 2010-08-19 2010-08-19 620600 Nox4 Rnor_5.0 1 157246099 157285107 + Nox4em2Mcwi
4139868 Nox4em2Mcwi NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 7 (del 586-593). 2010-08-19 2010-08-19 620600 Nox4 Rnor_6.0 1 150796359 150976186 + Nox4em2Mcwi
4139857 Nppaem4Mcwi natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273). 2010-08-19 2010-08-19 3193 Nppa RGSC 3.4 5 165074518 165075827 + Nppaem4Mcwi
4139857 Nppaem4Mcwi natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273). 2010-08-19 2010-08-19 3193 Nppa Rnor_5.0 5 168466309 168467618 + Nppaem4Mcwi
4139857 Nppaem4Mcwi natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273). 2010-08-19 2010-08-19 3193 Nppa Rnor_6.0 5 164808407 164809716 + Nppaem4Mcwi
5508324 Nppbem2Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2 (del 165062746-165062845) 2011-10-13 2011-10-13 3194 Nppb RGSC 3.4 5 165062348 165063650 + Nppbem2Mcwi
5508324 Nppbem2Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2 (del 165062746-165062845) 2011-10-13 2011-10-13 3194 Nppb Rnor_5.0 5 168454278 168455640 + Nppbem2Mcwi
5508324 Nppbem2Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2 (del 165062746-165062845) 2011-10-13 2011-10-13 3194 Nppb Rnor_6.0 5 164796176 164797538 + Nppbem2Mcwi
5509979 Nppbem4Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2 (del 165062749 165062886) 2011-11-16 2011-11-16 3194 Nppb RGSC 3.4 5 165062348 165063650 + Nppbem4Mcwi
5509979 Nppbem4Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2 (del 165062749 165062886) 2011-11-16 2011-11-16 3194 Nppb Rnor_5.0 5 168454278 168455640 + Nppbem4Mcwi
5509979 Nppbem4Mcwi natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2 (del 165062749 165062886) 2011-11-16 2011-11-16 3194 Nppb Rnor_6.0 5 164796176 164797538 + Nppbem4Mcwi
127284866 Nppcem1Kyo natriuretic peptide C; ZFN induced mutant 1, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). 2021-06-11 2021-06-11 620850 Nppc RGSC 3.4 9 85434254 85438454 -
127284866 Nppcem1Kyo natriuretic peptide C; ZFN induced mutant 1, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). 2021-06-11 2021-06-11 620850 Nppc Rnor_5.0 9 93458753 93462953 -
127284866 Nppcem1Kyo natriuretic peptide C; ZFN induced mutant 1, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). 2021-06-11 2021-06-11 620850 Nppc Rnor_6.0 9 93731436 93735636 -
127284869 Nppcem2Kyo natriuretic peptide C; ZFN induced mutant 2 , Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc 2021-06-11 2021-06-11 620850 Nppc RGSC 3.4 9 85434254 85438454 -
127284869 Nppcem2Kyo natriuretic peptide C; ZFN induced mutant 2 , Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc 2021-06-11 2021-06-11 620850 Nppc Rnor_5.0 9 93458753 93462953 -
127284869 Nppcem2Kyo natriuretic peptide C; ZFN induced mutant 2 , Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc 2021-06-11 2021-06-11 620850 Nppc Rnor_6.0 9 93731436 93735636 -
127284871 Nppcem3Kyo natriuretic peptide C; ZFN induced mutant 3, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem3Kyo allele ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) 2021-06-11 2021-06-11 620850 Nppc RGSC 3.4 9 85434254 85438454 -
127284871 Nppcem3Kyo natriuretic peptide C; ZFN induced mutant 3, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem3Kyo allele ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) 2021-06-11 2021-06-11 620850 Nppc Rnor_5.0 9 93458753 93462953 -
127284871 Nppcem3Kyo natriuretic peptide C; ZFN induced mutant 3, Kyo Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem3Kyo allele ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) 2021-06-11 2021-06-11 620850 Nppc Rnor_6.0 9 93731436 93735636 -
127284873 Nppcem4Kyo natriuretic peptide C; ZFN induced mutant 4, Kyo This allele was induced by Zinc-finger nucleases (ZFNs) system injuected to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem4Kyo ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats 2021-06-14 2021-06-14 620850 Nppc RGSC 3.4 9 85434254 85438454 -
127284873 Nppcem4Kyo natriuretic peptide C; ZFN induced mutant 4, Kyo This allele was induced by Zinc-finger nucleases (ZFNs) system injuected to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem4Kyo ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats 2021-06-14 2021-06-14 620850 Nppc Rnor_5.0 9 93458753 93462953 -
127284873 Nppcem4Kyo natriuretic peptide C; ZFN induced mutant 4, Kyo This allele was induced by Zinc-finger nucleases (ZFNs) system injuected to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem4Kyo ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats 2021-06-14 2021-06-14 620850 Nppc Rnor_6.0 9 93731436 93735636 -
11530022 Npyem6Sage neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 26-bp deletion at the targeted site, including 6 bp in intron 1 and 20 bp in exon 2. 2016-08-19 2016-08-19 3197 Npy RGSC 3.4 4 78038013 78045187 + Npyem6Sage
11530022 Npyem6Sage neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 26-bp deletion at the targeted site, including 6 bp in intron 1 and 20 bp in exon 2. 2016-08-19 2016-08-19 3197 Npy Rnor_5.0 4 144233753 144240956 + Npyem6Sage
11530022 Npyem6Sage neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 26-bp deletion at the targeted site, including 6 bp in intron 1 and 20 bp in exon 2. 2016-08-19 2016-08-19 3197 Npy Rnor_6.0 4 79557856 79565059 + Npyem6Sage
1578798 Nr0b2m1Mcwi nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G96R mutation is generated from the codon change GGC/CGC 2006-05-02 2006-05-02 621032 Nr0b2 RGSC 3.4 5 151524685 151528000 - Nr0b2m1Mcwi
1578798 Nr0b2m1Mcwi nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G96R mutation is generated from the codon change GGC/CGC 2006-05-02 2006-05-02 621032 Nr0b2 Rnor_5.0 5 155465275 155468590 + Nr0b2m1Mcwi
1578798 Nr0b2m1Mcwi nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); G96R mutation is generated from the codon change GGC/CGC 2006-05-02 2006-05-02 621032 Nr0b2 Rnor_6.0 5 151776004 151779319 + Nr0b2m1Mcwi
12902626 Nr1i2em1Sage nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage This ZFN induced allele contains a 20-bp deletion within exon 2 of the Nr1i2 gene. 2017-05-09 2017-05-09 69057 Nr1i2 RGSC 3.4 11 64239918 64276702 + nuclear receptor subfamily 1, group I, member 2; endonuclease induced mutant1, SAGE;Nr1i2 em1Sage;Nr1i2 em1Sage
12902626 Nr1i2em1Sage nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage This ZFN induced allele contains a 20-bp deletion within exon 2 of the Nr1i2 gene. 2017-05-09 2017-05-09 69057 Nr1i2 Rnor_5.0 11 67024185 67060494 - nuclear receptor subfamily 1, group I, member 2; endonuclease induced mutant1, SAGE;Nr1i2 em1Sage;Nr1i2 em1Sage
12902626 Nr1i2em1Sage nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage This ZFN induced allele contains a 20-bp deletion within exon 2 of the Nr1i2 gene. 2017-05-09 2017-05-09 69057 Nr1i2 Rnor_6.0 11 65022100 65058546 + nuclear receptor subfamily 1, group I, member 2; endonuclease induced mutant1, SAGE;Nr1i2 em1Sage;Nr1i2 em1Sage
12903268 Nr1i3em1Sage nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE This is a knockout allele induced by the zinc finger nuclease genome editing system. The allele contains a 10-bp deletion within exon 2 of the rat Nr1i3 gene. 2017-05-10 2017-05-10 621400 Nr1i3 RGSC 3.4 13 87104241 87108563 + Nr1i3 em1Sage;Nr1i3 em1Sage;Nr1i3 em1Sage
12903268 Nr1i3em1Sage nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE This is a knockout allele induced by the zinc finger nuclease genome editing system. The allele contains a 10-bp deletion within exon 2 of the rat Nr1i3 gene. 2017-05-10 2017-05-10 621400 Nr1i3 Rnor_5.0 13 94211961 94218143 + Nr1i3 em1Sage;Nr1i3 em1Sage;Nr1i3 em1Sage
12903268 Nr1i3em1Sage nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE This is a knockout allele induced by the zinc finger nuclease genome editing system. The allele contains a 10-bp deletion within exon 2 of the rat Nr1i3 gene. 2017-05-10 2017-05-10 621400 Nr1i3 Rnor_6.0 13 89585072 89591278 + Nr1i3 em1Sage;Nr1i3 em1Sage;Nr1i3 em1Sage
5687721 Nr2f2em1Mcwi nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp in-frame deletion in exon 2 (del 600-647) resulting in a 5 amino acid deletion in the hinge region of the Nr2f2 protein, affecting protein-protein interaction with Zfpm2 (also known as Fog2). 2012-02-09 2012-02-09 69305 Nr2f2 RGSC 3.4 1 125280974 125286929 - Nr2f2em1Mcwi
5687721 Nr2f2em1Mcwi nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp in-frame deletion in exon 2 (del 600-647) resulting in a 5 amino acid deletion in the hinge region of the Nr2f2 protein, affecting protein-protein interaction with Zfpm2 (also known as Fog2). 2012-02-09 2012-02-09 69305 Nr2f2 Rnor_5.0 1 132486697 132499845 - Nr2f2em1Mcwi
5687721 Nr2f2em1Mcwi nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp in-frame deletion in exon 2 (del 600-647) resulting in a 5 amino acid deletion in the hinge region of the Nr2f2 protein, affecting protein-protein interaction with Zfpm2 (also known as Fog2). 2012-02-09 2012-02-09 69305 Nr2f2 Rnor_6.0 1 131447671 131465749 - Nr2f2em1Mcwi
125097487 Nr3c1em1Jhrmn nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. This allele contains CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) 2021-03-31 2021-03-31 2741 Nr3c1 RGSC 3.4 18 32371496 32459145 - nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan;Nr3c1em1Kuan;Nr3c1em1KuanJhrmn
125097487 Nr3c1em1Jhrmn nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. This allele contains CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) 2021-03-31 2021-03-31 2741 Nr3c1 Rnor_5.0 18 32347227 32348480 - nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan;Nr3c1em1Kuan;Nr3c1em1KuanJhrmn
125097487 Nr3c1em1Jhrmn nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. This allele contains CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) 2021-03-31 2021-03-31 2741 Nr3c1 Rnor_5.0 18 31408742 31442725 - nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan;Nr3c1em1Kuan;Nr3c1em1KuanJhrmn
125097487 Nr3c1em1Jhrmn nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. This allele contains CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) 2021-03-31 2021-03-31 2741 Nr3c1 Rnor_6.0 18 31728373 32704022 - nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan;Nr3c1em1Kuan;Nr3c1em1KuanJhrmn
1578791 Nr4a1m1Mcwi nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y130Stop mutation is generated from the codon change TAC/TAA. 2006-05-02 2006-05-02 620029 Nr4a1 RGSC 3.4 7 140012807 140020590 + Nr4a1m1Mcwi
1578791 Nr4a1m1Mcwi nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y130Stop mutation is generated from the codon change TAC/TAA. 2006-05-02 2006-05-02 620029 Nr4a1 Rnor_5.0 7 140700242 140721073 + Nr4a1m1Mcwi
1578791 Nr4a1m1Mcwi nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y130Stop mutation is generated from the codon change TAC/TAA. 2006-05-02 2006-05-02 620029 Nr4a1 Rnor_6.0 7 142899358 142920216 + Nr4a1m1Mcwi
2290090 Nrg1Tn(sb-T2/Bart3)2.183Mcwi neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene 2008-02-26 2008-02-26 621341 Nrg1 RGSC 3.4 16 63937796 64126183 + Nrg1Tn(sb-T2/Bart3)2.183Mcwi
2290090 Nrg1Tn(sb-T2/Bart3)2.183Mcwi neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene 2008-02-26 2008-02-26 621341 Nrg1 Rnor_5.0 16 62632432 63718738 + Nrg1Tn(sb-T2/Bart3)2.183Mcwi
2290090 Nrg1Tn(sb-T2/Bart3)2.183Mcwi neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene 2008-02-26 2008-02-26 621341 Nrg1 Rnor_6.0 16 62969573 64065063 + Nrg1Tn(sb-T2/Bart3)2.183Mcwi
11568059 Nrxn1em1 neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. The resulting mutation was a a 16-bp deletion in Exon 1. 2016-12-07 2021-05-21 628659 Nrxn1 RGSC 3.4 6 14050929 15354069 - Nrxn1tm1Sage;Nrxn1em1
11568059 Nrxn1em1 neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. The resulting mutation was a a 16-bp deletion in Exon 1. 2016-12-07 2021-05-21 628659 Nrxn1 Rnor_5.0 6 24704937 25145167 - Nrxn1tm1Sage;Nrxn1em1
11568059 Nrxn1em1 neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. The resulting mutation was a a 16-bp deletion in Exon 1. 2016-12-07 2021-05-21 628659 Nrxn1 Rnor_5.0 6 23843153 24482073 - Nrxn1tm1Sage;Nrxn1em1
11568059 Nrxn1em1 neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. The resulting mutation was a a 16-bp deletion in Exon 1. 2016-12-07 2021-05-21 628659 Nrxn1 Rnor_6.0 6 13886757 15191660 - Nrxn1tm1Sage;Nrxn1em1
2299118 Nrxn2Tn(sb-T2/Bart3)2.250Mcwi neurexin 2; transposon insertion 2.250, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene 2008-08-12 2008-08-12 620211 Nrxn2 RGSC 3.4 1 209211740 209318064 + Nrxn2Tn(sb-T2/Bart3)2.250Mcwi
2299118 Nrxn2Tn(sb-T2/Bart3)2.250Mcwi neurexin 2; transposon insertion 2.250, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene 2008-08-12 2008-08-12 620211 Nrxn2 Rnor_5.0 1 228789462 228899340 + Nrxn2Tn(sb-T2/Bart3)2.250Mcwi
2299118 Nrxn2Tn(sb-T2/Bart3)2.250Mcwi neurexin 2; transposon insertion 2.250, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene 2008-08-12 2008-08-12 620211 Nrxn2 Rnor_6.0 1 221792191 221908047 + Nrxn2Tn(sb-T2/Bart3)2.250Mcwi
2302645 Nsun4Tn(sb-T2/Bart3)2.286Mcwi NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene 2009-01-06 2009-01-06 1559652 Nsun4 RGSC 3.4 5 136277224 136297339 + Nsun4Tn(sb-T2/Bart3)2.286Mcwi
2302645 Nsun4Tn(sb-T2/Bart3)2.286Mcwi NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene 2009-01-06 2009-01-06 1559652 Nsun4 Rnor_5.0 5 138152068 138174158 - Nsun4Tn(sb-T2/Bart3)2.286Mcwi
2302645 Nsun4Tn(sb-T2/Bart3)2.286Mcwi NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene 2009-01-06 2009-01-06 1559652 Nsun4 Rnor_5.0 5 138669115 138689234 - Nsun4Tn(sb-T2/Bart3)2.286Mcwi
2302645 Nsun4Tn(sb-T2/Bart3)2.286Mcwi NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene 2009-01-06 2009-01-06 1559652 Nsun4 Rnor_6.0 5 134885377 134905492 - Nsun4Tn(sb-T2/Bart3)2.286Mcwi
2290157 NtmTn(sb-T2/Bart3)2.130Mcwi neurotrimin; transposon insertion 2.130, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene 2008-02-26 2008-02-26 620958 Ntm RGSC 3.4 8 28587019 29019888 - HntTn(sb-T2/Bart3)2.130Mcwi;HntTn(sb-T2/Bart3)2.130Mcwi;NtmTn(sb-T2/Bart3)2.130Mcwi
2290157 NtmTn(sb-T2/Bart3)2.130Mcwi neurotrimin; transposon insertion 2.130, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene 2008-02-26 2008-02-26 620958 Ntm Rnor_5.0 8 30073163 31070882 - HntTn(sb-T2/Bart3)2.130Mcwi;HntTn(sb-T2/Bart3)2.130Mcwi;NtmTn(sb-T2/Bart3)2.130Mcwi
2290157 NtmTn(sb-T2/Bart3)2.130Mcwi neurotrimin; transposon insertion 2.130, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene 2008-02-26 2008-02-26 620958 Ntm Rnor_6.0 8 30039332 31041755 - HntTn(sb-T2/Bart3)2.130Mcwi;HntTn(sb-T2/Bart3)2.130Mcwi;NtmTn(sb-T2/Bart3)2.130Mcwi
126925168 Ogdhem1Yuyi oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. 2021-05-13 2021-05-13 1561359 Ogdh RGSC 3.4 14 87022994 87090768 +
126925168 Ogdhem1Yuyi oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. 2021-05-13 2021-05-13 1561359 Ogdh Rnor_5.0 14 87376110 87442862 +
126925168 Ogdhem1Yuyi oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. 2021-05-13 2021-05-13 1561359 Ogdh Rnor_6.0 14 86414924 86481903 +
13792571 Oprl1m1Hubr opioid related nociceptin receptor 1; ENU induced mutant1, Hubr The original mutation was created by target-selected ENU-induced mutagenesis in a Brown Norway background.Then they were subsequently backcrossed on a Wistar (Crl:WI) background. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. 2018-09-13 2018-09-13 68438 Oprl1 RGSC 3.4 3 170869862 170873417 +
13792571 Oprl1m1Hubr opioid related nociceptin receptor 1; ENU induced mutant1, Hubr The original mutation was created by target-selected ENU-induced mutagenesis in a Brown Norway background.Then they were subsequently backcrossed on a Wistar (Crl:WI) background. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. 2018-09-13 2018-09-13 68438 Oprl1 Rnor_5.0 3 180932344 180943574 +
13792571 Oprl1m1Hubr opioid related nociceptin receptor 1; ENU induced mutant1, Hubr The original mutation was created by target-selected ENU-induced mutagenesis in a Brown Norway background.Then they were subsequently backcrossed on a Wistar (Crl:WI) background. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. 2018-09-13 2018-09-13 68438 Oprl1 Rnor_6.0 3 177223779 177231663 +
2302648 Orc3Tn(sb-T2/Bart3)2.275Mcwi origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene 2009-01-06 2009-01-06 1308457 Orc3 RGSC 3.4 5 51172243 51226644 - Orc3lTn(sb-T2/Bart3)2.275Mcwi;Orc3Tn(sb-T2/Bart3)2.275Mcwi;Orc3lTn(sb-T2/Bart3)2.275Mcwi
2302648 Orc3Tn(sb-T2/Bart3)2.275Mcwi origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene 2009-01-06 2009-01-06 1308457 Orc3 Rnor_5.0 5 54588113 54644440 - Orc3lTn(sb-T2/Bart3)2.275Mcwi;Orc3Tn(sb-T2/Bart3)2.275Mcwi;Orc3lTn(sb-T2/Bart3)2.275Mcwi
2302648 Orc3Tn(sb-T2/Bart3)2.275Mcwi origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene 2009-01-06 2009-01-06 1308457 Orc3 Rnor_6.0 5 50019159 50075533 - Orc3lTn(sb-T2/Bart3)2.275Mcwi;Orc3Tn(sb-T2/Bart3)2.275Mcwi;Orc3lTn(sb-T2/Bart3)2.275Mcwi
1642173 Oxtrm1Mcwi oxytocin receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F225Y mutation is generated from the codon change TTC/TAC 2007-09-06 2007-09-06 3239 Oxtr RGSC 3.4 4 148314089 148326797 - Oxtrm1Mcwi
1642173 Oxtrm1Mcwi oxytocin receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F225Y mutation is generated from the codon change TTC/TAC 2007-09-06 2007-09-06 3239 Oxtr Rnor_5.0 4 207701360 207717840 - Oxtrm1Mcwi
1642173 Oxtrm1Mcwi oxytocin receptor; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); F225Y mutation is generated from the codon change TTC/TAC 2007-09-06 2007-09-06 3239 Oxtr Rnor_6.0 4 144399326 144417598 - Oxtrm1Mcwi
11553876 P2rx1em1Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. 2016-10-17 2016-10-17 3240 P2rx1 RGSC 3.4 10 59889933 59904985 + P2rx1em1Mcwi
11553876 P2rx1em1Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. 2016-10-17 2016-10-17 3240 P2rx1 Rnor_5.0 10 59305737 59320797 + P2rx1em1Mcwi
11553876 P2rx1em1Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. 2016-10-17 2016-10-17 3240 P2rx1 Rnor_6.0 10 59566268 59581328 + P2rx1em1Mcwi
12790677 P2rx1em6Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. 2017-02-20 2017-02-20 3240 P2rx1 RGSC 3.4 10 59889933 59904985 + P2rx1em6Mcwi
12790677 P2rx1em6Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. 2017-02-20 2017-02-20 3240 P2rx1 Rnor_5.0 10 59305737 59320797 + P2rx1em6Mcwi
12790677 P2rx1em6Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. 2017-02-20 2017-02-20 3240 P2rx1 Rnor_6.0 10 59566268 59581328 + P2rx1em6Mcwi
13207510 P2rx1em7Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. 2017-08-03 2017-08-03 3240 P2rx1 RGSC 3.4 10 59889933 59904985 + P2rx1em7Mcwi
13207510 P2rx1em7Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. 2017-08-03 2017-08-03 3240 P2rx1 Rnor_5.0 10 59305737 59320797 + P2rx1em7Mcwi
13207510 P2rx1em7Mcwi purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. 2017-08-03 2017-08-03 3240 P2rx1 Rnor_6.0 10 59566268 59581328 + P2rx1em7Mcwi
13792805 P2rx7em10Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2. 2018-09-28 2018-09-28 3241 P2rx7 RGSC 3.4 12 35074025 35117152 - purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi
13792805 P2rx7em10Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41804060 41808755 - purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi
13792805 P2rx7em10Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41242368 41284797 - purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi
13792805 P2rx7em10Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_6.0 12 39353613 39396042 - purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi
13792802 P2rx7em12Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. 2018-09-28 2018-09-28 3241 P2rx7 RGSC 3.4 12 35074025 35117152 -
13792802 P2rx7em12Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41242368 41284797 -
13792802 P2rx7em12Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41804060 41808755 -
13792802 P2rx7em12Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. 2018-09-28 2018-09-28 3241 P2rx7 Rnor_6.0 12 39353613 39396042 -
13792806 P2rx7em13Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 2018-09-28 2018-09-28 3241 P2rx7 RGSC 3.4 12 35074025 35117152 -
13792806 P2rx7em13Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41804060 41808755 -
13792806 P2rx7em13Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 2018-09-28 2018-09-28 3241 P2rx7 Rnor_5.0 12 41242368 41284797 -
13792806 P2rx7em13Mcwi purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 2018-09-28 2018-09-28 3241 P2rx7 Rnor_6.0 12 39353613 39396042 -
329955460 P2rx7em1Tja purinergic receptor P2X 7; ZFN induced mutant 1, Tja This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10 2023-07-12 2023-07-12 3241 P2rx7 RGSC 3.4 12 35074025 35117152 -
329955460 P2rx7em1Tja purinergic receptor P2X 7; ZFN induced mutant 1, Tja This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10 2023-07-12 2023-07-12 3241 P2rx7 Rnor_5.0 12 41242368 41284797 -
329955460 P2rx7em1Tja purinergic receptor P2X 7; ZFN induced mutant 1, Tja This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10 2023-07-12 2023-07-12 3241 P2rx7 Rnor_5.0 12 41804060 41808755 -
329955460 P2rx7em1Tja purinergic receptor P2X 7; ZFN induced mutant 1, Tja This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10 2023-07-12 2023-07-12 3241 P2rx7 Rnor_6.0 12 39353613 39396042 -
12790680 P2rx7em8Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. 2017-02-20 2017-02-20 3241 P2rx7 RGSC 3.4 12 35074025 35117152 - purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus;P2rx7em8Mcwi
12790680 P2rx7em8Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. 2017-02-20 2017-02-20 3241 P2rx7 Rnor_5.0 12 41242368 41284797 - purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus;P2rx7em8Mcwi
12790680 P2rx7em8Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. 2017-02-20 2017-02-20 3241 P2rx7 Rnor_5.0 12 41804060 41808755 - purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus;P2rx7em8Mcwi
12790680 P2rx7em8Mcwi purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. 2017-02-20 2017-02-20 3241 P2rx7 Rnor_6.0 12 39353613 39396042 - purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus;P2rx7em8Mcwi
13800870 P2ry2em6Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 RGSC 3.4 1 158440018 158454213 -
13800870 P2ry2em6Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 Rnor_5.0 1 172227726 172241921 -
13800870 P2ry2em6Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 Rnor_6.0 1 166031228 166045423 -
13800873 P2ry2em7Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 RGSC 3.4 1 158440018 158454213 -
13800873 P2ry2em7Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 Rnor_5.0 1 172227726 172241921 -
13800873 P2ry2em7Mcwi purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. 2018-10-18 2018-10-18 62088 P2ry2 Rnor_6.0 1 166031228 166045423 -
2304195 P3h3Tn(sb-T2/Bart3)2.310Mcwi prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene 2009-03-10 2009-03-10 1305699 P3h3 RGSC 3.4 4 160964297 160978321 - Leprel2Tn(sb-T2/Bart3)2.310Mcwi;leprecan-like 2; transposon insertion 2.310, Medical College of Wisconsin;Leprel2Tn(sb-T2/Bart3)2.310Mcwi;P3h3Tn(sb-T2/Bart3)2.310Mcwi
2304195 P3h3Tn(sb-T2/Bart3)2.310Mcwi prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene 2009-03-10 2009-03-10 1305699 P3h3 Rnor_5.0 4 224377005 224392881 - Leprel2Tn(sb-T2/Bart3)2.310Mcwi;leprecan-like 2; transposon insertion 2.310, Medical College of Wisconsin;Leprel2Tn(sb-T2/Bart3)2.310Mcwi;P3h3Tn(sb-T2/Bart3)2.310Mcwi
2304195 P3h3Tn(sb-T2/Bart3)2.310Mcwi prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene 2009-03-10 2009-03-10 1305699 P3h3 Rnor_6.0 4 157359331 157375186 - Leprel2Tn(sb-T2/Bart3)2.310Mcwi;leprecan-like 2; transposon insertion 2.310, Medical College of Wisconsin;Leprel2Tn(sb-T2/Bart3)2.310Mcwi;P3h3Tn(sb-T2/Bart3)2.310Mcwi
2314336 PalldTn(sb-T2/Bart3)2.341Mcwi palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene 2009-11-11 2009-11-11 1359390 Palldl1 RGSC 3.4 16 31144028 31144544 + transposon insertion 2.341, Medical College of Wisconsin;LOC290704Tn(sb-T2/Bart3)2.341Mcwi;similar to palladin;PalldTn(sb-T2/Bart3)2.341Mcwi
2314336 PalldTn(sb-T2/Bart3)2.341Mcwi palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene 2009-11-11 2009-11-11 1359390 Palldl1 Rnor_5.0 16 31198863 31240064 + transposon insertion 2.341, Medical College of Wisconsin;LOC290704Tn(sb-T2/Bart3)2.341Mcwi;similar to palladin;PalldTn(sb-T2/Bart3)2.341Mcwi
2314336 PalldTn(sb-T2/Bart3)2.341Mcwi palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene 2009-11-11 2009-11-11 1359390 Palldl1 Rnor_6.0 16 31349140 31390340 + transposon insertion 2.341, Medical College of Wisconsin;LOC290704Tn(sb-T2/Bart3)2.341Mcwi;similar to palladin;PalldTn(sb-T2/Bart3)2.341Mcwi
13204758 Pappa2em4Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2. 2017-07-18 2017-07-18 1591785 Pappa2 RGSC 3.4 13 74286881 74379736 - Pappa2em4Mcwi
13204758 Pappa2em4Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2. 2017-07-18 2017-07-18 1591785 Pappa2 Rnor_5.0 13 81303663 81574402 - Pappa2em4Mcwi
13204758 Pappa2em4Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2. 2017-07-18 2017-07-18 1591785 Pappa2 Rnor_6.0 13 76389150 76660248 - Pappa2em4Mcwi
13204789 Pappa2em5Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2. 2017-07-19 2017-07-19 1591785 Pappa2 RGSC 3.4 13 74286881 74379736 - Pappa2em5Mcwi
13204789 Pappa2em5Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2. 2017-07-19 2017-07-19 1591785 Pappa2 Rnor_5.0 13 81303663 81574402 - Pappa2em5Mcwi
13204789 Pappa2em5Mcwi pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2. 2017-07-19 2017-07-19 1591785 Pappa2 Rnor_6.0 13 76389150 76660248 - Pappa2em5Mcwi
7241042 Park7em1Sage parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA) 2013-02-25 2013-02-25 621808 Park7 RGSC 3.4 5 168050149 168061616 - Park7em1Sage
7241042 Park7em1Sage parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA) 2013-02-25 2013-02-25 621808 Park7 Rnor_5.0 5 171559202 171582476 - Park7em1Sage
7241042 Park7em1Sage parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA) 2013-02-25 2013-02-25 621808 Park7 Rnor_6.0 5 167982438 168004724 - Park7em1Sage
2314335 PatjTn(sb-T2/Bart3)2.343Mcwi PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene 2009-11-11 2009-11-11 1565362 Patj RGSC 3.4 5 118806744 119131114 + InadlTn(sb-T2/Bart3)2.343Mcwi;InaD-like (Drosophila); transposon insertion 2.343, Medical College of Wisconsin;InadlTn(sb-T2/Bart3)2.343Mcwi;PatjTn(sb-T2/Bart3)2.343Mcwi
2314335 PatjTn(sb-T2/Bart3)2.343Mcwi PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene 2009-11-11 2009-11-11 1565362 Patj Rnor_5.0 5 120981525 121281044 + InadlTn(sb-T2/Bart3)2.343Mcwi;InaD-like (Drosophila); transposon insertion 2.343, Medical College of Wisconsin;InadlTn(sb-T2/Bart3)2.343Mcwi;PatjTn(sb-T2/Bart3)2.343Mcwi
2314335 PatjTn(sb-T2/Bart3)2.343Mcwi PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene 2009-11-11 2009-11-11 1565362 Patj Rnor_6.0 5 117038548 117340308 + InadlTn(sb-T2/Bart3)2.343Mcwi;InaD-like (Drosophila); transposon insertion 2.343, Medical College of Wisconsin;InadlTn(sb-T2/Bart3)2.343Mcwi;PatjTn(sb-T2/Bart3)2.343Mcwi
12790970 Pax6Sey2 paired box gene 6, small eye mutation 2 Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. 2017-02-23 2017-02-23 3258 Pax6 RGSC 3.4 3 91127605 91149178 + Pax6Sey2;rsey2
12790970 Pax6Sey2 paired box gene 6, small eye mutation 2 Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. 2017-02-23 2017-02-23 3258 Pax6 Rnor_5.0 3 102320059 102348223 + Pax6Sey2;rsey2
12790970 Pax6Sey2 paired box gene 6, small eye mutation 2 Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. 2017-02-23 2017-02-23 3258 Pax6 Rnor_6.0 3 95700241 95728682 + Pax6Sey2;rsey2
737688 Pax6Sey paired box gene 6, small eye mutation Genomic DNA analysis from mutants revealed a single base (G) insertion generating a novel 5' donor splice site. Abnormal splicing between this donor site and a non-conforming downstream acceptor site led to an internal 602-bp deletion in the Pax6 mRNA, removing approximately 1/3 of the 3' end of the coding region and part of the 3'-UTR. The mutation results in nose and eye defects in Sprague Dawley (SD) rats. 2004-02-23 2004-12-14 3258 Pax6 RGSC 3.4 3 91127605 91149178 + Pax6Sey
737688 Pax6Sey paired box gene 6, small eye mutation Genomic DNA analysis from mutants revealed a single base (G) insertion generating a novel 5' donor splice site. Abnormal splicing between this donor site and a non-conforming downstream acceptor site led to an internal 602-bp deletion in the Pax6 mRNA, removing approximately 1/3 of the 3' end of the coding region and part of the 3'-UTR. The mutation results in nose and eye defects in Sprague Dawley (SD) rats. 2004-02-23 2004-12-14 3258 Pax6 Rnor_5.0 3 102320059 102348223 + Pax6Sey
737688 Pax6Sey paired box gene 6, small eye mutation Genomic DNA analysis from mutants revealed a single base (G) insertion generating a novel 5' donor splice site. Abnormal splicing between this donor site and a non-conforming downstream acceptor site led to an internal 602-bp deletion in the Pax6 mRNA, removing approximately 1/3 of the 3' end of the coding region and part of the 3'-UTR. The mutation results in nose and eye defects in Sprague Dawley (SD) rats. 2004-02-23 2004-12-14 3258 Pax6 Rnor_6.0 3 95700241 95728682 + Pax6Sey
626419692 Pbkem1Dfult PDZ binding kinase; endonuclease induced mutant 1, Dfult CRISPR-Cas9 technology was used to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. 2025-09-05 2025-09-05 1309565 Pbk RGSC 3.4 15 45227251 45238096 +
626419692 Pbkem1Dfult PDZ binding kinase; endonuclease induced mutant 1, Dfult CRISPR-Cas9 technology was used to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. 2025-09-05 2025-09-05 1309565 Pbk Rnor_5.0 15 49092278 49103401 -
626419692 Pbkem1Dfult PDZ binding kinase; endonuclease induced mutant 1, Dfult CRISPR-Cas9 technology was used to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. 2025-09-05 2025-09-05 1309565 Pbk Rnor_6.0 15 42489253 42500377 +
41408340 PcloTn(sb-B-Geo)Fkh presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh Transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rats. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame, 2021-02-09 2021-02-09 69406 Pclo RGSC 3.4 4 15911051 16269090 - PcloTn(sb)Fkh
41408340 PcloTn(sb-B-Geo)Fkh presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh Transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rats. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame, 2021-02-09 2021-02-09 69406 Pclo Rnor_5.0 4 16923700 17031648 - PcloTn(sb)Fkh
41408340 PcloTn(sb-B-Geo)Fkh presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh Transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rats. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame, 2021-02-09 2021-02-09 69406 Pclo Rnor_5.0 4 16428814 16661584 - PcloTn(sb)Fkh
41408340 PcloTn(sb-B-Geo)Fkh presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh Transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rats. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame, 2021-02-09 2021-02-09 69406 Pclo Rnor_6.0 4 16454904 17058921 - PcloTn(sb)Fkh
5687695 Pdcem2Mcwi phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 5 (del 489-502) 2012-02-09 2012-02-09 3277 Pdc RGSC 3.4 13 64622473 64636031 + Pdcem2Mcwi
5687695 Pdcem2Mcwi phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 5 (del 489-502) 2012-02-09 2012-02-09 3277 Pdc Rnor_5.0 13 72510251 72523421 + Pdcem2Mcwi
5687695 Pdcem2Mcwi phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 5 (del 489-502) 2012-02-09 2012-02-09 3277 Pdc Rnor_6.0 13 67545430 67558600 + Pdcem2Mcwi
5687712 Pdcem3Mcwi phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 47-bp deletion in exon 5 (del 450-501, ins. Catcg) 2012-02-09 2012-09-12 3277 Pdc RGSC 3.4 13 64622473 64636031 + Pdcem3Mcwi
5687712 Pdcem3Mcwi phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 47-bp deletion in exon 5 (del 450-501, ins. Catcg) 2012-02-09 2012-09-12 3277 Pdc Rnor_5.0 13 72510251 72523421 + Pdcem3Mcwi
5687712 Pdcem3Mcwi phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a net 47-bp deletion in exon 5 (del 450-501, ins. Catcg) 2012-02-09 2012-09-12 3277 Pdc Rnor_6.0 13 67545430 67558600 + Pdcem3Mcwi
155631294 Pde3aem1Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). 2022-10-31 2022-10-31 61942 Pde3a RGSC 3.4 4 178658896 178930417 +
155631294 Pde3aem1Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). 2022-10-31 2022-10-31 61942 Pde3a Rnor_5.0 4 239659270 239921900 +
155631294 Pde3aem1Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). 2022-10-31 2022-10-31 61942 Pde3a Rnor_6.0 4 175431904 175703844 +
155631296 Pde3aem2Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein 2022-10-31 2022-10-31 61942 Pde3a RGSC 3.4 4 178658896 178930417 +
155631296 Pde3aem2Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein 2022-10-31 2022-10-31 61942 Pde3a Rnor_5.0 4 239659270 239921900 +
155631296 Pde3aem2Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein 2022-10-31 2022-10-31 61942 Pde3a Rnor_6.0 4 175431904 175703844 +
155631299 Pde3aem3Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGT missense mutation and results in R862C substitutions in the protein 2022-10-31 2022-10-31 61942 Pde3a RGSC 3.4 4 178658896 178930417 +
155631299 Pde3aem3Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGT missense mutation and results in R862C substitutions in the protein 2022-10-31 2022-10-31 61942 Pde3a Rnor_5.0 4 239659270 239921900 +
155631299 Pde3aem3Bdr phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGT missense mutation and results in R862C substitutions in the protein 2022-10-31 2022-10-31 61942 Pde3a Rnor_6.0 4 175431904 175703844 +
13782129 Pde4bem1Sage phosphodiesterase 4B; ZFN induced mutant1, Sage These gene was generated using a pair of zinc finger nucleases targeting exon 1 of the rat PDE4B gene, and the 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 was verified by genomic DNA sequencing. 2018-08-22 2018-08-22 3280 Pde4b RGSC 3.4 5 123158156 123533877 +
13782129 Pde4bem1Sage phosphodiesterase 4B; ZFN induced mutant1, Sage These gene was generated using a pair of zinc finger nucleases targeting exon 1 of the rat PDE4B gene, and the 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 was verified by genomic DNA sequencing. 2018-08-22 2018-08-22 3280 Pde4b Rnor_5.0 5 125623815 126001128 +
13782129 Pde4bem1Sage phosphodiesterase 4B; ZFN induced mutant1, Sage These gene was generated using a pair of zinc finger nucleases targeting exon 1 of the rat PDE4B gene, and the 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 was verified by genomic DNA sequencing. 2018-08-22 2018-08-22 3280 Pde4b Rnor_6.0 5 121759236 122136814 +
2302644 Pde4dTn(sb-T2/Bart3)2.285Mcwi phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene 2009-01-06 2009-01-06 3281 Pde4d RGSC 3.4 2 40196097 41311012 + Pde4dTn(sb-T2/Bart3)2.285Mcwi
2302644 Pde4dTn(sb-T2/Bart3)2.285Mcwi phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene 2009-01-06 2009-01-06 3281 Pde4d Rnor_5.0 2 60035104 60521358 + Pde4dTn(sb-T2/Bart3)2.285Mcwi
2302644 Pde4dTn(sb-T2/Bart3)2.285Mcwi phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene 2009-01-06 2009-01-06 3281 Pde4d Rnor_5.0 2 59292847 59860049 + Pde4dTn(sb-T2/Bart3)2.285Mcwi
2302644 Pde4dTn(sb-T2/Bart3)2.285Mcwi phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene 2009-01-06 2009-01-06 3281 Pde4d Rnor_6.0 2 40219999 41468551 + Pde4dTn(sb-T2/Bart3)2.285Mcwi
2290151 Pde5aTn(sb-T2/Bart3)2.144Mcwi phosphodiesterase 5A, cGMP-specific; transposon insertion 2.144, Medical College of Wisconsin trap construct into the 4th intron of the Pde5a gene 2008-02-26 2008-02-26 620995 Pde5a RGSC 3.4 2 219410394 219550910 + Pde5aTn(sb-T2/Bart3)2.144Mcwi
2290151 Pde5aTn(sb-T2/Bart3)2.144Mcwi phosphodiesterase 5A, cGMP-specific; transposon insertion 2.144, Medical College of Wisconsin trap construct into the 4th intron of the Pde5a gene 2008-02-26 2008-02-26 620995 Pde5a Rnor_5.0 2 246260843 246406296 + Pde5aTn(sb-T2/Bart3)2.144Mcwi
2290151 Pde5aTn(sb-T2/Bart3)2.144Mcwi phosphodiesterase 5A, cGMP-specific; transposon insertion 2.144, Medical College of Wisconsin trap construct into the 4th intron of the Pde5a gene 2008-02-26 2008-02-26 620995 Pde5a Rnor_6.0 2 226899604 227044916 + Pde5aTn(sb-T2/Bart3)2.144Mcwi
42721979 Pde6bem1Baek phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek Cpf1-CRISPR system was injected to SD embryos to induced an 11-bp deletion in exon 1 of rat Pde6b. 2021-02-25 2021-02-25 1311039 Pde6b RGSC 3.4 14 1871037 1914170 -
42721979 Pde6bem1Baek phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek Cpf1-CRISPR system was injected to SD embryos to induced an 11-bp deletion in exon 1 of rat Pde6b. 2021-02-25 2021-02-25 1311039 Pde6b Rnor_5.0 14 2327104 2370811 -
42721979 Pde6bem1Baek phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek Cpf1-CRISPR system was injected to SD embryos to induced an 11-bp deletion in exon 1 of rat Pde6b. 2021-02-25 2021-02-25 1311039 Pde6b Rnor_6.0 14 2328690 2371913 -
155631290 Pde6bem1Cgen phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen The rat Pde6b knock out allele was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. 2022-10-31 2022-10-31 1311039 Pde6b RGSC 3.4 14 1871037 1914170 -
155631290 Pde6bem1Cgen phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen The rat Pde6b knock out allele was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. 2022-10-31 2022-10-31 1311039 Pde6b Rnor_5.0 14 2327104 2370811 -
155631290 Pde6bem1Cgen phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen The rat Pde6b knock out allele was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. 2022-10-31 2022-10-31 1311039 Pde6b Rnor_6.0 14 2328690 2371913 -
2303096 Pebp4Tn(sb-T2/Bart3)2.299Mcwi phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene 2009-02-02 2009-02-02 1593295 Pebp4 RGSC 3.4 15 50225405 50460627 + Pebp4Tn(sb-T2/Bart3)2.299Mcwi
2303096 Pebp4Tn(sb-T2/Bart3)2.299Mcwi phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene 2009-02-02 2009-02-02 1593295 Pebp4 Rnor_5.0 15 55252902 55466149 + Pebp4Tn(sb-T2/Bart3)2.299Mcwi
2303096 Pebp4Tn(sb-T2/Bart3)2.299Mcwi phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene 2009-02-02 2009-02-02 1593295 Pebp4 Rnor_6.0 15 51528587 51615204 + Pebp4Tn(sb-T2/Bart3)2.299Mcwi
2303096 Pebp4Tn(sb-T2/Bart3)2.299Mcwi phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene 2009-02-02 2009-02-02 1593295 Pebp4 Rnor_6.0 15 51644948 51740626 + Pebp4Tn(sb-T2/Bart3)2.299Mcwi
626419682 Peg3em1Soar paternally expressed 3; endonuclease induced mutant 1, Soar Crispr/Cas9 genome editing of the Peg3 gene 2025-09-05 2025-09-05 2323590 Peg3 RGSC 3.4 1 65513912 65526040 +
626419682 Peg3em1Soar paternally expressed 3; endonuclease induced mutant 1, Soar Crispr/Cas9 genome editing of the Peg3 gene 2025-09-05 2025-09-05 2323590 Peg3 Rnor_6.0 1 70210810 70237450 +
629006643 Per1em1Smoc period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc CRISPR/Cas9 system was used to generate a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter in Sprague Dawley (Charles River) rat embryos. 2025-11-11 2025-11-11 727863 Per1 RGSC 3.4 10 55859851 55868747 + Per1 (c.‐3353_‐3345delTGACGTCA) Smoc
629006643 Per1em1Smoc period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc CRISPR/Cas9 system was used to generate a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter in Sprague Dawley (Charles River) rat embryos. 2025-11-11 2025-11-11 727863 Per1 Rnor_5.0 10 55424863 55439853 + Per1 (c.‐3353_‐3345delTGACGTCA) Smoc
629006643 Per1em1Smoc period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc CRISPR/Cas9 system was used to generate a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter in Sprague Dawley (Charles River) rat embryos. 2025-11-11 2025-11-11 727863 Per1 Rnor_6.0 10 55681761 55696557 + Per1 (c.‐3353_‐3345delTGACGTCA) Smoc
13825148 Per1em3Mcwi period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. 2018-11-19 2018-11-19 727863 Per1 RGSC 3.4 10 55859851 55868747 +
13825148 Per1em3Mcwi period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. 2018-11-19 2018-11-19 727863 Per1 Rnor_5.0 10 55424863 55439853 +
13825148 Per1em3Mcwi period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. 2018-11-19 2018-11-19 727863 Per1 Rnor_6.0 10 55681761 55696557 +
626469578 Phlda2em1Soar pleckstrin homology-like domain, family A, member 2; em1, Soar Crispr/Cas9 mediated 103 bp deletion within Exon 1 of the Phlda2 gene 2025-09-16 2025-09-16 1304755 Phlda2 RGSC 3.4 1 203878093 203879038 -
626469578 Phlda2em1Soar pleckstrin homology-like domain, family A, member 2; em1, Soar Crispr/Cas9 mediated 103 bp deletion within Exon 1 of the Phlda2 gene 2025-09-16 2025-09-16 1304755 Phlda2 Rnor_5.0 1 223562616 223564645 -
626469578 Phlda2em1Soar pleckstrin homology-like domain, family A, member 2; em1, Soar Crispr/Cas9 mediated 103 bp deletion within Exon 1 of the Phlda2 gene 2025-09-16 2025-09-16 1304755 Phlda2 Rnor_6.0 1 216701345 216704479 -
7241046 Pink1em1Sage PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC) 2013-02-25 2013-02-25 1305769 Pink1 RGSC 3.4 5 157091181 157103293 - Pink1em1Sage
7241046 Pink1em1Sage PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC) 2013-02-25 2013-02-25 1305769 Pink1 Rnor_5.0 5 160425715 160437827 - Pink1em1Sage
7241046 Pink1em1Sage PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC) 2013-02-25 2013-02-25 1305769 Pink1 Rnor_6.0 5 156677146 156689258 - Pink1em1Sage
730454552 Pirtem1Luozd phosphoinositide-interacting regulator of transient receptor potential channels; CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce the Cre recombinase coding region into the endogenous ATG start site of the rat Pirt gene 2026-05-26 2026-05-26 1565284 Pirt RGSC 3.4 10 53617910 53633542 +
730454552 Pirtem1Luozd phosphoinositide-interacting regulator of transient receptor potential channels; CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce the Cre recombinase coding region into the endogenous ATG start site of the rat Pirt gene 2026-05-26 2026-05-26 1565284 Pirt Rnor_5.0 10 53218153 53236283 +
730454552 Pirtem1Luozd phosphoinositide-interacting regulator of transient receptor potential channels; CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce the Cre recombinase coding region into the endogenous ATG start site of the rat Pirt gene 2026-05-26 2026-05-26 1565284 Pirt Rnor_6.0 10 53466870 53485096 +
10054434 Pkd1em1Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 RGSC 3.4 10 13801445 13848212 + Pkd1em1Mcwi
10054434 Pkd1em1Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_5.0 10 13731035 13778993 + Pkd1em1Mcwi
10054434 Pkd1em1Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_6.0 10 13914057 13962008 + Pkd1em1Mcwi
10054428 Pkd1em2Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 RGSC 3.4 10 13801445 13848212 + Pkd1em2Mcwi
10054428 Pkd1em2Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_5.0 10 13731035 13778993 + Pkd1em2Mcwi
10054428 Pkd1em2Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_6.0 10 13914057 13962008 + Pkd1em2Mcwi
10054431 Pkd1em3Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 12-bp deletion in the Pkd1 gene 2015-08-06 2017-01-24 3333 Pkd1 RGSC 3.4 10 13801445 13848212 + Pkd1em3Mcwi
10054431 Pkd1em3Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 12-bp deletion in the Pkd1 gene 2015-08-06 2017-01-24 3333 Pkd1 Rnor_5.0 10 13731035 13778993 + Pkd1em3Mcwi
10054431 Pkd1em3Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 12-bp deletion in the Pkd1 gene 2015-08-06 2017-01-24 3333 Pkd1 Rnor_6.0 10 13914057 13962008 + Pkd1em3Mcwi
10054437 Pkd1em6Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 RGSC 3.4 10 13801445 13848212 + Pkd1em6Mcwi
10054437 Pkd1em6Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_5.0 10 13731035 13778993 + Pkd1em6Mcwi
10054437 Pkd1em6Mcwi polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene 2015-08-06 2016-10-19 3333 Pkd1 Rnor_6.0 10 13914057 13962008 + Pkd1em6Mcwi
11535943 Pkhd1pck polycystic kidney and hepatic disease 1,polycystic kidney disease This allele is a spontaneously deletion mutant developed in a female rat with polycysts on both kidney and liver in the colony of Crj:CD (SD) rats. The mutation was a splicing change, IVS35-2A>T that caused skipping of the 157-bp exon36, leading to a frame shift. 2016-09-22 2016-09-22 1308476 Pkhd1 RGSC 3.4 9 18833903 19338716 - Pkdh1pck;Pkhd1pck
11535943 Pkhd1pck polycystic kidney and hepatic disease 1,polycystic kidney disease This allele is a spontaneously deletion mutant developed in a female rat with polycysts on both kidney and liver in the colony of Crj:CD (SD) rats. The mutation was a splicing change, IVS35-2A>T that caused skipping of the 157-bp exon36, leading to a frame shift. 2016-09-22 2016-09-22 1308476 Pkhd1 Rnor_5.0 9 25025958 25065045 - Pkdh1pck;Pkhd1pck
11535943 Pkhd1pck polycystic kidney and hepatic disease 1,polycystic kidney disease This allele is a spontaneously deletion mutant developed in a female rat with polycysts on both kidney and liver in the colony of Crj:CD (SD) rats. The mutation was a splicing change, IVS35-2A>T that caused skipping of the 157-bp exon36, leading to a frame shift. 2016-09-22 2016-09-22 1308476 Pkhd1 Rnor_5.0 9 25159062 25593163 - Pkdh1pck;Pkhd1pck
11535943 Pkhd1pck polycystic kidney and hepatic disease 1,polycystic kidney disease This allele is a spontaneously deletion mutant developed in a female rat with polycysts on both kidney and liver in the colony of Crj:CD (SD) rats. The mutation was a splicing change, IVS35-2A>T that caused skipping of the 157-bp exon36, leading to a frame shift. 2016-09-22 2016-09-22 1308476 Pkhd1 Rnor_6.0 9 26164969 26736704 - Pkdh1pck;Pkhd1pck
736705838 Plac1em1Soar placenta enriched 1; CRISPR/Cas9 induced mutant 1, Soar A 469 bp deletion within exon 3 of rat Plac1 was generated in Holtzman Sprague Dawley embryos using CRISPR/Cas9 system. 2026-07-01 2026-07-01 1563777 Plac1 RGSC 3.4 X 140014910 140055813 -
736705838 Plac1em1Soar placenta enriched 1; CRISPR/Cas9 induced mutant 1, Soar A 469 bp deletion within exon 3 of rat Plac1 was generated in Holtzman Sprague Dawley embryos using CRISPR/Cas9 system. 2026-07-01 2026-07-01 1563777 Plac1 Rnor_5.0 X 152508501 152758813 +
736705838 Plac1em1Soar placenta enriched 1; CRISPR/Cas9 induced mutant 1, Soar A 469 bp deletion within exon 3 of rat Plac1 was generated in Holtzman Sprague Dawley embryos using CRISPR/Cas9 system. 2026-07-01 2026-07-01 1563777 Plac1 Rnor_6.0 X 157931450 158133506 +
11561974 Plcb1Tn(pb-Bhr2)1Wmukf phospholipase C beta 1;Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into Plcb1 gene. 2016-11-15 2016-11-15 3344 Plcb1 RGSC 3.4 3 122797718 123523675 + Plcb1Tn(pb-Bhr2)1Wmukf
11561974 Plcb1Tn(pb-Bhr2)1Wmukf phospholipase C beta 1;Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into Plcb1 gene. 2016-11-15 2016-11-15 3344 Plcb1 Rnor_5.0 3 134211557 134908321 + Plcb1Tn(pb-Bhr2)1Wmukf
11561974 Plcb1Tn(pb-Bhr2)1Wmukf phospholipase C beta 1;Bhr2 transposon insertion 1, Wmukf Transposon "Bhr2" was inserted into Plcb1 gene. 2016-11-15 2016-11-15 3344 Plcb1 Rnor_6.0 3 127721244 128419565 + Plcb1Tn(pb-Bhr2)1Wmukf
2290155 Plcb3Tn(sb-T2/Bart3)2.69Mcwi phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene 2008-02-26 2008-02-26 61993 Plcb3 RGSC 3.4 1 209628425 209643694 - Plcb3Tn(sb-T2/Bart3)2.69Mcwi
2290155 Plcb3Tn(sb-T2/Bart3)2.69Mcwi phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene 2008-02-26 2008-02-26 61993 Plcb3 Rnor_5.0 1 229198739 229215831 - Plcb3Tn(sb-T2/Bart3)2.69Mcwi
2290155 Plcb3Tn(sb-T2/Bart3)2.69Mcwi phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene 2008-02-26 2008-02-26 61993 Plcb3 Rnor_6.0 1 222207887 222224993 - Plcb3Tn(sb-T2/Bart3)2.69Mcwi
5143954 Plcd3em4Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor (del 92275081-92275241) 2011-07-27 2011-07-27 1310903 Plcd3 RGSC 3.4 10 92234651 92275433 - Plcd3em4Mcwi
5143954 Plcd3em4Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor (del 92275081-92275241) 2011-07-27 2011-07-27 1310903 Plcd3 Rnor_5.0 10 90937117 90958001 - Plcd3em4Mcwi
5143954 Plcd3em4Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor (del 92275081-92275241) 2011-07-27 2011-07-27 1310903 Plcd3 Rnor_6.0 10 91164778 91186067 - Plcd3em4Mcwi
5143976 Plcd3em7Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 142-bp deletion, overlapping the start codon (del 68-209) 2011-07-27 2011-07-27 1310903 Plcd3 RGSC 3.4 10 92234651 92275433 - Plcd3em7Mcwi
5143976 Plcd3em7Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 142-bp deletion, overlapping the start codon (del 68-209) 2011-07-27 2011-07-27 1310903 Plcd3 Rnor_5.0 10 90937117 90958001 - Plcd3em7Mcwi
5143976 Plcd3em7Mcwi phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 142-bp deletion, overlapping the start codon (del 68-209) 2011-07-27 2011-07-27 1310903 Plcd3 Rnor_6.0 10 91164778 91186067 - Plcd3em7Mcwi
2290125 Plce1Tn(sb-T2/Bart3)2.146Mcwi phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene 2008-02-26 2008-02-26 69424 Plce1 RGSC 3.4 1 242794858 243103437 + Plce1Tn(sb-T2/Bart3)2.146Mcwi
2290125 Plce1Tn(sb-T2/Bart3)2.146Mcwi phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene 2008-02-26 2008-02-26 69424 Plce1 Rnor_5.0 1 264652842 264956664 + Plce1Tn(sb-T2/Bart3)2.146Mcwi
2290125 Plce1Tn(sb-T2/Bart3)2.146Mcwi phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene 2008-02-26 2008-02-26 69424 Plce1 Rnor_6.0 1 257156023 257465440 + Plce1Tn(sb-T2/Bart3)2.146Mcwi
2313462 Pld5Tn(sb-T2/Bart3)2.340Mcwi phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene 2009-09-28 2009-09-28 1562609 Pld5 RGSC 3.4 13 91715000 92058036 - Pld5Tn(sb-T2/Bart3)2.340Mcwi
2313462 Pld5Tn(sb-T2/Bart3)2.340Mcwi phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene 2009-09-28 2009-09-28 1562609 Pld5 Rnor_5.0 13 98486317 98812030 - Pld5Tn(sb-T2/Bart3)2.340Mcwi
2313462 Pld5Tn(sb-T2/Bart3)2.340Mcwi phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene 2009-09-28 2009-09-28 1562609 Pld5 Rnor_6.0 13 94025696 94355219 - Pld5Tn(sb-T2/Bart3)2.340Mcwi
5143978 Plekha7em1Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 635-650) 2011-07-27 2011-07-27 1598216 Plekha7 RGSC 3.4 1 174249022 174316226 - Plekha7em1Mcwi
5143978 Plekha7em1Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 635-650) 2011-07-27 2011-07-27 1598216 Plekha7 Rnor_5.0 1 192397589 192463974 + Plekha7em1Mcwi
5143978 Plekha7em1Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 635-650) 2011-07-27 2011-07-27 1598216 Plekha7 Rnor_6.0 1 185427600 185493985 + Plekha7em1Mcwi
5143979 Plekha7em4Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 8 (del 638-656) 2011-07-27 2011-07-27 1598216 Plekha7 RGSC 3.4 1 174249022 174316226 - Plekha7em4Mcwi
5143979 Plekha7em4Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 8 (del 638-656) 2011-07-27 2011-07-27 1598216 Plekha7 Rnor_5.0 1 192397589 192463974 + Plekha7em4Mcwi
5143979 Plekha7em4Mcwi pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 8 (del 638-656) 2011-07-27 2011-07-27 1598216 Plekha7 Rnor_6.0 1 185427600 185493985 + Plekha7em4Mcwi
5131960 Plod1em1Mcwi procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 764-773). 2011-05-17 2011-05-17 621382 Plod1 RGSC 3.4 5 164987252 165012581 - Plod1em1Mcwi
5131960 Plod1em1Mcwi procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 764-773). 2011-05-17 2011-05-17 621382 Plod1 Rnor_5.0 5 168379092 168405534 - Plod1em1Mcwi
5131960 Plod1em1Mcwi procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 764-773). 2011-05-17 2011-05-17 621382 Plod1 Rnor_6.0 5 164720629 164747071 - Plod1em1Mcwi
12802346 Plp1md proteolipid protein 1; Myelin-deficient A naturally occurring missense mutation (p.T75P) arising in Wistar rats. It is a transversion(A>C) mutation located on exon 3 of Plp1 gene. 2017-04-05 2017-04-05 3354 Plp1 RGSC 3.4 X 124488627 124503639 + Plp1md
12802346 Plp1md proteolipid protein 1; Myelin-deficient A naturally occurring missense mutation (p.T75P) arising in Wistar rats. It is a transversion(A>C) mutation located on exon 3 of Plp1 gene. 2017-04-05 2017-04-05 3354 Plp1 Rnor_5.0 X 107379831 107394881 + Plp1md
12802346 Plp1md proteolipid protein 1; Myelin-deficient A naturally occurring missense mutation (p.T75P) arising in Wistar rats. It is a transversion(A>C) mutation located on exon 3 of Plp1 gene. 2017-04-05 2017-04-05 3354 Plp1 Rnor_6.0 X 107494326 107511355 + Plp1md
2299105 Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene 2008-08-12 2008-08-12 1306289 Plpp4 RGSC 3.4 1 188518590 188643804 + Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi
2299105 Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene 2008-08-12 2008-08-12 1306289 Plpp4 Rnor_5.0 1 209449940 209577459 + Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi
2299105 Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene 2008-08-12 2008-08-12 1306289 Plpp4 Rnor_6.0 1 202432366 202560628 + Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi
150429964 Pmchm1Hubr pro-melanin-concentrating hormone; ENU induced mutant1, Hubr The Pmch mutant allele was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. 2021-10-07 2021-10-07 3358 Pmch RGSC 3.4 7 24778133 24779449 +
150429964 Pmchm1Hubr pro-melanin-concentrating hormone; ENU induced mutant1, Hubr The Pmch mutant allele was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. 2021-10-07 2021-10-07 3358 Pmch Rnor_5.0 7 28764993 28766309 +
150429964 Pmchm1Hubr pro-melanin-concentrating hormone; ENU induced mutant1, Hubr The Pmch mutant allele was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. 2021-10-07 2021-10-07 3358 Pmch Rnor_6.0 7 28655206 28656522 +
1642176 Podxlm1Mcwi podocalyxin-like; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T154A mutation is generated from the codon change ACA/GCA 2007-09-06 2007-09-06 621878 Podxl RGSC 3.4 4 58611904 58658598 - Podxlm1Mcwi
1642176 Podxlm1Mcwi podocalyxin-like; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T154A mutation is generated from the codon change ACA/GCA 2007-09-06 2007-09-06 621878 Podxl Rnor_5.0 4 58581513 58645671 - Podxlm1Mcwi
1642176 Podxlm1Mcwi podocalyxin-like; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T154A mutation is generated from the codon change ACA/GCA 2007-09-06 2007-09-06 621878 Podxl Rnor_6.0 4 58829049 58893353 - Podxlm1Mcwi
124715481 Pon1em1Lizh paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-Dawley embryos. 2021-03-26 2021-03-26 620062 Pon1 RGSC 3.4 4 29936314 29964821 -
124715481 Pon1em1Lizh paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-Dawley embryos. 2021-03-26 2021-03-26 620062 Pon1 Rnor_5.0 4 30156712 30183204 -
124715481 Pon1em1Lizh paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-Dawley embryos. 2021-03-26 2021-03-26 620062 Pon1 Rnor_6.0 4 30249749 30276297 -
12790693 Pon1em1Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 620062 Pon1 RGSC 3.4 4 29936314 29964821 - Pon1em1Mcwi
12790693 Pon1em1Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 620062 Pon1 Rnor_5.0 4 30156712 30183204 - Pon1em1Mcwi
12790693 Pon1em1Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 620062 Pon1 Rnor_6.0 4 30249749 30276297 - Pon1em1Mcwi
12790696 Pon1em2Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 RGSC 3.4 4 29936314 29964821 - Pon1em2Mcwi
12790696 Pon1em2Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 Rnor_5.0 4 30156712 30183204 - Pon1em2Mcwi
12790696 Pon1em2Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 Rnor_6.0 4 30249749 30276297 - Pon1em2Mcwi
12790699 Pon1em3Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 RGSC 3.4 4 29936314 29964821 - Pon1em3Mcwi
12790699 Pon1em3Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 Rnor_5.0 4 30156712 30183204 - Pon1em3Mcwi
12790699 Pon1em3Mcwi paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. 2017-02-20 2017-07-21 620062 Pon1 Rnor_6.0 4 30249749 30276297 - Pon1em3Mcwi
12790703 Pon3em1Mcwi paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 1302965 Pon3 RGSC 3.4 4 30000505 30027203 - Pon3em1Mcwi
12790703 Pon3em1Mcwi paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 1302965 Pon3 Rnor_5.0 4 30218888 30245586 - Pon3em1Mcwi
12790703 Pon3em1Mcwi paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. 2017-02-20 2017-02-20 1302965 Pon3 Rnor_6.0 4 30311981 30338679 - Pon3em1Mcwi
6893424 Ppargem1Mcwi peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 2012-08-28 2012-08-28 3371 Pparg RGSC 3.4 4 151492220 151617331 + Ppargem1Mcwi
6893424 Ppargem1Mcwi peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 2012-08-28 2012-08-28 3371 Pparg Rnor_5.0 4 210562928 210688585 + Ppargem1Mcwi
6893424 Ppargem1Mcwi peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 2012-08-28 2012-08-28 3371 Pparg Rnor_6.0 4 147274055 147399383 + Ppargem1Mcwi
127285617 Ppargm1Kyo peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo This mutant allele was induced by ENU in F344/NSlc. It is a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg.The Pparg homozygous rats are embryonic lethal. 2021-06-22 2021-06-22 3371 Pparg RGSC 3.4 4 151492220 151617331 +
127285617 Ppargm1Kyo peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo This mutant allele was induced by ENU in F344/NSlc. It is a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg.The Pparg homozygous rats are embryonic lethal. 2021-06-22 2021-06-22 3371 Pparg Rnor_5.0 4 210562928 210688585 +
127285617 Ppargm1Kyo peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo This mutant allele was induced by ENU in F344/NSlc. It is a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg.The Pparg homozygous rats are embryonic lethal. 2021-06-22 2021-06-22 3371 Pparg Rnor_6.0 4 147274055 147399383 +
2313459 Ppfia2Tn(sb-T2/Bart3)2.339Mcwi protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene 2009-09-28 2009-09-28 1305021 Ppfia2 RGSC 3.4 7 45140154 45616620 + Ppfia2Tn(sb-T2/Bart3)2.339Mcwi
2313459 Ppfia2Tn(sb-T2/Bart3)2.339Mcwi protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene 2009-09-28 2009-09-28 1305021 Ppfia2 Rnor_5.0 7 48658858 49058116 + Ppfia2Tn(sb-T2/Bart3)2.339Mcwi
2313459 Ppfia2Tn(sb-T2/Bart3)2.339Mcwi protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene 2009-09-28 2009-09-28 1305021 Ppfia2 Rnor_5.0 7 48563521 48568045 + Ppfia2Tn(sb-T2/Bart3)2.339Mcwi
2313459 Ppfia2Tn(sb-T2/Bart3)2.339Mcwi protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene 2009-09-28 2009-09-28 1305021 Ppfia2 Rnor_6.0 7 48548932 49045852 + Ppfia2Tn(sb-T2/Bart3)2.339Mcwi
2299104 Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene 2008-08-12 2008-08-12 631441 Ppp2r2b RGSC 3.4 18 35865837 36318308 - Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi
2299104 Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene 2008-08-12 2008-08-12 631441 Ppp2r2b Rnor_5.0 18 36647298 37076455 - Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi
2299104 Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene 2008-08-12 2008-08-12 631441 Ppp2r2b Rnor_6.0 18 36985709 37421383 - Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi
41457453 Prdm14em10Nips PR/SET domain 14; CRISPR/Cas9 system induced mutant 1, Nips Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. 2021-02-24 2021-02-25 2319590 Prdm14 Rnor_5.0 5 10550222 10570255 + Prdm14em1Nips
41457453 Prdm14em10Nips PR/SET domain 14; CRISPR/Cas9 system induced mutant 1, Nips Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. 2021-02-24 2021-02-25 2319590 Prdm14 Rnor_6.0 5 5710076 5730560 + Prdm14em1Nips
126781696 Prdm14tm1(H2BVenus)Nips PR/SET domain 14; targeted mutant 1, Nips Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by Lipofectamin 2000. Founder animals were backcrossed to Crlj:WI. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype 2021-04-15 2021-04-15 2319590 Prdm14 Rnor_5.0 5 10550222 10570255 +
126781696 Prdm14tm1(H2BVenus)Nips PR/SET domain 14; targeted mutant 1, Nips Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by Lipofectamin 2000. Founder animals were backcrossed to Crlj:WI. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype 2021-04-15 2021-04-15 2319590 Prdm14 Rnor_6.0 5 5710076 5730560 +
5687719 Prex1em2Mcwi phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 16 (del 1872-1885) 2012-02-09 2012-02-09 1306534 Prex1 RGSC 3.4 3 157693897 157863943 - Prex1em2Mcwi
5687719 Prex1em2Mcwi phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 16 (del 1872-1885) 2012-02-09 2012-02-09 1306534 Prex1 Rnor_5.0 3 169494331 169575981 - Prex1em2Mcwi
5687719 Prex1em2Mcwi phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 16 (del 1872-1885) 2012-02-09 2012-02-09 1306534 Prex1 Rnor_6.0 3 163329580 163477822 - Prex1em2Mcwi
150519902 Prkar1bem1Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b RGSC 3.4 12 16025867 16131129 +
150519902 Prkar1bem1Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b Rnor_5.0 12 19611694 19708682 +
150519902 Prkar1bem1Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b Rnor_6.0 12 17614536 17713567 +
150519903 Prkar1bem2Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 13-bp frameshift ideletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b RGSC 3.4 12 16025867 16131129 +
150519903 Prkar1bem2Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 13-bp frameshift ideletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b Rnor_5.0 12 19611694 19708682 +
150519903 Prkar1bem2Tua protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 13-bp frameshift ideletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 2021-10-15 2021-10-15 3392 Prkar1b Rnor_6.0 12 17614536 17713567 +
12910095 Prkdcem1Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo This ZFN induced mutant allele contains a 46-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc RGSC 3.4 11 86951420 87169229 - Prkdcem1Kyo
12910095 Prkdcem1Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo This ZFN induced mutant allele contains a 46-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_5.0 11 92347175 92565022 - Prkdcem1Kyo
12910095 Prkdcem1Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo This ZFN induced mutant allele contains a 46-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_6.0 11 89293547 89510948 - Prkdcem1Kyo
151232284 Prkdcem1Sage protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage The ZFN induced mutation was identified by a 872-bp PCR fragment vs 1627-bp in wild type animals. 2022-01-13 2022-01-13 1308982 Prkdc RGSC 3.4 11 86951420 87169229 -
151232284 Prkdcem1Sage protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage The ZFN induced mutation was identified by a 872-bp PCR fragment vs 1627-bp in wild type animals. 2022-01-13 2022-01-13 1308982 Prkdc Rnor_5.0 11 92347175 92565022 -
151232284 Prkdcem1Sage protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage The ZFN induced mutation was identified by a 872-bp PCR fragment vs 1627-bp in wild type animals. 2022-01-13 2022-01-13 1308982 Prkdc Rnor_6.0 11 89293547 89510948 -
12910096 Prkdcem2Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo This ZFN induced mutant allele contains a 227-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc RGSC 3.4 11 86951420 87169229 - Prkdcem2Kyo
12910096 Prkdcem2Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo This ZFN induced mutant allele contains a 227-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_5.0 11 92347175 92565022 - Prkdcem2Kyo
12910096 Prkdcem2Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo This ZFN induced mutant allele contains a 227-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_6.0 11 89293547 89510948 - Prkdcem2Kyo
12910098 Prkdcem4Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo This ZFN induced mutant allele contains a 20-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc RGSC 3.4 11 86951420 87169229 - Prkdcem4Kyo
12910098 Prkdcem4Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo This ZFN induced mutant allele contains a 20-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_5.0 11 92347175 92565022 - Prkdcem4Kyo
12910098 Prkdcem4Kyo protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo This ZFN induced mutant allele contains a 20-bp deletion in the exon1 of Prkdc gene. 2017-06-08 2017-06-08 1308982 Prkdc Rnor_6.0 11 89293547 89510948 - Prkdcem4Kyo
7241041 Prknem1Sage parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT) 2013-02-25 2013-02-25 61797 Prkn RGSC 3.4 1 43151265 44374470 - Park2em1Sage;Park2em1Sage;Prkn em1Sage;Prkn em1Sage
7241041 Prknem1Sage parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT) 2013-02-25 2013-02-25 61797 Prkn Rnor_5.0 1 49684308 50875397 + Park2em1Sage;Park2em1Sage;Prkn em1Sage;Prkn em1Sage
7241041 Prknem1Sage parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT) 2013-02-25 2013-02-25 61797 Prkn Rnor_6.0 1 48880015 50069998 - Park2em1Sage;Park2em1Sage;Prkn em1Sage;Prkn em1Sage
401900751 Prl7b1em1Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus 2023-11-21 2023-11-21 708582 Prl7b1 RGSC 3.4 17 43783328 43791541 +
401900751 Prl7b1em1Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus 2023-11-21 2023-11-21 708582 Prl7b1 Rnor_5.0 17 41012487 41020700 +
401900751 Prl7b1em1Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus 2023-11-21 2023-11-21 708582 Prl7b1 Rnor_6.0 17 39153431 39161644 +
401900752 Prl7b1tm1(cre)Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. 2023-11-21 2023-11-21 708582 Prl7b1 RGSC 3.4 17 43783328 43791541 +
401900752 Prl7b1tm1(cre)Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. 2023-11-21 2023-11-21 708582 Prl7b1 Rnor_5.0 17 41012487 41020700 +
401900752 Prl7b1tm1(cre)Soar prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. 2023-11-21 2023-11-21 708582 Prl7b1 Rnor_6.0 17 39153431 39161644 +
1578790 Procm1Mcwi protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L312P mutation is generated 2006-05-02 2006-05-02 3411 Proc RGSC 3.4 18 24563368 24573715 - Procm1Mcwi
1578790 Procm1Mcwi protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L312P mutation is generated 2006-05-02 2006-05-02 3411 Proc Rnor_5.0 18 24633206 24643623 - Procm1Mcwi
1578790 Procm1Mcwi protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); L312P mutation is generated 2006-05-02 2006-05-02 3411 Proc Rnor_6.0 18 24918402 24928822 - Procm1Mcwi
5131948 Prokr1em1Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 2 (del 748-758). 2011-05-17 2011-05-17 708443 Prokr1 RGSC 3.4 4 121750651 121758116 - Prokr1em1Mcwi
5131948 Prokr1em1Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 2 (del 748-758). 2011-05-17 2011-05-17 708443 Prokr1 Rnor_5.0 4 183939201 183949822 - Prokr1em1Mcwi
5131948 Prokr1em1Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 2 (del 748-758). 2011-05-17 2011-05-17 708443 Prokr1 Rnor_6.0 4 119375790 119386551 - Prokr1em1Mcwi
5131947 Prokr1em2Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 126-bp frameshift deletion in exon 2 (del 636-761). 2011-05-17 2011-05-17 708443 Prokr1 RGSC 3.4 4 121750651 121758116 - Prokr1em2Mcwi
5131947 Prokr1em2Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 126-bp frameshift deletion in exon 2 (del 636-761). 2011-05-17 2011-05-17 708443 Prokr1 Rnor_5.0 4 183939201 183949822 - Prokr1em2Mcwi
5131947 Prokr1em2Mcwi prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 126-bp frameshift deletion in exon 2 (del 636-761). 2011-05-17 2011-05-17 708443 Prokr1 Rnor_6.0 4 119375790 119386551 - Prokr1em2Mcwi
40818256 Prr5em1Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 RGSC 3.4 7 122693577 122714377 +
40818256 Prr5em1Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 Rnor_5.0 7 125317939 125338782 +
40818256 Prr5em1Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 Rnor_6.0 7 125569791 125609340 +
40818255 Prr5em2Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 RGSC 3.4 7 122693577 122714377 +
40818255 Prr5em2Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 Rnor_5.0 7 125317939 125338782 +
40818255 Prr5em2Mcwi proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. 2020-11-16 2020-11-16 1307954 Prr5 Rnor_6.0 7 125569791 125609340 +
2299112 Prr5lTn(sb-T2/Bart3)2.228Mcwi proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. 2008-08-12 2008-08-12 1309969 Prr5l RGSC 3.4 3 86868129 86948468 - RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;Prr5lTn(sb-T2/Bart3)2.228Mcwi
2299112 Prr5lTn(sb-T2/Bart3)2.228Mcwi proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. 2008-08-12 2008-08-12 1309969 Prr5l Rnor_5.0 3 97950297 98119477 - RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;Prr5lTn(sb-T2/Bart3)2.228Mcwi
2299112 Prr5lTn(sb-T2/Bart3)2.228Mcwi proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. 2008-08-12 2008-08-12 1309969 Prr5l Rnor_6.0 3 91290207 91461208 - RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;RGD1309969Tn(sb-T2/Bart3)2.228Mcwi;Prr5lTn(sb-T2/Bart3)2.228Mcwi
5508341 Pruneem1Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 198-bp deletion in the 5' URT and exon 1 (v3.4 del 190192348-190192545) 2011-10-13 2011-10-13 1359521 Prune1 RGSC 3.4 2 190165356 190192807 - Pruneem1Mcwi
5508341 Pruneem1Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 198-bp deletion in the 5' URT and exon 1 (v3.4 del 190192348-190192545) 2011-10-13 2011-10-13 1359521 Prune1 Rnor_5.0 2 215924545 215954221 - Pruneem1Mcwi
5508341 Pruneem1Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 198-bp deletion in the 5' URT and exon 1 (v3.4 del 190192348-190192545) 2011-10-13 2011-10-13 1359521 Prune1 Rnor_6.0 2 196427714 196457105 - Pruneem1Mcwi
5508348 Pruneem3Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 130-bp frameshift deletion in exon 1 (del 237-268) 2011-10-13 2011-10-13 1359521 Prune1 RGSC 3.4 2 190165356 190192807 - Pruneem3Mcwi
5508348 Pruneem3Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 130-bp frameshift deletion in exon 1 (del 237-268) 2011-10-13 2011-10-13 1359521 Prune1 Rnor_5.0 2 215924545 215954221 - Pruneem3Mcwi
5508348 Pruneem3Mcwi prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 130-bp frameshift deletion in exon 1 (del 237-268) 2011-10-13 2011-10-13 1359521 Prune1 Rnor_6.0 2 196427714 196457105 - Pruneem3Mcwi
11568063 Ptenem1Sage phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. 2016-12-07 2016-12-07 61995 Pten RGSC 3.4 1 236771027 236837261 + Ptenem1Sage
11568063 Ptenem1Sage phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. 2016-12-07 2016-12-07 61995 Pten Rnor_5.0 1 258651829 258717009 + Ptenem1Sage
11568063 Ptenem1Sage phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. 2016-12-07 2016-12-07 61995 Pten Rnor_6.0 1 251421814 251487634 + Ptenem1Sage
13208843 Ptgs2em1Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 RGSC 3.4 13 64427288 64432978 + Ptgs2em1Mcwi
13208843 Ptgs2em1Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 Rnor_5.0 13 72315959 72324483 + Ptgs2em1Mcwi
13208843 Ptgs2em1Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 Rnor_6.0 13 67351230 67356920 + Ptgs2em1Mcwi
13208845 Ptgs2em2Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 RGSC 3.4 13 64427288 64432978 + Ptgs2em2Mcwi
13208845 Ptgs2em2Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 Rnor_5.0 13 72315959 72324483 + Ptgs2em2Mcwi
13208845 Ptgs2em2Mcwi prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 4 in the Ptgs2 gene. 2017-08-21 2017-08-21 620349 Ptgs2 Rnor_6.0 13 67351230 67356920 + Ptgs2em2Mcwi
13792810 Ptk2bem1Mcwi protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. 2018-10-01 2018-10-01 628758 Ptk2b RGSC 3.4 15 45589222 45717866 -
13792810 Ptk2bem1Mcwi protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. 2018-10-01 2018-10-01 628758 Ptk2b Rnor_5.0 15 48646476 48766708 +
13792810 Ptk2bem1Mcwi protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. 2018-10-01 2018-10-01 628758 Ptk2b Rnor_6.0 15 42827306 42947796 -
5131970 Ptpn11em1Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 4 (del 624-640). 2011-05-17 2011-05-17 3447 Ptpn11 RGSC 3.4 12 36501886 36558055 + Ptpn11em1Mcwi
5131970 Ptpn11em1Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 4 (del 624-640). 2011-05-17 2011-05-17 3447 Ptpn11 Rnor_5.0 12 42762630 42822760 + Ptpn11em1Mcwi
5131970 Ptpn11em1Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 4 (del 624-640). 2011-05-17 2011-05-17 3447 Ptpn11 Rnor_6.0 12 40895515 40955999 + Ptpn11em1Mcwi
5131969 Ptpn11em4Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 84-bp frameshift deletion in exon 4 (del 570-653). 2011-05-17 2011-05-17 3447 Ptpn11 RGSC 3.4 12 36501886 36558055 + Ptpn11em4Mcwi
5131969 Ptpn11em4Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 84-bp frameshift deletion in exon 4 (del 570-653). 2011-05-17 2011-05-17 3447 Ptpn11 Rnor_5.0 12 42762630 42822760 + Ptpn11em4Mcwi
5131969 Ptpn11em4Mcwi protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 84-bp frameshift deletion in exon 4 (del 570-653). 2011-05-17 2011-05-17 3447 Ptpn11 Rnor_6.0 12 40895515 40955999 + Ptpn11em4Mcwi
2301698 PtpraTn(sb-T2/Bart3)2.261Mcwi protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene 2008-10-29 2008-10-29 3450 Ptpra RGSC 3.4 3 118061713 118171300 + PtpraTn(sb-T2/Bart3)2.261Mcwi
2301698 PtpraTn(sb-T2/Bart3)2.261Mcwi protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene 2008-10-29 2008-10-29 3450 Ptpra Rnor_5.0 3 129475237 129582992 + PtpraTn(sb-T2/Bart3)2.261Mcwi
2301698 PtpraTn(sb-T2/Bart3)2.261Mcwi protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene 2008-10-29 2008-10-29 3450 Ptpra Rnor_6.0 3 122976066 123084585 + PtpraTn(sb-T2/Bart3)2.261Mcwi
2299097 PtpreTn(sb-T2/Bart3)236Mcwi protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene 2008-08-12 2008-08-12 620771 Ptpre RGSC 3.4 1 195263489 195303249 + PtpreTn(sb-T2/Bart3)236Mcwi
2299097 PtpreTn(sb-T2/Bart3)236Mcwi protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene 2008-08-12 2008-08-12 620771 Ptpre Rnor_5.0 1 214818446 214920034 + PtpreTn(sb-T2/Bart3)236Mcwi
2299097 PtpreTn(sb-T2/Bart3)236Mcwi protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene 2008-08-12 2008-08-12 620771 Ptpre Rnor_6.0 1 207820719 207987123 + PtpreTn(sb-T2/Bart3)236Mcwi
14694849 Pvalbem1(flpo)Berke parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. ) 2019-06-17 2019-06-17 3457 Pvalb RGSC 3.4 7 116115034 116127508 -
14694849 Pvalbem1(flpo)Berke parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. ) 2019-06-17 2019-06-17 3457 Pvalb Rnor_5.0 7 119420581 119435235 -
14694849 Pvalbem1(flpo)Berke parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. ) 2019-06-17 2019-06-17 3457 Pvalb Rnor_6.0 7 119428657 119443674 -
2304198 RGD1563503Tn(sb-T2/Bart3)2.313Mcwi similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503 2009-03-10 2009-03-10 1563503 RGD1563503 RGSC 3.4 17 21066144 21067040 - RGD1563503Tn(sb-T2/Bart3)2.313Mcwi
2304198 RGD1563503Tn(sb-T2/Bart3)2.313Mcwi similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503 2009-03-10 2009-03-10 1563503 RGD1563503 Rnor_5.0 17 17584757 17585688 - RGD1563503Tn(sb-T2/Bart3)2.313Mcwi
2304198 RGD1563503Tn(sb-T2/Bart3)2.313Mcwi similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503 2009-03-10 2009-03-10 1563503 RGD1563503 Rnor_6.0 17 15526295 15527253 - RGD1563503Tn(sb-T2/Bart3)2.313Mcwi
2292447 RGD1564304Tn(sb-T2/Bart3)2.201Mcwi RGD1564304; transposon insertion 2.201, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene 2008-04-18 2008-04-18 1564304 RGD1564304 RGD1564304Tn(sb-T2/Bart3)2.201Mcwi
2304193 RGD1565323Tn(sb-T2/Bart3)2.312Mcwi similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323 2009-03-10 2009-03-10 1565323 RGD1565323 RGSC 3.4 17 38022396 38039975 + RGD1565323Tn(sb-T2/Bart3)2.312Mcwi
2304193 RGD1565323Tn(sb-T2/Bart3)2.312Mcwi similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323 2009-03-10 2009-03-10 1565323 RGD1565323 Rnor_5.0 17 34865901 34882646 + RGD1565323Tn(sb-T2/Bart3)2.312Mcwi
2304193 RGD1565323Tn(sb-T2/Bart3)2.312Mcwi similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323 2009-03-10 2009-03-10 1565323 RGD1565323 Rnor_6.0 17 32973695 32990440 + RGD1565323Tn(sb-T2/Bart3)2.312Mcwi
4139867 Rab38em1Mcwi RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 1 (del 155). 2010-08-19 2010-08-19 628752 Rab38 RGSC 3.4 1 144783919 144864573 + Rab38em1Mcwi
4139867 Rab38em1Mcwi RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 1 (del 155). 2010-08-19 2010-08-19 628752 Rab38 Rnor_5.0 1 158385888 158466621 + Rab38em1Mcwi
4139867 Rab38em1Mcwi RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 1 (del 155). 2010-08-19 2010-08-19 628752 Rab38 Rnor_6.0 1 152072716 152153449 + Rab38em1Mcwi
1600311 Rab38ru Rab38, member of RAS oncogene family, ruby allele The Met1Ile mutation in the Rab38 gene abolishes the translation of the gene resulting in a hypopigmentation phenotype 2007-03-07 2007-03-07 628752 Rab38 RGSC 3.4 1 144783919 144864573 + R_mapped;R;red eyed dilution;Ruby;Ruby or red eyed dilution;ruby or red eyed dilution (mapped);IMAGE:7099841;MGC:91458;Rab38ru
1600311 Rab38ru Rab38, member of RAS oncogene family, ruby allele The Met1Ile mutation in the Rab38 gene abolishes the translation of the gene resulting in a hypopigmentation phenotype 2007-03-07 2007-03-07 628752 Rab38 Rnor_5.0 1 158385888 158466621 + R_mapped;R;red eyed dilution;Ruby;Ruby or red eyed dilution;ruby or red eyed dilution (mapped);IMAGE:7099841;MGC:91458;Rab38ru
1600311 Rab38ru Rab38, member of RAS oncogene family, ruby allele The Met1Ile mutation in the Rab38 gene abolishes the translation of the gene resulting in a hypopigmentation phenotype 2007-03-07 2007-03-07 628752 Rab38 Rnor_6.0 1 152072716 152153449 + R_mapped;R;red eyed dilution;Ruby;Ruby or red eyed dilution;ruby or red eyed dilution (mapped);IMAGE:7099841;MGC:91458;Rab38ru
7204135 Rag1em1Ang recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon This mutant allele was made by zinc finger nuclease mutagenesis using meganucleases recognizing the 22-bp DNA sequence (nt731â¿¿752) in exon 2 of the Rag1 gene. This allele showed a 5-bp deletion due to the deletion of 8-bp and insertion of 3-bp that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 2012-12-17 2018-06-20 619790 Rag1 RGSC 3.4 3 86780782 86791878 - Rag1em1Ang
7204135 Rag1em1Ang recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon This mutant allele was made by zinc finger nuclease mutagenesis using meganucleases recognizing the 22-bp DNA sequence (nt731â¿¿752) in exon 2 of the Rag1 gene. This allele showed a 5-bp deletion due to the deletion of 8-bp and insertion of 3-bp that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 2012-12-17 2018-06-20 619790 Rag1 Rnor_5.0 3 97866048 97877145 - Rag1em1Ang
7204135 Rag1em1Ang recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon This mutant allele was made by zinc finger nuclease mutagenesis using meganucleases recognizing the 22-bp DNA sequence (nt731â¿¿752) in exon 2 of the Rag1 gene. This allele showed a 5-bp deletion due to the deletion of 8-bp and insertion of 3-bp that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 2012-12-17 2018-06-20 619790 Rag1 Rnor_6.0 3 91206394 91217491 - Rag1em1Ang
4139865 Rag1em1Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 681-693). 2010-08-19 2010-08-19 619790 Rag1 RGSC 3.4 3 86780782 86791878 - Rag1em1Mcwi
4139865 Rag1em1Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 681-693). 2010-08-19 2010-08-19 619790 Rag1 Rnor_5.0 3 97866048 97877145 - Rag1em1Mcwi
4139865 Rag1em1Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 681-693). 2010-08-19 2010-08-19 619790 Rag1 Rnor_6.0 3 91206394 91217491 - Rag1em1Mcwi
12904901 Rag1em1Sage recombination activating 1; ZFN induced mutant 1, Sage This ZFN mutant allele has a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. 2017-05-24 2017-05-24 619790 Rag1 RGSC 3.4 3 86780782 86791878 - Rag1 tm1sage;recombination activating 1; endonuclease induced mutant 1, Sage;Rag1em1Sage
12904901 Rag1em1Sage recombination activating 1; ZFN induced mutant 1, Sage This ZFN mutant allele has a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. 2017-05-24 2017-05-24 619790 Rag1 Rnor_5.0 3 97866048 97877145 - Rag1 tm1sage;recombination activating 1; endonuclease induced mutant 1, Sage;Rag1em1Sage
12904901 Rag1em1Sage recombination activating 1; ZFN induced mutant 1, Sage This ZFN mutant allele has a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. 2017-05-24 2017-05-24 619790 Rag1 Rnor_6.0 3 91206394 91217491 - Rag1 tm1sage;recombination activating 1; endonuclease induced mutant 1, Sage;Rag1em1Sage
7204132 Rag1em1Ztm recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp deletion in exon 2 (del 5246-5249). 2012-12-17 2012-12-17 619790 Rag1 RGSC 3.4 3 86780782 86791878 - Rag1em1Ztm
7204132 Rag1em1Ztm recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp deletion in exon 2 (del 5246-5249). 2012-12-17 2012-12-17 619790 Rag1 Rnor_5.0 3 97866048 97877145 - Rag1em1Ztm
7204132 Rag1em1Ztm recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp deletion in exon 2 (del 5246-5249). 2012-12-17 2012-12-17 619790 Rag1 Rnor_6.0 3 91206394 91217491 - Rag1em1Ztm
4139866 Rag1em2Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 1 (del 687-703). 2010-08-19 2010-08-19 619790 Rag1 RGSC 3.4 3 86780782 86791878 - Rag1em2Mcwi
4139866 Rag1em2Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 1 (del 687-703). 2010-08-19 2010-08-19 619790 Rag1 Rnor_5.0 3 97866048 97877145 - Rag1em2Mcwi
4139866 Rag1em2Mcwi recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 1 (del 687-703). 2010-08-19 2010-08-19 619790 Rag1 Rnor_6.0 3 91206394 91217491 - Rag1em2Mcwi
629096379 Rag1em6Mcwi recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi The allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. 2025-12-02 2025-12-02 619790 Rag1 RGSC 3.4 3 86780782 86791878 -
629096379 Rag1em6Mcwi recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi The allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. 2025-12-02 2025-12-02 619790 Rag1 Rnor_5.0 3 97866048 97877145 -
629096379 Rag1em6Mcwi recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi The allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. 2025-12-02 2025-12-02 619790 Rag1 Rnor_6.0 3 91206394 91217491 -
38599191 Rag2em1Iexas recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. 2020-09-14 2020-09-14 1305588 Rag2 RGSC 3.4 3 86764810 86773438 +
38599191 Rag2em1Iexas recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. 2020-09-14 2020-09-14 1305588 Rag2 Rnor_5.0 3 97851318 97859615 +
38599191 Rag2em1Iexas recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. 2020-09-14 2020-09-14 1305588 Rag2 Rnor_6.0 3 91191837 91200134 +
12790714 Rag2em1Mcwi recombination activating 2;mutant 1, Medical College of Wisconsin The mutant allele is a 8-bp deletion in exon 2 of Rag2 gene. 2017-02-21 2017-02-21 1305588 Rag2 RGSC 3.4 3 86764810 86773438 + Rag2em1Mcwi
12790714 Rag2em1Mcwi recombination activating 2;mutant 1, Medical College of Wisconsin The mutant allele is a 8-bp deletion in exon 2 of Rag2 gene. 2017-02-21 2017-02-21 1305588 Rag2 Rnor_5.0 3 97851318 97859615 + Rag2em1Mcwi
12790714 Rag2em1Mcwi recombination activating 2;mutant 1, Medical College of Wisconsin The mutant allele is a 8-bp deletion in exon 2 of Rag2 gene. 2017-02-21 2017-02-21 1305588 Rag2 Rnor_6.0 3 91191837 91200134 + Rag2em1Mcwi
12904904 Rag2em1Sage recombination activating 2; ZFN induced mutant1, Sage This ZFN mutant allele has a 2 bp deletion within exon 3 of the Rag2 gene. 2017-05-24 2017-05-24 1305588 Rag2 RGSC 3.4 3 86764810 86773438 + Rag2 tm1sage;recombination activating 2; endonuclease induced mutant1, Sage;Rag2em1Sage
12904904 Rag2em1Sage recombination activating 2; ZFN induced mutant1, Sage This ZFN mutant allele has a 2 bp deletion within exon 3 of the Rag2 gene. 2017-05-24 2017-05-24 1305588 Rag2 Rnor_5.0 3 97851318 97859615 + Rag2 tm1sage;recombination activating 2; endonuclease induced mutant1, Sage;Rag2em1Sage
12904904 Rag2em1Sage recombination activating 2; ZFN induced mutant1, Sage This ZFN mutant allele has a 2 bp deletion within exon 3 of the Rag2 gene. 2017-05-24 2017-05-24 1305588 Rag2 Rnor_6.0 3 91191837 91200134 + Rag2 tm1sage;recombination activating 2; endonuclease induced mutant1, Sage;Rag2em1Sage
645123289 Rag2em2Hera recombination activating 2;endonuclease induced mutant 2, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying an eight base pair deletion (atatggcc) in the Rag2 coding exon . 2026-04-16 2026-04-16 1305588 Rag2 RGSC 3.4 3 86764810 86773438 +
645123289 Rag2em2Hera recombination activating 2;endonuclease induced mutant 2, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying an eight base pair deletion (atatggcc) in the Rag2 coding exon . 2026-04-16 2026-04-16 1305588 Rag2 Rnor_5.0 3 97851318 97859615 +
645123289 Rag2em2Hera recombination activating 2;endonuclease induced mutant 2, Hera The endonuclease-mediated genome editing system was used to generate this mutant rat strain carrying an eight base pair deletion (atatggcc) in the Rag2 coding exon . 2026-04-16 2026-04-16 1305588 Rag2 Rnor_6.0 3 91191837 91200134 +
12738366 Rag2em2Mcwi recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 2-bp (GA) deletion in the exon2 of Rag2 gene 2017-02-01 2017-02-01 1305588 Rag2 RGSC 3.4 3 86764810 86773438 + Rag2em2Mcwi
12738366 Rag2em2Mcwi recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 2-bp (GA) deletion in the exon2 of Rag2 gene 2017-02-01 2017-02-01 1305588 Rag2 Rnor_5.0 3 97851318 97859615 + Rag2em2Mcwi
12738366 Rag2em2Mcwi recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 2-bp (GA) deletion in the exon2 of Rag2 gene 2017-02-01 2017-02-01 1305588 Rag2 Rnor_6.0 3 91191837 91200134 + Rag2em2Mcwi
12790711 Rag2em3Mcwi recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 10-bp deletion in the exon2 of Rag2 gene 2017-02-21 2017-02-21 1305588 Rag2 RGSC 3.4 3 86764810 86773438 + Rag2em3Mcwi
12790711 Rag2em3Mcwi recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 10-bp deletion in the exon2 of Rag2 gene 2017-02-21 2017-02-21 1305588 Rag2 Rnor_5.0 3 97851318 97859615 + Rag2em3Mcwi
12790711 Rag2em3Mcwi recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 10-bp deletion in the exon2 of Rag2 gene 2017-02-21 2017-02-21 1305588 Rag2 Rnor_6.0 3 91191837 91200134 + Rag2em3Mcwi
2299098 Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene 2008-08-12 2008-08-12 1308558 Rap1gds1 RGSC 3.4 2 236522381 236638692 - Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi
2299098 Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene 2008-08-12 2008-08-12 1308558 Rap1gds1 Rnor_5.0 2 262787595 262899803 - Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi
2299098 Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene 2008-08-12 2008-08-12 1308558 Rap1gds1 Rnor_6.0 2 244258550 244370983 - Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi
2304197 Rapgef4Tn(sb-T2/Bart3)2.314Mcwi Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene 2009-03-10 2009-03-10 621886 Rapgef4 RGSC 3.4 3 54396312 54717148 + Rapgef4Tn(sb-T2/Bart3)2.314Mcwi
2304197 Rapgef4Tn(sb-T2/Bart3)2.314Mcwi Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene 2009-03-10 2009-03-10 621886 Rapgef4 Rnor_5.0 3 65122705 65409814 + Rapgef4Tn(sb-T2/Bart3)2.314Mcwi
2304197 Rapgef4Tn(sb-T2/Bart3)2.314Mcwi Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene 2009-03-10 2009-03-10 621886 Rapgef4 Rnor_6.0 3 58632338 58925127 + Rapgef4Tn(sb-T2/Bart3)2.314Mcwi
38596341 Rarres2em1Msu retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2. 2020-09-04 2020-09-04 1309874 Rarres2 RGSC 3.4 4 76659507 76662465 -
38596341 Rarres2em1Msu retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2. 2020-09-04 2020-09-04 1309874 Rarres2 Rnor_5.0 4 142869493 142872619 -
38596341 Rarres2em1Msu retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2. 2020-09-04 2020-09-04 1309874 Rarres2 Rnor_6.0 4 78205809 78208956 -
5131968 Rasgrp3em1Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 12 (del 1501-1503, ins. Ttaggtgg). 2011-05-17 2011-05-17 1304612 Rasgrp3 RGSC 3.4 6 19808453 19871923 - Rasgrp3em1Mcwi
5131968 Rasgrp3em1Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 12 (del 1501-1503, ins. Ttaggtgg). 2011-05-17 2011-05-17 1304612 Rasgrp3 Rnor_5.0 6 30966364 31065175 - Rasgrp3em1Mcwi
5131968 Rasgrp3em1Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 12 (del 1501-1503, ins. Ttaggtgg). 2011-05-17 2011-05-17 1304612 Rasgrp3 Rnor_6.0 6 21072634 21171619 - Rasgrp3em1Mcwi
5143946 Rasgrp3em3Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 20-bp frameshift deletion in exon 12 (del 1494-1513) 2011-07-27 2011-07-27 1304612 Rasgrp3 RGSC 3.4 6 19808453 19871923 - Rasgrp3em3Mcwi
5143946 Rasgrp3em3Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 20-bp frameshift deletion in exon 12 (del 1494-1513) 2011-07-27 2011-07-27 1304612 Rasgrp3 Rnor_5.0 6 30966364 31065175 - Rasgrp3em3Mcwi
5143946 Rasgrp3em3Mcwi RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 20-bp frameshift deletion in exon 12 (del 1494-1513) 2011-07-27 2011-07-27 1304612 Rasgrp3 Rnor_6.0 6 21072634 21171619 - Rasgrp3em3Mcwi
7241593 Rbm20m1Mlgw RNA binding motif protein 20; mutation 1, Marion Greaser a deletion in chromosome 1 between bp 260,070,892 and 260,166,363 originally found in Hsd:SD which is responsible for an altered titin isoform expression 2013-03-12 2013-03-12 1307427 Rbm20 RGSC 3.4 1 259905545 260144190 + Rbm20m1Mlgw
7241593 Rbm20m1Mlgw RNA binding motif protein 20; mutation 1, Marion Greaser a deletion in chromosome 1 between bp 260,070,892 and 260,166,363 originally found in Hsd:SD which is responsible for an altered titin isoform expression 2013-03-12 2013-03-12 1307427 Rbm20 Rnor_5.0 1 281783646 282003053 + Rbm20m1Mlgw
7241593 Rbm20m1Mlgw RNA binding motif protein 20; mutation 1, Marion Greaser a deletion in chromosome 1 between bp 260,070,892 and 260,166,363 originally found in Hsd:SD which is responsible for an altered titin isoform expression 2013-03-12 2013-03-12 1307427 Rbm20 Rnor_6.0 1 274391932 274589816 + Rbm20m1Mlgw
11553880 Rbm20em10Mcwi RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2017-07-21 1307427 Rbm20 RGSC 3.4 1 259905545 260144190 + Rbm20em10Mcwi
11553880 Rbm20em10Mcwi RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2017-07-21 1307427 Rbm20 Rnor_5.0 1 281783646 282003053 + Rbm20em10Mcwi
11553880 Rbm20em10Mcwi RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2017-07-21 1307427 Rbm20 Rnor_6.0 1 274391932 274589816 + Rbm20em10Mcwi
11553857 Rbm20em5Mcwi RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene 2016-10-14 2016-10-14 1307427 Rbm20 RGSC 3.4 1 259905545 260144190 + Rbm20em5Mcwi
11553857 Rbm20em5Mcwi RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene 2016-10-14 2016-10-14 1307427 Rbm20 Rnor_5.0 1 281783646 282003053 + Rbm20em5Mcwi
11553857 Rbm20em5Mcwi RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene 2016-10-14 2016-10-14 1307427 Rbm20 Rnor_6.0 1 274391932 274589816 + Rbm20em5Mcwi
11553882 Rbm20em8Mcwi RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2016-10-17 1307427 Rbm20 RGSC 3.4 1 259905545 260144190 + Rbm20em8Mcwi
11553882 Rbm20em8Mcwi RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2016-10-17 1307427 Rbm20 Rnor_5.0 1 281783646 282003053 + Rbm20em8Mcwi
11553882 Rbm20em8Mcwi RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. 2016-10-17 2016-10-17 1307427 Rbm20 Rnor_6.0 1 274391932 274589816 + Rbm20em8Mcwi
4139863 Renem1Mcwi renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 578-587); this causes a truncation of the message from 1451 to 1441 bp leading to a frameshift and premature truncation of the normal open reading frame after codon 185. 2010-08-19 2010-08-19 3554 Ren RGSC 3.4 13 46262936 46275213 + renin;Renem1Mcwi;renem2mcwi;zinc-finger nuclease induced mutant 2, Medical College of Wisconsin
4139863 Renem1Mcwi renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 578-587); this causes a truncation of the message from 1451 to 1441 bp leading to a frameshift and premature truncation of the normal open reading frame after codon 185. 2010-08-19 2010-08-19 3554 Ren Rnor_5.0 13 55555583 55566812 - renin;Renem1Mcwi;renem2mcwi;zinc-finger nuclease induced mutant 2, Medical College of Wisconsin
4139863 Renem1Mcwi renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 578-587); this causes a truncation of the message from 1451 to 1441 bp leading to a frameshift and premature truncation of the normal open reading frame after codon 185. 2010-08-19 2010-08-19 3554 Ren Rnor_6.0 13 50502724 50513953 - renin;Renem1Mcwi;renem2mcwi;zinc-finger nuclease induced mutant 2, Medical College of Wisconsin
5687705 Resp18em2Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 3 (del 375-381) 2012-02-09 2012-02-09 3555 Resp18 RGSC 3.4 9 74551809 74558151 - Resp18em2Mcwi
5687705 Resp18em2Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 3 (del 375-381) 2012-02-09 2012-02-09 3555 Resp18 Rnor_5.0 9 82240055 82246695 - Resp18em2Mcwi
5687705 Resp18em2Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 3 (del 375-381) 2012-02-09 2012-02-09 3555 Resp18 Rnor_6.0 9 82470794 82477136 - Resp18em2Mcwi
5687714 Resp18em3Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 369-381) 2012-02-09 2012-02-09 3555 Resp18 RGSC 3.4 9 74551809 74558151 - Resp18em3Mcwi
5687714 Resp18em3Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 369-381) 2012-02-09 2012-02-09 3555 Resp18 Rnor_5.0 9 82240055 82246695 - Resp18em3Mcwi
5687714 Resp18em3Mcwi regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made using ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 369-381) 2012-02-09 2012-02-09 3555 Resp18 Rnor_6.0 9 82470794 82477136 - Resp18em3Mcwi
40818254 Rictorem4Mcwi RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was injected to the SS/JrHsdMcwi embryo to introduce a 11-bp deletion in exon 19 of rat Rictor gene. 2020-11-16 2020-11-16 1307224 Rictor RGSC 3.4 2 55982784 56071528 +
40818254 Rictorem4Mcwi RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was injected to the SS/JrHsdMcwi embryo to introduce a 11-bp deletion in exon 19 of rat Rictor gene. 2020-11-16 2020-11-16 1307224 Rictor Rnor_5.0 2 75754848 75846705 +
40818254 Rictorem4Mcwi RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi CRISPR/Cas9 system was injected to the SS/JrHsdMcwi embryo to introduce a 11-bp deletion in exon 19 of rat Rictor gene. 2020-11-16 2020-11-16 1307224 Rictor Rnor_6.0 2 56013898 56105818 +
126790548 Rin1em1Hcz Ras and Rab interactor 1; TALEN induced mutant 1, Hcz This allele was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. 2021-04-26 2021-04-26 620006 Rin1 RGSC 3.4 1 207671502 207676150 + Rin1em1-/-Hcz
126790548 Rin1em1Hcz Ras and Rab interactor 1; TALEN induced mutant 1, Hcz This allele was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. 2021-04-26 2021-04-26 620006 Rin1 Rnor_5.0 1 227359504 227364152 + Rin1em1-/-Hcz
126790548 Rin1em1Hcz Ras and Rab interactor 1; TALEN induced mutant 1, Hcz This allele was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. 2021-04-26 2021-04-26 620006 Rin1 Rnor_6.0 1 220335036 220342319 + Rin1em1-/-Hcz
13781891 Rnaset2em1Sage ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. 2018-08-10 2018-08-10 1309918 Rnaset2 RGSC 3.4 1 47227491 47244660 +
13781891 Rnaset2em1Sage ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. 2018-08-10 2018-08-10 1309918 Rnaset2 Rnor_5.0 1 54425133 54442302 +
13781891 Rnaset2em1Sage ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. 2018-08-10 2018-08-10 1309918 Rnaset2 Rnor_6.0 1 53174879 53192048 +
2307439 Robo1Tn(sb-T2/Bart3)2.327Mcwi roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene 2009-06-05 2009-06-05 61941 Robo1 RGSC 3.4 11 10784947 11720646 + Robo1Tn(sb-T2/Bart3)2.327Mcwi
2307439 Robo1Tn(sb-T2/Bart3)2.327Mcwi roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene 2009-06-05 2009-06-05 61941 Robo1 Rnor_5.0 11 13314508 13808775 + Robo1Tn(sb-T2/Bart3)2.327Mcwi
2307439 Robo1Tn(sb-T2/Bart3)2.327Mcwi roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene 2009-06-05 2009-06-05 61941 Robo1 Rnor_6.0 11 9079291 10146302 + Robo1Tn(sb-T2/Bart3)2.327Mcwi
2304199 RorbTn(sb-T2/Bart3)2.304Mcwi RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene 2009-03-10 2009-03-10 1306778 Rorb RGSC 3.4 1 222545682 222726307 - RorbTn(sb-T2/Bart3)2.304Mcwi
2304199 RorbTn(sb-T2/Bart3)2.304Mcwi RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene 2009-03-10 2009-03-10 1306778 Rorb Rnor_5.0 1 241354340 241541103 + RorbTn(sb-T2/Bart3)2.304Mcwi
2304199 RorbTn(sb-T2/Bart3)2.304Mcwi RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene 2009-03-10 2009-03-10 1306778 Rorb Rnor_6.0 1 234252757 234442597 + RorbTn(sb-T2/Bart3)2.304Mcwi
10054442 Rorcem3Mcwi RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Rorc gene 2015-08-06 2016-10-19 1595785 Rorc RGSC 3.4 2 189345134 189369442 + Rorcem3Mcwi
10054442 Rorcem3Mcwi RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Rorc gene 2015-08-06 2016-10-19 1595785 Rorc Rnor_6.0 2 195612471 195636797 + Rorcem3Mcwi
10054445 Rorcem5Mcwi RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 69-bp deletion in the genome and a 9-bp insertion at the deletion site, net 60-bp deletion in the Rorc gene. 2015-08-06 2016-10-19 1595785 Rorc RGSC 3.4 2 189345134 189369442 + Rorcem5Mcwi
10054445 Rorcem5Mcwi RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 69-bp deletion in the genome and a 9-bp insertion at the deletion site, net 60-bp deletion in the Rorc gene. 2015-08-06 2016-10-19 1595785 Rorc Rnor_6.0 2 195612471 195636797 + Rorcem5Mcwi
2290154 Rph3aTn(sb-T2/Bart3)2.104Mcwi rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene 2008-02-26 2008-02-26 620073 Rph3a RGSC 3.4 12 36678613 36753316 + Rph3aTn(sb-T2/Bart3)2.104Mcwi
2290154 Rph3aTn(sb-T2/Bart3)2.104Mcwi rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene 2008-02-26 2008-02-26 620073 Rph3a Rnor_5.0 12 42938832 43014142 + Rph3aTn(sb-T2/Bart3)2.104Mcwi
2290154 Rph3aTn(sb-T2/Bart3)2.104Mcwi rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene 2008-02-26 2008-02-26 620073 Rph3a Rnor_6.0 12 41073296 41149799 + Rph3aTn(sb-T2/Bart3)2.104Mcwi
2299096 Rprd1aTn(sb-T2/Bart3)2.247Mcwi cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. 2008-08-12 2008-08-12 1307374 Rprd1a RGSC 3.4 18 16283291 16328357 - P15rsTn(sb-T2/Bart3)2.247Mcwi;Rprd1aTn(sb-T2/Bart3)2.247Mcwi
2299096 Rprd1aTn(sb-T2/Bart3)2.247Mcwi cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. 2008-08-12 2008-08-12 1307374 Rprd1a Rnor_5.0 18 16209135 16256883 - P15rsTn(sb-T2/Bart3)2.247Mcwi;Rprd1aTn(sb-T2/Bart3)2.247Mcwi
2299096 Rprd1aTn(sb-T2/Bart3)2.247Mcwi cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. 2008-08-12 2008-08-12 1307374 Rprd1a Rnor_6.0 18 16450160 16497913 - P15rsTn(sb-T2/Bart3)2.247Mcwi;Rprd1aTn(sb-T2/Bart3)2.247Mcwi
2305933 Rtn4Tn(sb-T2/Bart3)2.316Mcwi reticulon 4; transposon insertion 2.316, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene 2009-03-16 2009-03-16 620989 Rtn4 RGSC 3.4 14 110725089 110772578 + Rtn4Tn(sb-T2/Bart3)2.316Mcwi
2305933 Rtn4Tn(sb-T2/Bart3)2.316Mcwi reticulon 4; transposon insertion 2.316, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene 2009-03-16 2009-03-16 620989 Rtn4 Rnor_5.0 14 113792257 113839936 + Rtn4Tn(sb-T2/Bart3)2.316Mcwi
2305933 Rtn4Tn(sb-T2/Bart3)2.316Mcwi reticulon 4; transposon insertion 2.316, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene 2009-03-16 2009-03-16 620989 Rtn4 Rnor_6.0 14 114126931 114174459 + Rtn4Tn(sb-T2/Bart3)2.316Mcwi
126781694 Sall1em1Nips spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 RGSC 3.4 19 19277337 19293298 +
126781694 Sall1em1Nips spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 Rnor_5.0 19 34377838 34395131 +
126781694 Sall1em1Nips spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 Rnor_6.0 19 23387737 23405025 +
126781695 Sall1tm4(tdTomato)Nips spalt-like transcription factor 1; targeted mutant 4, Nips Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Founder animals were backcrossed to Crlj:WI. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 RGSC 3.4 19 19277337 19293298 +
126781695 Sall1tm4(tdTomato)Nips spalt-like transcription factor 1; targeted mutant 4, Nips Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Founder animals were backcrossed to Crlj:WI. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 Rnor_5.0 19 34377838 34395131 +
126781695 Sall1tm4(tdTomato)Nips spalt-like transcription factor 1; targeted mutant 4, Nips Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Founder animals were backcrossed to Crlj:WI. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 2021-04-15 2021-04-15 1309916 Sall1 Rnor_6.0 19 23387737 23405025 +
11561928 Samt4Tn(pb-Bhr7)1Wmukf spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene 2016-11-11 2016-11-11 1590194 Samt4 RGSC 3.4 X 43197794 43199857 - spermatogenesis associated multipass transmembrane protein 4, Bhr7 transposon-incuded mutant 1, Wmukf);spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf);Samt4Tn(pb-Bhr7)1Wmukf
11561928 Samt4Tn(pb-Bhr7)1Wmukf spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene 2016-11-11 2016-11-11 1590194 Samt4 Rnor_5.0 X 24776551 24782744 - spermatogenesis associated multipass transmembrane protein 4, Bhr7 transposon-incuded mutant 1, Wmukf);spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf);Samt4Tn(pb-Bhr7)1Wmukf
11561928 Samt4Tn(pb-Bhr7)1Wmukf spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene 2016-11-11 2016-11-11 1590194 Samt4 Rnor_6.0 X 24362079 24364320 - spermatogenesis associated multipass transmembrane protein 4, Bhr7 transposon-incuded mutant 1, Wmukf);spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf);Samt4Tn(pb-Bhr7)1Wmukf
10002755 Sbf1m1Ipcv SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences spontaneous recessive mutation found in the colony of SHR/OlaIpcv; the mutated nucleotide is chr7:127585309 (of Baylor 3.4) and it is last nucleotide of intron 37 (-1 of exon 38) of Sbf1 gene. 2015-04-24 2017-01-25 1307090 Sbf1 RGSC 3.4 7 127583779 127611043 - ifm;ifm;Sbf1m1Ipcv
10002755 Sbf1m1Ipcv SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences spontaneous recessive mutation found in the colony of SHR/OlaIpcv; the mutated nucleotide is chr7:127585309 (of Baylor 3.4) and it is last nucleotide of intron 37 (-1 of exon 38) of Sbf1 gene. 2015-04-24 2017-01-25 1307090 Sbf1 Rnor_5.0 7 129946572 129973566 - ifm;ifm;Sbf1m1Ipcv
10002755 Sbf1m1Ipcv SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences spontaneous recessive mutation found in the colony of SHR/OlaIpcv; the mutated nucleotide is chr7:127585309 (of Baylor 3.4) and it is last nucleotide of intron 37 (-1 of exon 38) of Sbf1 gene. 2015-04-24 2017-01-25 1307090 Sbf1 Rnor_6.0 7 130261552 130288566 - ifm;ifm;Sbf1m1Ipcv
12792283 Scn1am1Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo A missense mutant N1417H (4246A>G) in the third pore region of the sodium channel was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a RGSC 3.4 3 48238528 48364143 - sodium voltage-gated channel alpha subunit 1; mutant1, Kyo;Scn1aKyo811;sodium voltage-gated channel alpha subunit 1; mutant1;Scn1am1;Scn1am1Kyo
12792283 Scn1am1Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo A missense mutant N1417H (4246A>G) in the third pore region of the sodium channel was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a Rnor_5.0 3 59016641 59135580 - sodium voltage-gated channel alpha subunit 1; mutant1, Kyo;Scn1aKyo811;sodium voltage-gated channel alpha subunit 1; mutant1;Scn1am1;Scn1am1Kyo
12792283 Scn1am1Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo A missense mutant N1417H (4246A>G) in the third pore region of the sodium channel was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a Rnor_6.0 3 52388811 52533365 - sodium voltage-gated channel alpha subunit 1; mutant1, Kyo;Scn1aKyo811;sodium voltage-gated channel alpha subunit 1; mutant1;Scn1am1;Scn1am1Kyo
12792284 Scn1am2Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo A missense mutant E539A (1616A>C) was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a RGSC 3.4 3 48238528 48364143 - sodium voltage-gated channel alpha subunit 1; mutant2, Kyo;Scn1aKyo631;Scn1am2Kyo
12792284 Scn1am2Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo A missense mutant E539A (1616A>C) was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a Rnor_5.0 3 59016641 59135580 - sodium voltage-gated channel alpha subunit 1; mutant2, Kyo;Scn1aKyo631;Scn1am2Kyo
12792284 Scn1am2Kyo sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo A missense mutant E539A (1616A>C) was induced by ethylnitrosourea (ENU) mutagenesis. 2017-03-15 2017-03-15 69364 Scn1a Rnor_6.0 3 52388811 52533365 - sodium voltage-gated channel alpha subunit 1; mutant2, Kyo;Scn1aKyo631;Scn1am2Kyo
25394531 Scn2aem1Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). 2020-04-09 2020-04-09 3632 Scn2a RGSC 3.4 3 47588413 47722800 +
25394531 Scn2aem1Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). 2020-04-09 2020-04-09 3632 Scn2a Rnor_5.0 3 58322640 58456658 +
25394531 Scn2aem1Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). 2020-04-09 2020-04-09 3632 Scn2a Rnor_6.0 3 51687910 51822008 +
25394533 Scn2aem2Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene. 2020-04-09 2020-04-09 3632 Scn2a RGSC 3.4 3 47588413 47722800 +
25394533 Scn2aem2Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene. 2020-04-09 2020-04-09 3632 Scn2a Rnor_5.0 3 58322640 58456658 +
25394533 Scn2aem2Mcwi sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene. 2020-04-09 2020-04-09 3632 Scn2a Rnor_6.0 3 51687910 51822008 +
11553859 Scn5aem2Mcwi sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene 2016-10-14 2016-10-14 3637 Scn5a RGSC 3.4 8 124446479 124545301 - Scn5aem2Mcwi
11553859 Scn5aem2Mcwi sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene 2016-10-14 2016-10-14 3637 Scn5a Rnor_5.0 8 127375781 127471879 - Scn5aem2Mcwi
11553859 Scn5aem2Mcwi sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene 2016-10-14 2016-10-14 3637 Scn5a Rnor_6.0 8 128169191 128266681 - Scn5aem2Mcwi
150429827 Scn9a*tm1Amgn sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase). 2021-10-01 2021-10-01 69368 Scn9a RGSC 3.4 3 48438725 48518893
150429827 Scn9a*tm1Amgn sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase). 2021-10-01 2021-10-01 69368 Scn9a Rnor_5.0 3 59207264 59286961 -
150429827 Scn9a*tm1Amgn sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase). 2021-10-01 2021-10-01 69368 Scn9a Rnor_6.0 3 52583953 52664209 -
1642167 Serpina5m1Mcwi serpin family A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H24R mutation is generated from the codon change CAT/CGT 2007-09-06 2007-09-06 619817 Serpina5 RGSC 3.4 6 128156901 128161334 + Serpina5m1Mcwi
1642167 Serpina5m1Mcwi serpin family A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H24R mutation is generated from the codon change CAT/CGT 2007-09-06 2007-09-06 619817 Serpina5 Rnor_5.0 6 136972583 136990812 + Serpina5m1Mcwi
1642167 Serpina5m1Mcwi serpin family A member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); H24R mutation is generated from the codon change CAT/CGT 2007-09-06 2007-09-06 619817 Serpina5 Rnor_6.0 6 127753152 127772403 + Serpina5m1Mcwi
329955453 Serpina6em1Glha serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha This allele was made by CRISPR/cas9 in Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. 2023-07-12 2023-07-12 1595901 Serpina6 RGSC 3.4 6 127911618 127921851 -
329955453 Serpina6em1Glha serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha This allele was made by CRISPR/cas9 in Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. 2023-07-12 2023-07-12 1595901 Serpina6 Rnor_5.0 6 136742720 136752950 -
329955453 Serpina6em1Glha serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha This allele was made by CRISPR/cas9 in Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. 2023-07-12 2023-07-12 1595901 Serpina6 Rnor_6.0 6 127523948 127534178 -
12790722 Serpinc1em2Mcwi serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene. 2017-02-21 2017-02-21 1307404 Serpinc1 RGSC 3.4 13 76548456 76562724 + Serpinc1em2Mcwi
12790722 Serpinc1em2Mcwi serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene. 2017-02-21 2017-02-21 1307404 Serpinc1 Rnor_5.0 13 83700761 83715029 + Serpinc1em2Mcwi
12790722 Serpinc1em2Mcwi serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene. 2017-02-21 2017-02-21 1307404 Serpinc1 Rnor_6.0 13 78806107 78820375 + Serpinc1em2Mcwi
4139858 Sh2b3em1Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an in-frame 6-bp deletion in exon 2 (del 847-852). 2010-08-19 2010-08-19 68411 Sh2b3 RGSC 3.4 12 35954679 35958446 + Sh2b3em1Mcwi
4139858 Sh2b3em1Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an in-frame 6-bp deletion in exon 2 (del 847-852). 2010-08-19 2010-08-19 68411 Sh2b3 Rnor_5.0 12 42132947 42136714 + Sh2b3em1Mcwi
4139858 Sh2b3em1Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an in-frame 6-bp deletion in exon 2 (del 847-852). 2010-08-19 2010-08-19 68411 Sh2b3 Rnor_6.0 12 40261990 40265757 + Sh2b3em1Mcwi
5509982 Sh2b3em2Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 7 (del 1589) in SS/JrHsdMcwi 2011-11-16 2011-11-16 68411 Sh2b3 RGSC 3.4 12 35954679 35958446 + Sh2b3em2Mcwi
5509982 Sh2b3em2Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 7 (del 1589) in SS/JrHsdMcwi 2011-11-16 2011-11-16 68411 Sh2b3 Rnor_5.0 12 42132947 42136714 + Sh2b3em2Mcwi
5509982 Sh2b3em2Mcwi SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 7 (del 1589) in SS/JrHsdMcwi 2011-11-16 2011-11-16 68411 Sh2b3 Rnor_6.0 12 40261990 40265757 + Sh2b3em2Mcwi
126790499 Shank2em13Sage SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage This mutant allele was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 2021-04-23 2021-04-23 628772 Shank2 RGSC 3.4 1 204399856 204855474 +
126790499 Shank2em13Sage SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage This mutant allele was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 2021-04-23 2021-04-23 628772 Shank2 Rnor_5.0 1 224028791 224450737 +
126790499 Shank2em13Sage SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage This mutant allele was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 2021-04-23 2021-04-23 628772 Shank2 Rnor_5.0 1 222118530 222150341 +
126790499 Shank2em13Sage SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage This mutant allele was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 2021-04-23 2021-04-23 628772 Shank2 Rnor_6.0 1 217149156 217593950 +
631721279 SD-Shank3em1Bcgen SH3 and multiple ankyrin repeat domains 3; CRISPR/Cas9 induced mutant 1,Bcgen This CRISPR/Cas9 induced mutant allele was generated using gRNAs target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exons 11–21 2026-01-21 2026-01-21 69264 Shank3 RGSC 3.4 7 127817026 127877875 +
631721279 SD-Shank3em1Bcgen SH3 and multiple ankyrin repeat domains 3; CRISPR/Cas9 induced mutant 1,Bcgen This CRISPR/Cas9 induced mutant allele was generated using gRNAs target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exons 11–21 2026-01-21 2026-01-21 69264 Shank3 Rnor_5.0 7 130159246 130220171 +
631721279 SD-Shank3em1Bcgen SH3 and multiple ankyrin repeat domains 3; CRISPR/Cas9 induced mutant 1,Bcgen This CRISPR/Cas9 induced mutant allele was generated using gRNAs target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exons 11–21 2026-01-21 2026-01-21 69264 Shank3 Rnor_6.0 7 130474278 130534679 +
41404706 Shank3em1Bux SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. 2021-02-04 2021-02-04 69264 Shank3 RGSC 3.4 7 127817026 127877875 + Shank3em1Bux
41404706 Shank3em1Bux SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. 2021-02-04 2021-02-04 69264 Shank3 Rnor_5.0 7 130159246 130220171 + Shank3em1Bux
41404706 Shank3em1Bux SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. 2021-02-04 2021-02-04 69264 Shank3 Rnor_6.0 7 130474278 130534679 + Shank3em1Bux
11553854 Shc1em1Mcwi SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene 2016-10-14 2016-10-14 620446 Shc1 RGSC 3.4 2 181616581 181628144 + p66Shcem1Mcwi;Shc1em1Mcwi
11553854 Shc1em1Mcwi SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene 2016-10-14 2016-10-14 620446 Shc1 Rnor_5.0 2 208159786 208171348 + p66Shcem1Mcwi;Shc1em1Mcwi
11553854 Shc1em1Mcwi SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene 2016-10-14 2016-10-14 620446 Shc1 Rnor_6.0 2 188745503 188757066 + p66Shcem1Mcwi;Shc1em1Mcwi
11553903 Shc1em3Mcwi SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 RGSC 3.4 2 181616581 181628144 + p66Shcem3Mcwi;Shc1em3Mcwi
11553903 Shc1em3Mcwi SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 Rnor_5.0 2 208159786 208171348 + p66Shcem3Mcwi;Shc1em3Mcwi
11553903 Shc1em3Mcwi SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 Rnor_6.0 2 188745503 188757066 + p66Shcem3Mcwi;Shc1em3Mcwi
11553913 Shc1em4Mcwi SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 RGSC 3.4 2 181616581 181628144 + p66Shcem4Mcwi;p66Shcem4Mcwi;Shc1em4Mcwi
11553913 Shc1em4Mcwi SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 Rnor_5.0 2 208159786 208171348 + p66Shcem4Mcwi;p66Shcem4Mcwi;Shc1em4Mcwi
11553913 Shc1em4Mcwi SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Shc1 gene. 2016-10-17 2016-10-17 620446 Shc1 Rnor_6.0 2 188745503 188757066 + p66Shcem4Mcwi;p66Shcem4Mcwi;Shc1em4Mcwi
11553915 Shc1em5Mcwi SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a T>C substitution to generate S36A in Exon 2 of theShc1 gene 2016-10-17 2016-10-17 620446 Shc1 RGSC 3.4 2 181616581 181628144 + p66Shctm1(S36A)Mcwi;Shc1em1(S36A)Mcwi;SHC adaptor protein 1; ZFN induced mutant 1 (S36A), Medical College of Wisconsin;Shc1em5Mcwi
11553915 Shc1em5Mcwi SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a T>C substitution to generate S36A in Exon 2 of theShc1 gene 2016-10-17 2016-10-17 620446 Shc1 Rnor_5.0 2 208159786 208171348 + p66Shctm1(S36A)Mcwi;Shc1em1(S36A)Mcwi;SHC adaptor protein 1; ZFN induced mutant 1 (S36A), Medical College of Wisconsin;Shc1em5Mcwi
11553915 Shc1em5Mcwi SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a T>C substitution to generate S36A in Exon 2 of theShc1 gene 2016-10-17 2016-10-17 620446 Shc1 Rnor_6.0 2 188745503 188757066 + p66Shctm1(S36A)Mcwi;Shc1em1(S36A)Mcwi;SHC adaptor protein 1; ZFN induced mutant 1 (S36A), Medical College of Wisconsin;Shc1em5Mcwi
124715483 Shc1em6Mcwi SHC adaptor protein 1; CRISPR/Cas9 induced mutant 6, Mcwi Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This allele carries a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. 2021-03-26 2026-03-06 620446 Shc1 RGSC 3.4 2 181616581 181628144 +
124715483 Shc1em6Mcwi SHC adaptor protein 1; CRISPR/Cas9 induced mutant 6, Mcwi Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This allele carries a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. 2021-03-26 2026-03-06 620446 Shc1 Rnor_5.0 2 208159786 208171348 +
124715483 Shc1em6Mcwi SHC adaptor protein 1; CRISPR/Cas9 induced mutant 6, Mcwi Generated by pronuclear injection of a CRISPR plasmid expressing Cas9 and single-guide RNA targeting the sequence CACTCAGCTTGTTCATGTCCTGG (protospacer adjacent motif underlined) into one-cell SS (SS/JrHsdMcwi) rat embryos. This allele carries a 6-bp deletion (mRatBN7.2 chr2:174,841,367-174,841,372) including the p52SHC initiation codon. 2021-03-26 2026-03-06 620446 Shc1 Rnor_6.0 2 188745503 188757066 +
10059574 Sik2em4Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene 2015-08-19 2016-10-04 1559698 Sik2 RGSC 3.4 8 54240307 54337976 - Sik2em4Mcwi
10059574 Sik2em4Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene 2015-08-19 2016-10-04 1559698 Sik2 Rnor_5.0 8 53905730 54005295 - Sik2em4Mcwi
10059574 Sik2em4Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene 2015-08-19 2016-10-04 1559698 Sik2 Rnor_6.0 8 55309005 55408608 - Sik2em4Mcwi
12790945 Sik2em5Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp deletion in the genome and 1-bp (T) insertion in the deletion site, net 5-bp deletion in exon 4 of the Sik2 gene. 2017-02-22 2017-02-22 1559698 Sik2 RGSC 3.4 8 54240307 54337976 - Sik2em5Mcwi;Sik2em5Mcwi
12790945 Sik2em5Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp deletion in the genome and 1-bp (T) insertion in the deletion site, net 5-bp deletion in exon 4 of the Sik2 gene. 2017-02-22 2017-02-22 1559698 Sik2 Rnor_5.0 8 53905730 54005295 - Sik2em5Mcwi;Sik2em5Mcwi
12790945 Sik2em5Mcwi salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp deletion in the genome and 1-bp (T) insertion in the deletion site, net 5-bp deletion in exon 4 of the Sik2 gene. 2017-02-22 2017-02-22 1559698 Sik2 Rnor_6.0 8 55309005 55408608 - Sik2em5Mcwi;Sik2em5Mcwi
10054448 Sirt3em25Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 13-bp deletion in the Sirt3 gene;(RGSC 5.0/rn5) deleted region: chr1:220,552,421-220,552,433 2015-08-06 2016-10-19 1308374 Sirt3 RGSC 3.4 1 201021391 201043756 - Sirt3em25Mcwi
10054448 Sirt3em25Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 13-bp deletion in the Sirt3 gene;(RGSC 5.0/rn5) deleted region: chr1:220,552,421-220,552,433 2015-08-06 2016-10-19 1308374 Sirt3 Rnor_5.0 1 220539132 220561380 - Sirt3em25Mcwi
10054448 Sirt3em25Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 13-bp deletion in the Sirt3 gene;(RGSC 5.0/rn5) deleted region: chr1:220,552,421-220,552,433 2015-08-06 2016-10-19 1308374 Sirt3 Rnor_6.0 1 213613502 213636061 - Sirt3em25Mcwi
10054457 Sirt3em30Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 RGSC 3.4 1 201021391 201043756 - Sirt3em30Mcwi
10054457 Sirt3em30Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 Rnor_5.0 1 220539132 220561380 - Sirt3em30Mcwi
10054457 Sirt3em30Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 Rnor_6.0 1 213613502 213636061 - Sirt3em30Mcwi
10054454 Sirt3em35Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 RGSC 3.4 1 201021391 201043756 - Sirt3em35Mcwi
10054454 Sirt3em35Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 Rnor_5.0 1 220539132 220561380 - Sirt3em35Mcwi
10054454 Sirt3em35Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene 2015-08-06 2016-10-05 1308374 Sirt3 Rnor_6.0 1 213613502 213636061 - Sirt3em35Mcwi
10054451 Sirt3em4Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Sirt3 gene 2015-08-06 2016-10-19 1308374 Sirt3 RGSC 3.4 1 201021391 201043756 - Sirt3em4Mcwi
10054451 Sirt3em4Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Sirt3 gene 2015-08-06 2016-10-19 1308374 Sirt3 Rnor_5.0 1 220539132 220561380 - Sirt3em4Mcwi
10054451 Sirt3em4Mcwi sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Sirt3 gene 2015-08-06 2016-10-19 1308374 Sirt3 Rnor_6.0 1 213613502 213636061 - Sirt3em4Mcwi
2303097 Slc16a12Tn(sb-T2/Bart3)2.298Mcwi solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene 2009-02-02 2009-02-02 1311468 Slc16a12 RGSC 3.4 1 238643040 238665699 - Slc16a12Tn(sb-T2/Bart3)2.298Mcwi
2303097 Slc16a12Tn(sb-T2/Bart3)2.298Mcwi solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene 2009-02-02 2009-02-02 1311468 Slc16a12 Rnor_5.0 1 260197556 260275962 - Slc16a12Tn(sb-T2/Bart3)2.298Mcwi
2303097 Slc16a12Tn(sb-T2/Bart3)2.298Mcwi solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene 2009-02-02 2009-02-02 1311468 Slc16a12 Rnor_6.0 1 252976071 253054500 - Slc16a12Tn(sb-T2/Bart3)2.298Mcwi
12904734 Slc22a1em1Sage solute carrier family 22 member 1; ZFN induced mutant 1, Sage This ZFN induced allele contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 3224 Slc22a1 RGSC 3.4 1 42351239 42378295 + Oct1 Knockout;solute carrier family 22 member 1; endonuclease induced mutant 1, Sage;Slc22a1em1Sage
12904734 Slc22a1em1Sage solute carrier family 22 member 1; ZFN induced mutant 1, Sage This ZFN induced allele contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 3224 Slc22a1 Rnor_5.0 1 51452604 51479610 - Oct1 Knockout;solute carrier family 22 member 1; endonuclease induced mutant 1, Sage;Slc22a1em1Sage
12904734 Slc22a1em1Sage solute carrier family 22 member 1; ZFN induced mutant 1, Sage This ZFN induced allele contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. 2017-05-19 2017-05-19 3224 Slc22a1 Rnor_6.0 1 48273639 48300645 + Oct1 Knockout;solute carrier family 22 member 1; endonuclease induced mutant 1, Sage;Slc22a1em1Sage
2290091 Slc24a3Tn(sb-T2/Bart3)2.178Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 RGSC 3.4 3 133734890 134249326 + Slc24a3Tn(sb-T2/Bart3)2.178Mcwi
2290091 Slc24a3Tn(sb-T2/Bart3)2.178Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 Rnor_5.0 3 145760074 146259491 + Slc24a3Tn(sb-T2/Bart3)2.178Mcwi
2290091 Slc24a3Tn(sb-T2/Bart3)2.178Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 Rnor_6.0 3 139333942 139835728 + Slc24a3Tn(sb-T2/Bart3)2.178Mcwi
2290073 Slc24a3Tn(sb-T2/Bart3)2.188Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 RGSC 3.4 3 133734890 134249326 + Slc24a3Tn(sb-T2/Bart3)2.188Mcwi
2290073 Slc24a3Tn(sb-T2/Bart3)2.188Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 Rnor_5.0 3 145760074 146259491 + Slc24a3Tn(sb-T2/Bart3)2.188Mcwi
2290073 Slc24a3Tn(sb-T2/Bart3)2.188Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene 2008-02-26 2008-02-26 69256 Slc24a3 Rnor_6.0 3 139333942 139835728 + Slc24a3Tn(sb-T2/Bart3)2.188Mcwi
2290127 Slc24a4Tn(sb-T2/Bart3)2.145Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. 2008-02-26 2008-02-26 1305926 Slc24a4 RGSC 3.4 6 126403837 126538501 + Slc24a4Tn(sb-T2/Bart3)2.145Mcwi
2290127 Slc24a4Tn(sb-T2/Bart3)2.145Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. 2008-02-26 2008-02-26 1305926 Slc24a4 Rnor_5.0 6 135226112 135364945 + Slc24a4Tn(sb-T2/Bart3)2.145Mcwi
2290127 Slc24a4Tn(sb-T2/Bart3)2.145Mcwi solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. 2008-02-26 2008-02-26 1305926 Slc24a4 Rnor_6.0 6 126015799 126158727 + Slc24a4Tn(sb-T2/Bart3)2.145Mcwi
1578799 Slc27a5m1Mcwi solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K196Stop is generated. 2006-05-02 2006-05-02 708535 Slc27a5 RGSC 3.4 1 72924630 72935223 + Slc27a5m1Mcwi
1578799 Slc27a5m1Mcwi solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K196Stop is generated. 2006-05-02 2006-05-02 708535 Slc27a5 Rnor_5.0 1 66387832 66398425 + Slc27a5m1Mcwi
1578799 Slc27a5m1Mcwi solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K196Stop is generated. 2006-05-02 2006-05-02 708535 Slc27a5 Rnor_6.0 1 65576599 65587192 + Slc27a5m1Mcwi
1642170 Slc27a5m2Mcwi solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K160E mutation is generated from the codon change AAA/GAA 2007-09-06 2007-09-06 708535 Slc27a5 RGSC 3.4 1 72924630 72935223 + Slc27a5m2Mcwi
1642170 Slc27a5m2Mcwi solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K160E mutation is generated from the codon change AAA/GAA 2007-09-06 2007-09-06 708535 Slc27a5 Rnor_5.0 1 66387832 66398425 + Slc27a5m2Mcwi
1642170 Slc27a5m2Mcwi solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); K160E mutation is generated from the codon change AAA/GAA 2007-09-06 2007-09-06 708535 Slc27a5 Rnor_6.0 1 65576599 65587192 + Slc27a5m2Mcwi
401795485 Slc30a10em1Sommu solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion. 2023-09-11 2023-09-11 1305098 Slc30a10 RGSC 3.4 13 101474867 101492180 +
401795485 Slc30a10em1Sommu solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion. 2023-09-11 2023-09-11 1305098 Slc30a10 Rnor_5.0 13 108048948 108083821 +
401795485 Slc30a10em1Sommu solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion. 2023-09-11 2023-09-11 1305098 Slc30a10 Rnor_6.0 13 103396295 103406759 +
5131979 Slc30a8em1Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 464-480). 2011-05-17 2011-05-17 1308282 Slc30a8 RGSC 3.4 7 88583770 88617145 + Slc30a8em1Mcwi
5131979 Slc30a8em1Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 464-480). 2011-05-17 2011-05-17 1308282 Slc30a8 Rnor_5.0 7 92476024 92512365 + Slc30a8em1Mcwi
5131979 Slc30a8em1Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 464-480). 2011-05-17 2011-05-17 1308282 Slc30a8 Rnor_6.0 7 91832988 91869329 + Slc30a8em1Mcwi
5131981 Slc30a8em2Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 462-478). 2011-05-17 2011-05-17 1308282 Slc30a8 RGSC 3.4 7 88583770 88617145 + Slc30a8em2Mcwi
5131981 Slc30a8em2Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 462-478). 2011-05-17 2011-05-17 1308282 Slc30a8 Rnor_5.0 7 92476024 92512365 + Slc30a8em2Mcwi
5131981 Slc30a8em2Mcwi solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 462-478). 2011-05-17 2011-05-17 1308282 Slc30a8 Rnor_6.0 7 91832988 91869329 + Slc30a8em2Mcwi
5687699 Slc34a1em1Mcwi solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp deletion in exon 4 (del 425-436) 2012-02-09 2012-02-09 3708 Slc34a1 RGSC 3.4 17 15262929 15277902 - Slc34a1em1Mcwi
5687699 Slc34a1em1Mcwi solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp deletion in exon 4 (del 425-436) 2012-02-09 2012-02-09 3708 Slc34a1 Rnor_5.0 17 11856946 11872100 - Slc34a1em1Mcwi
5687699 Slc34a1em1Mcwi solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp deletion in exon 4 (del 425-436) 2012-02-09 2012-02-09 3708 Slc34a1 Rnor_6.0 17 9747766 9762739 - Slc34a1em1Mcwi
2311689 Tmem22Tn(sb-T2/Bart3)2.332Mcwi transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene 2009-07-30 2009-07-30 1306109 Slc35g2 RGSC 3.4 8 105416072 105443969 - Tmem22Tn(sb-T2/Bart3)2.332Mcwi
2311689 Tmem22Tn(sb-T2/Bart3)2.332Mcwi transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene 2009-07-30 2009-07-30 1306109 Slc35g2 Rnor_5.0 8 108269643 108297339 - Tmem22Tn(sb-T2/Bart3)2.332Mcwi
2311689 Tmem22Tn(sb-T2/Bart3)2.332Mcwi transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene 2009-07-30 2009-07-30 1306109 Slc35g2 Rnor_6.0 8 108854134 108881519 - Tmem22Tn(sb-T2/Bart3)2.332Mcwi
10401842 Slc39a12em77Tja solute carrier family 39 (zinc transporter), member 12; zinc finger nuclease induced mutant 77, Timothy J. Aitman This allele was made by ZFN mutagenesis. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein 2015-10-08 2015-10-08 1309305 Slc39a12 RGSC 3.4 17 88525527 88605947 + Slc39a12em77Tja
10401842 Slc39a12em77Tja solute carrier family 39 (zinc transporter), member 12; zinc finger nuclease induced mutant 77, Timothy J. Aitman This allele was made by ZFN mutagenesis. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein 2015-10-08 2015-10-08 1309305 Slc39a12 Rnor_5.0 17 83202775 83288616 + Slc39a12em77Tja
10401842 Slc39a12em77Tja solute carrier family 39 (zinc transporter), member 12; zinc finger nuclease induced mutant 77, Timothy J. Aitman This allele was made by ZFN mutagenesis. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein 2015-10-08 2015-10-08 1309305 Slc39a12 Rnor_6.0 17 81455731 81541742 + Slc39a12em77Tja
617301245 Slc5a10em1Mcwi solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. 2025-07-28 2025-07-28 1305232 Slc5a10 RGSC 3.4 10 47831700 47878552 -
617301245 Slc5a10em1Mcwi solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. 2025-07-28 2025-07-28 1305232 Slc5a10 Rnor_5.0 10 47742919 47789930 -
617301245 Slc5a10em1Mcwi solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. 2025-07-28 2025-07-28 1305232 Slc5a10 Rnor_6.0 10 47949775 47997802 -
617301244 Slc5a9em1Mcwi solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. 2025-07-28 2025-07-28 1311383 Slc5a9 RGSC 3.4 5 133455811 133465217 -
617301244 Slc5a9em1Mcwi solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. 2025-07-28 2025-07-28 1311383 Slc5a9 Rnor_5.0 5 135659660 135683248 -
617301244 Slc5a9em1Mcwi solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. 2025-07-28 2025-07-28 1311383 Slc5a9 Rnor_6.0 5 131836927 131865218 -
5687736 Slc6a12em1Mcwi solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 53-bp deletion overlapping exon 2 (v3.4 del 157781847- 157781899) 2012-02-09 2012-02-09 620255 Slc6a12 RGSC 3.4 4 157781178 157800038 + Slc6a12em1Mcwi
5687736 Slc6a12em1Mcwi solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 53-bp deletion overlapping exon 2 (v3.4 del 157781847- 157781899) 2012-02-09 2012-02-09 620255 Slc6a12 Rnor_5.0 4 221009224 221029242 + Slc6a12em1Mcwi
5687736 Slc6a12em1Mcwi solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 53-bp deletion overlapping exon 2 (v3.4 del 157781847- 157781899) 2012-02-09 2012-02-09 620255 Slc6a12 Rnor_6.0 4 153921199 153941333 + Slc6a12em1Mcwi
126925197 Slc6a3m1Span solute carrier family 6 member 3; ENU induced mutant 1, Span This allele was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. 2021-05-14 2021-05-14 3715 Slc6a3 RGSC 3.4 1 30516568 30557540 -
126925197 Slc6a3m1Span solute carrier family 6 member 3; ENU induced mutant 1, Span This allele was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. 2021-05-14 2021-05-14 3715 Slc6a3 Rnor_5.0 1 33745060 33788878 -
126925197 Slc6a3m1Span solute carrier family 6 member 3; ENU induced mutant 1, Span This allele was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. 2021-05-14 2021-05-14 3715 Slc6a3 Rnor_6.0 1 32323011 32363983 -
14390068 Slc6a4m1Hubr solute carrier family 6 member 4; ZFN induced mutant1, Hubr An ENU-induced C to A transversion at position 3924 (relative to the start codon in ENSRNOG0000003476) in the slc6a4 gene, resulting in a premature stop codon (TGC>TGA) in the third exon encoding the second extracellular loop and thereby most likely resulting in a non-functional protein product. 2019-02-18 2019-02-18 3714 Slc6a4 RGSC 3.4 10 67134790 67155891 -
14390068 Slc6a4m1Hubr solute carrier family 6 member 4; ZFN induced mutant1, Hubr An ENU-induced C to A transversion at position 3924 (relative to the start codon in ENSRNOG0000003476) in the slc6a4 gene, resulting in a premature stop codon (TGC>TGA) in the third exon encoding the second extracellular loop and thereby most likely resulting in a non-functional protein product. 2019-02-18 2019-02-18 3714 Slc6a4 Rnor_5.0 10 62851326 62872481 -
14390068 Slc6a4m1Hubr solute carrier family 6 member 4; ZFN induced mutant1, Hubr An ENU-induced C to A transversion at position 3924 (relative to the start codon in ENSRNOG0000003476) in the slc6a4 gene, resulting in a premature stop codon (TGC>TGA) in the third exon encoding the second extracellular loop and thereby most likely resulting in a non-functional protein product. 2019-02-18 2019-02-18 3714 Slc6a4 Rnor_6.0 10 63153656 63188377 -
2302643 Slc7a11Tn(sb-T2/Bart3)2.266Mcwi solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene 2009-01-06 2009-01-06 1309275 Slc7a11 RGSC 3.4 2 139241142 139317101 - Slc7a11Tn(sb-T2/Bart3)2.266Mcwi
2302643 Slc7a11Tn(sb-T2/Bart3)2.266Mcwi solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene 2009-01-06 2009-01-06 1309275 Slc7a11 Rnor_5.0 2 158930294 159004937 - Slc7a11Tn(sb-T2/Bart3)2.266Mcwi
2302643 Slc7a11Tn(sb-T2/Bart3)2.266Mcwi solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene 2009-01-06 2009-01-06 1309275 Slc7a11 Rnor_6.0 2 139453774 139528479 - Slc7a11Tn(sb-T2/Bart3)2.266Mcwi
5687700 Slc7a9em1Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 6 (del 745-751) 2012-02-09 2013-10-07 619905 Slc7a9 RGSC 3.4 1 87976440 87999102 + Slc7a9em1Mcwi
5687700 Slc7a9em1Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 6 (del 745-751) 2012-02-09 2013-10-07 619905 Slc7a9 Rnor_5.0 1 92836837 92865759 + Slc7a9em1Mcwi
5687700 Slc7a9em1Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 6 (del 745-751) 2012-02-09 2013-10-07 619905 Slc7a9 Rnor_6.0 1 91709034 91738492 + Slc7a9em1Mcwi
5687701 Slc7a9em2Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 746-755) 2012-02-09 2012-02-09 619905 Slc7a9 RGSC 3.4 1 87976440 87999102 + Slc7a9em2Mcwi
5687701 Slc7a9em2Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 746-755) 2012-02-09 2012-02-09 619905 Slc7a9 Rnor_5.0 1 92836837 92865759 + Slc7a9em2Mcwi
5687701 Slc7a9em2Mcwi solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 746-755) 2012-02-09 2012-02-09 619905 Slc7a9 Rnor_6.0 1 91709034 91738492 + Slc7a9em2Mcwi
1578786 Slc8a2m1Mcwi solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y213Stop mutation is generated from the codon change TAT/TAA 2006-05-02 2006-05-02 620194 Slc8a2 RGSC 3.4 1 76473938 76498624 + Slc8a2m1Mcwi
1578786 Slc8a2m1Mcwi solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y213Stop mutation is generated from the codon change TAT/TAA 2006-05-02 2006-05-02 620194 Slc8a2 Rnor_5.0 1 79296259 79320746 + Slc8a2m1Mcwi
1578786 Slc8a2m1Mcwi solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); Y213Stop mutation is generated from the codon change TAT/TAA 2006-05-02 2006-05-02 620194 Slc8a2 Rnor_6.0 1 78029555 78054042 + Slc8a2m1Mcwi
151664749 Slc9a6 em1Moro solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon. 2022-03-09 2022-03-09 1563582 Slc9a6 RGSC 3.4 X 141146237 141201234 +
151664749 Slc9a6 em1Moro solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon. 2022-03-09 2022-03-09 1563582 Slc9a6 Rnor_5.0 X 153620082 153675717 +
151664749 Slc9a6 em1Moro solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon. 2022-03-09 2022-03-09 1563582 Slc9a6 Rnor_6.0 X 158979081 159045019 +
150521524 Slco1b2em1Myliu solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion. 2021-11-09 2021-11-09 69300 Slco1b2 RGSC 3.4 4 179045586 179118680 +
150521524 Slco1b2em1Myliu solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion. 2021-11-09 2021-11-09 69300 Slco1b2 Rnor_5.0 4 240035313 240103015 +
150521524 Slco1b2em1Myliu solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion. 2021-11-09 2021-11-09 69300 Slco1b2 Rnor_6.0 4 175814118 175881775 +
2299117 SnphTn(sb-T2/Bart3)2.214Mcwi syntaphilin; transposon insertion 2.214, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene 2008-08-12 2008-08-12 1305867 Snph RGSC 3.4 3 141921547 141961697 - SnphTn(sb-T2/Bart3)2.214Mcwi
2299117 SnphTn(sb-T2/Bart3)2.214Mcwi syntaphilin; transposon insertion 2.214, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene 2008-08-12 2008-08-12 1305867 Snph Rnor_5.0 3 153455882 153496985 - SnphTn(sb-T2/Bart3)2.214Mcwi
2299117 SnphTn(sb-T2/Bart3)2.214Mcwi syntaphilin; transposon insertion 2.214, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene 2008-08-12 2008-08-12 1305867 Snph Rnor_6.0 3 147102394 147143576 - SnphTn(sb-T2/Bart3)2.214Mcwi
2302636 Snx25Tn(sb-T2/Bart3)2.270Mcwi sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene 2009-01-06 2009-01-06 1310150 Snx25 RGSC 3.4 16 49415658 49518663 + Snx25Tn(sb-T2/Bart3)2.270Mcwi
2302636 Snx25Tn(sb-T2/Bart3)2.270Mcwi sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene 2009-01-06 2009-01-06 1310150 Snx25 Rnor_5.0 16 49051539 49159381 + Snx25Tn(sb-T2/Bart3)2.270Mcwi
2302636 Snx25Tn(sb-T2/Bart3)2.270Mcwi sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene 2009-01-06 2009-01-06 1310150 Snx25 Rnor_6.0 16 49328958 49432415 + Snx25Tn(sb-T2/Bart3)2.270Mcwi
1599567 Sod3m1Mcwi superoxide dismutase 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E124D mutation is generated from the codon change GAG/GAT 2007-02-07 2007-02-07 3733 Sod3 RGSC 3.4 14 63381447 63387180 - Sod3m1Mcwi
1599567 Sod3m1Mcwi superoxide dismutase 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E124D mutation is generated from the codon change GAG/GAT 2007-02-07 2007-02-07 3733 Sod3 Rnor_5.0 14 61071304 61083776 - Sod3m1Mcwi
1599567 Sod3m1Mcwi superoxide dismutase 3; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E124D mutation is generated from the codon change GAG/GAT 2007-02-07 2007-02-07 3733 Sod3 Rnor_6.0 14 60958583 60971143 - Sod3m1Mcwi
4139864 Sorcs1em1Mcwi sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20 (del 1109-1122). 2010-08-19 2010-08-19 1305910 Sorcs1 RGSC 3.4 1 255767411 256279565 - Sorcs1em1Mcwi
4139864 Sorcs1em1Mcwi sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20 (del 1109-1122). 2010-08-19 2010-08-19 1305910 Sorcs1 Rnor_5.0 1 277404996 277912261 - Sorcs1em1Mcwi
4139864 Sorcs1em1Mcwi sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20 (del 1109-1122). 2010-08-19 2010-08-19 1305910 Sorcs1 Rnor_6.0 1 269965824 270473097 - Sorcs1em1Mcwi
5508343 Sorcs2em1Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 34-bp frameshift deletion in exon 15 (del 1989-2022) 2011-10-13 2013-10-07 1310621 Sorcs2 RGSC 3.4 14 79968072 80344330 + Sorcs2em1Mcwi
5508343 Sorcs2em1Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 34-bp frameshift deletion in exon 15 (del 1989-2022) 2011-10-13 2013-10-07 1310621 Sorcs2 Rnor_5.0 14 79176694 79547823 + Sorcs2em1Mcwi
5508343 Sorcs2em1Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 34-bp frameshift deletion in exon 15 (del 1989-2022) 2011-10-13 2013-10-07 1310621 Sorcs2 Rnor_6.0 14 79538911 79912333 + Sorcs2em1Mcwi
5508326 Sorcs2em4Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 15 (del 1991-1995) 2011-10-13 2011-10-13 1310621 Sorcs2 RGSC 3.4 14 79968072 80344330 + Sorcs2em4Mcwi
5508326 Sorcs2em4Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 15 (del 1991-1995) 2011-10-13 2011-10-13 1310621 Sorcs2 Rnor_5.0 14 79176694 79547823 + Sorcs2em4Mcwi
5508326 Sorcs2em4Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 15 (del 1991-1995) 2011-10-13 2011-10-13 1310621 Sorcs2 Rnor_6.0 14 79538911 79912333 + Sorcs2em4Mcwi
12790948 Sorcs2em7Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 RGSC 3.4 14 79968072 80344330 + Sorcs2em7Mcwi
12790948 Sorcs2em7Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 Rnor_5.0 14 79176694 79547823 + Sorcs2em7Mcwi
12790948 Sorcs2em7Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 Rnor_6.0 14 79538911 79912333 + Sorcs2em7Mcwi
12790952 Sorcs2em9Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 RGSC 3.4 14 79968072 80344330 + Sorcs2em9Mcwi
12790952 Sorcs2em9Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 Rnor_5.0 14 79176694 79547823 + Sorcs2em9Mcwi
12790952 Sorcs2em9Mcwi sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 15. 2017-02-22 2017-02-22 1310621 Sorcs2 Rnor_6.0 14 79538911 79912333 + Sorcs2em9Mcwi
5687731 Sorcs3em1Mcwi sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttcaaatgctccttaattccttgac) 2012-02-09 2012-02-09 1310974 Sorcs3 RGSC 3.4 1 254125935 254345330 + Sorcs3em1Mcwi
5687731 Sorcs3em1Mcwi sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttcaaatgctccttaattccttgac) 2012-02-09 2012-02-09 1310974 Sorcs3 Rnor_5.0 1 275416357 276060204 + Sorcs3em1Mcwi
5687731 Sorcs3em1Mcwi sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttcaaatgctccttaattccttgac) 2012-02-09 2012-02-09 1310974 Sorcs3 Rnor_6.0 1 267986305 268620331 + Sorcs3em1Mcwi
2301697 Spata13Tn(sb-T2/Bart3)2.267Mcwi spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene 2008-10-29 2008-10-29 1307364 Spata13 RGSC 3.4 15 39722469 39849214 + Spata13Tn(sb-T2/Bart3)2.267Mcwi
2301697 Spata13Tn(sb-T2/Bart3)2.267Mcwi spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene 2008-10-29 2008-10-29 1307364 Spata13 Rnor_5.0 15 44749770 44878760 + Spata13Tn(sb-T2/Bart3)2.267Mcwi
2301697 Spata13Tn(sb-T2/Bart3)2.267Mcwi spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene 2008-10-29 2008-10-29 1307364 Spata13 Rnor_6.0 15 40937652 41066645 + Spata13Tn(sb-T2/Bart3)2.267Mcwi
2290150 Spetex-2HTn(sb-T2/Bart3)2.136Mcwi Spetex-2H protein; transposon insertion 2.136, Medical College of Wisconsin trap construct into the 1st intron of the Spetex-2H gene 2008-02-26 2008-02-26 1359560 Spetex2h RGSC 3.4 15 5180002 5186910 Spetex-2HTn(sb-T2/Bart3)2.136Mcwi
329333021 Spon2em1Holi spondin 2; TALEN induced mutant1, Holi This Spon2 deleted mutationt was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats 2023-04-26 2023-04-26 708584 Spon2 Rnor_5.0 14 83501025 83510376 +
329333021 Spon2em1Holi spondin 2; TALEN induced mutant1, Holi This Spon2 deleted mutationt was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats 2023-04-26 2023-04-26 708584 Spon2 Rnor_6.0 14 82815158 82824529 +
11553895 Spp1em1Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 2016-10-17 2016-10-17 3752 Spp1 Rnor_5.0 14 6653086 6658937 - Spp1em1Mcwi
11553895 Spp1em1Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 2016-10-17 2016-10-17 3752 Spp1 Rnor_6.0 14 6673686 6679965 - Spp1em1Mcwi
13792814 Spp1em2Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. 2018-10-01 2018-10-01 3752 Spp1 Rnor_5.0 14 6653086 6658937 -
13792814 Spp1em2Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. 2018-10-01 2018-10-01 3752 Spp1 Rnor_6.0 14 6673686 6679965 -
13207530 Spp1em4Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 2017-08-04 2017-08-04 3752 Spp1 Rnor_5.0 14 6653086 6658937 - Spp1em4Mcwi
13207530 Spp1em4Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 2017-08-04 2017-08-04 3752 Spp1 Rnor_6.0 14 6673686 6679965 - Spp1em4Mcwi
13207528 spp1em3Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene. 2017-08-04 2017-08-04 3752 Spp1 Rnor_5.0 14 6653086 6658937 - spp1em3Mcwi
13207528 spp1em3Mcwi secreted phosphoprotein 1; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene. 2017-08-04 2017-08-04 3752 Spp1 Rnor_6.0 14 6673686 6679965 - spp1em3Mcwi
2305932 Spta1Tn(sb-T2/Bart3)2.315Mcwi spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene 2009-03-16 2009-03-16 1305194 Spta1 RGSC 3.4 13 89951924 90028592 + Spta1Tn(sb-T2/Bart3)2.315Mcwi
2305932 Spta1Tn(sb-T2/Bart3)2.315Mcwi spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene 2009-03-16 2009-03-16 1305194 Spta1 Rnor_5.0 13 96782387 96860327 + Spta1Tn(sb-T2/Bart3)2.315Mcwi
2305932 Spta1Tn(sb-T2/Bart3)2.315Mcwi spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene 2009-03-16 2009-03-16 1305194 Spta1 Rnor_6.0 13 92264231 92340091 + Spta1Tn(sb-T2/Bart3)2.315Mcwi
2290097 Sptbn4Tn(sb-T2/Bart3)2.179Mcwi spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. 2008-02-26 2008-02-26 1304682 Sptbn4 RGSC 3.4 1 82436626 82523827 - Spnb4Tn(sb-T2/Bart3)2.179Mcwi;Sptbn4Tn(sb-T2/Bart3)2.179Mcwi
2290097 Sptbn4Tn(sb-T2/Bart3)2.179Mcwi spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. 2008-02-26 2008-02-26 1304682 Sptbn4 Rnor_5.0 1 85379609 85467354 - Spnb4Tn(sb-T2/Bart3)2.179Mcwi;Sptbn4Tn(sb-T2/Bart3)2.179Mcwi
2290097 Sptbn4Tn(sb-T2/Bart3)2.179Mcwi spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. 2008-02-26 2008-02-26 1304682 Sptbn4 Rnor_6.0 1 84168494 84254679 - Spnb4Tn(sb-T2/Bart3)2.179Mcwi;Sptbn4Tn(sb-T2/Bart3)2.179Mcwi
2290124 Sptlc3Tn(sb-T2/Bart3)2.147Mcwi similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. 2008-02-26 2008-02-26 1310030 Sptlc3 RGSC 3.4 3 127691668 127825206 + RGD1310030Tn(sb-T2/Bart3)2.147Mcwi;Sptlc3Tn(sb-T2/Bart3)2.147Mcwi
2290124 Sptlc3Tn(sb-T2/Bart3)2.147Mcwi similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. 2008-02-26 2008-02-26 1310030 Sptlc3 Rnor_5.0 3 139023075 139151792 + RGD1310030Tn(sb-T2/Bart3)2.147Mcwi;Sptlc3Tn(sb-T2/Bart3)2.147Mcwi
2290124 Sptlc3Tn(sb-T2/Bart3)2.147Mcwi similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. 2008-02-26 2008-02-26 1310030 Sptlc3 Rnor_6.0 3 132560437 132689313 + RGD1310030Tn(sb-T2/Bart3)2.147Mcwi;Sptlc3Tn(sb-T2/Bart3)2.147Mcwi
5687722 Stc1em2Mcwi stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 717-724) 2012-02-09 2012-02-09 621776 Stc1 RGSC 3.4 15 49566885 49577539 + Stc1em2Mcwi
5687722 Stc1em2Mcwi stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 717-724) 2012-02-09 2012-02-09 621776 Stc1 Rnor_5.0 15 54622230 54632884 + Stc1em2Mcwi
5687722 Stc1em2Mcwi stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 717-724) 2012-02-09 2012-02-09 621776 Stc1 Rnor_6.0 15 50891137 50901791 + Stc1em2Mcwi
5509978 Stk39em2Mcwi serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 24-bp frameshift deletion in exon 7 (del 1232-1255) 2011-11-16 2011-11-16 621643 Stk39 RGSC 3.4 3 50249626 50517085 - Stk39em3Mcwi;Stk39em2Mcwi
5509978 Stk39em2Mcwi serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 24-bp frameshift deletion in exon 7 (del 1232-1255) 2011-11-16 2011-11-16 621643 Stk39 Rnor_5.0 3 60973443 61244306 - Stk39em3Mcwi;Stk39em2Mcwi
5509978 Stk39em2Mcwi serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 24-bp frameshift deletion in exon 7 (del 1232-1255) 2011-11-16 2011-11-16 621643 Stk39 Rnor_6.0 3 54359449 54625702 - Stk39em3Mcwi;Stk39em2Mcwi
10054460 Stk39em5Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 RGSC 3.4 3 50249626 50517085 - Stk39em5Mcwi
10054460 Stk39em5Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 Rnor_5.0 3 60973443 61244306 - Stk39em5Mcwi
10054460 Stk39em5Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 Rnor_6.0 3 54359449 54625702 - Stk39em5Mcwi
10054463 Stk39em6Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 RGSC 3.4 3 50249626 50517085 - Stk39em6Mcwi
10054463 Stk39em6Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 Rnor_5.0 3 60973443 61244306 - Stk39em6Mcwi
10054463 Stk39em6Mcwi serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Stk39 gene 2015-08-06 2016-10-19 621643 Stk39 Rnor_6.0 3 54359449 54625702 - Stk39em6Mcwi
2292450 Stxbp5lTn(sb-T2/Bart3)2.202Mcwi syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene 2008-04-18 2008-04-18 1311561 Stxbp5l RGSC 3.4 11 65129572 65455115 + Stxbp5lTn(sb-T2/Bart3)2.202Mcwi
2292450 Stxbp5lTn(sb-T2/Bart3)2.202Mcwi syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene 2008-04-18 2008-04-18 1311561 Stxbp5l Rnor_5.0 11 69337663 69661463 + Stxbp5lTn(sb-T2/Bart3)2.202Mcwi
2292450 Stxbp5lTn(sb-T2/Bart3)2.202Mcwi syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene 2008-04-18 2008-04-18 1311561 Stxbp5l Rnor_6.0 11 66246624 66566331 + Stxbp5lTn(sb-T2/Bart3)2.202Mcwi
2301696 Sf4Tn(sb-T2/Bart3)2.264Mcwi splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene 2008-10-29 2008-10-29 1310496 Sugp1 RGSC 3.4 16 19835921 19866795 - Sf4Tn(sb-T2/Bart3)2.264Mcwi
2301696 Sf4Tn(sb-T2/Bart3)2.264Mcwi splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene 2008-10-29 2008-10-29 1310496 Sugp1 Rnor_5.0 16 20950430 20985149 - Sf4Tn(sb-T2/Bart3)2.264Mcwi
2301696 Sf4Tn(sb-T2/Bart3)2.264Mcwi splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene 2008-10-29 2008-10-29 1310496 Sugp1 Rnor_5.0 16 21016310 21047301 - Sf4Tn(sb-T2/Bart3)2.264Mcwi
2301696 Sf4Tn(sb-T2/Bart3)2.264Mcwi splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene 2008-10-29 2008-10-29 1310496 Sugp1 Rnor_6.0 16 21100923 21131795 - Sf4Tn(sb-T2/Bart3)2.264Mcwi
12792962 Sv2am1Kyo synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo, A missense mutation (L174Q) in the first transmembrane spanning region was induced by N-ethyl-N-nitrosourea (ENU) in F344 rats. 2017-03-17 2017-03-17 619715 Sv2a RGSC 3.4 2 190989187 191000859 + Sv2aL174Q;Sv2am1Kyo
12792962 Sv2am1Kyo synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo, A missense mutation (L174Q) in the first transmembrane spanning region was induced by N-ethyl-N-nitrosourea (ENU) in F344 rats. 2017-03-17 2017-03-17 619715 Sv2a Rnor_5.0 2 217808165 217823872 + Sv2aL174Q;Sv2am1Kyo
12792962 Sv2am1Kyo synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo, A missense mutation (L174Q) in the first transmembrane spanning region was induced by N-ethyl-N-nitrosourea (ENU) in F344 rats. 2017-03-17 2017-03-17 619715 Sv2a Rnor_6.0 2 198321100 198336889 + Sv2aL174Q;Sv2am1Kyo
2292449 Syndig1Tn(sb-T2/Bart3)2.171Mcwi synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. 2008-04-18 2008-04-18 1310753 Syndig1 RGSC 3.4 3 139434170 139834916 + RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;similar to chromosome 20 open reading frame 39;RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;Syndig1Tn(sb-T2/Bart3)2.171Mcwi;transposon insertion 2.171, Medical College of Wisconsin
2292449 Syndig1Tn(sb-T2/Bart3)2.171Mcwi synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. 2008-04-18 2008-04-18 1310753 Syndig1 Rnor_5.0 3 151405855 151571801 + RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;similar to chromosome 20 open reading frame 39;RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;Syndig1Tn(sb-T2/Bart3)2.171Mcwi;transposon insertion 2.171, Medical College of Wisconsin
2292449 Syndig1Tn(sb-T2/Bart3)2.171Mcwi synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. 2008-04-18 2008-04-18 1310753 Syndig1 Rnor_6.0 3 145031427 145199273 + RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;similar to chromosome 20 open reading frame 39;RGD1310753Tn(sb-T2/Bart3)2.171Mcwi;Syndig1Tn(sb-T2/Bart3)2.171Mcwi;transposon insertion 2.171, Medical College of Wisconsin
2290153 Syne1Tn(sb-T2/Bart3)2.68Mcwi spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2008-02-26 2008-02-26 620546 Syne1 RGSC 3.4 1 35803552 36269628 - Syne1Tn(sb-T2/Bart3)2.68Mcwi
2290153 Syne1Tn(sb-T2/Bart3)2.68Mcwi spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2008-02-26 2008-02-26 620546 Syne1 Rnor_5.0 1 42947742 43158478 - Syne1Tn(sb-T2/Bart3)2.68Mcwi
2290153 Syne1Tn(sb-T2/Bart3)2.68Mcwi spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2008-02-26 2008-02-26 620546 Syne1 Rnor_6.0 1 41844840 42086662 - Syne1Tn(sb-T2/Bart3)2.68Mcwi
2290153 Syne1Tn(sb-T2/Bart3)2.68Mcwi spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2008-02-26 2008-02-26 620546 Syne1 Rnor_6.0 1 41608287 41763591 - Syne1Tn(sb-T2/Bart3)2.68Mcwi
626419667 Syngap1em1Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb This allele carrying a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. 2025-09-04 2025-09-04 621090 Syngap1 RGSC 3.4 20 5178523 5208449 +
626419667 Syngap1em1Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb This allele carrying a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. 2025-09-04 2025-09-04 621090 Syngap1 Rnor_5.0 20 7594614 7623865 +
626419667 Syngap1em1Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb This allele carrying a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. 2025-09-04 2025-09-04 621090 Syngap1 Rnor_6.0 20 5535434 5564657 +
626419668 Syngap1em2Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb This allele created in LE embryos contains a 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. 2025-09-04 2025-09-04 621090 Syngap1 RGSC 3.4 20 5178523 5208449 + synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb
626419668 Syngap1em2Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb This allele created in LE embryos contains a 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. 2025-09-04 2025-09-04 621090 Syngap1 Rnor_5.0 20 7594614 7623865 + synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb
626419668 Syngap1em2Sidb synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb This allele created in LE embryos contains a 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. 2025-09-04 2025-09-04 621090 Syngap1 Rnor_6.0 20 5535434 5564657 + synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb
713452446 Synpoem1Kmh synaptopodin;CRISPR/Cas9 induced mutant 1, Kmh In this allele, exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It carries a deletion of approximately 10 Kb between exon 2 and 3 of the synaptopodin gene 2026-05-12 2026-05-12 620668 Synpo RGSC 3.4 18 56552991 56573981 -
713452446 Synpoem1Kmh synaptopodin;CRISPR/Cas9 induced mutant 1, Kmh In this allele, exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It carries a deletion of approximately 10 Kb between exon 2 and 3 of the synaptopodin gene 2026-05-12 2026-05-12 620668 Synpo Rnor_5.0 18 55096559 55154838 -
713452446 Synpoem1Kmh synaptopodin;CRISPR/Cas9 induced mutant 1, Kmh In this allele, exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It carries a deletion of approximately 10 Kb between exon 2 and 3 of the synaptopodin gene 2026-05-12 2026-05-12 620668 Synpo Rnor_6.0 18 55863081 55921412 -
713454776 Synpoem2Kmh synaptopodin;CRISPR/Cas9 induced mutant 2, Kmh This allele has a mutation located upstream of exon 2 of rat Synpo gene. Resulting deletion of exons 2 and 3 and thus eliminates all known sypaptopodin isoforms. 2026-05-12 2026-05-12 620668 Synpo RGSC 3.4 18 56552991 56573981 -
713454776 Synpoem2Kmh synaptopodin;CRISPR/Cas9 induced mutant 2, Kmh This allele has a mutation located upstream of exon 2 of rat Synpo gene. Resulting deletion of exons 2 and 3 and thus eliminates all known sypaptopodin isoforms. 2026-05-12 2026-05-12 620668 Synpo Rnor_5.0 18 55096559 55154838 -
713454776 Synpoem2Kmh synaptopodin;CRISPR/Cas9 induced mutant 2, Kmh This allele has a mutation located upstream of exon 2 of rat Synpo gene. Resulting deletion of exons 2 and 3 and thus eliminates all known sypaptopodin isoforms. 2026-05-12 2026-05-12 620668 Synpo Rnor_6.0 18 55863081 55921412 -
713456094 Synpoem3Kmh synaptopodin;CRISPR/Cas9 induced mutant 3, Kmh The CRISPR/Cas9 system was used to introduce loxP sites flanking exons 2 and 3 of the Synpo gene in outbred LE rat embryos. 2026-05-12 2026-05-12 620668 Synpo RGSC 3.4 18 56552991 56573981 -
713456094 Synpoem3Kmh synaptopodin;CRISPR/Cas9 induced mutant 3, Kmh The CRISPR/Cas9 system was used to introduce loxP sites flanking exons 2 and 3 of the Synpo gene in outbred LE rat embryos. 2026-05-12 2026-05-12 620668 Synpo Rnor_5.0 18 55096559 55154838 -
713456094 Synpoem3Kmh synaptopodin;CRISPR/Cas9 induced mutant 3, Kmh The CRISPR/Cas9 system was used to introduce loxP sites flanking exons 2 and 3 of the Synpo gene in outbred LE rat embryos. 2026-05-12 2026-05-12 620668 Synpo Rnor_6.0 18 55863081 55921412 -
626469801 Taf7lem1Soar TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 110 bp deletion targeting Exon 3 of the Taf7l gene 2025-09-17 2025-09-17 1564898 Taf7l RGSC 3.4 X 121935672 121950719 -
626469801 Taf7lem1Soar TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 110 bp deletion targeting Exon 3 of the Taf7l gene 2025-09-17 2025-09-17 1564898 Taf7l Rnor_5.0 X 105183229 105199248 -
626469801 Taf7lem1Soar TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 110 bp deletion targeting Exon 3 of the Taf7l gene 2025-09-17 2025-09-17 1564898 Taf7l Rnor_6.0 X 105292338 105308554 -
2290098 Fam19a2Tn(sb-T2/Bart3)2.184Mcwi similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. 2008-02-26 2008-02-26 1589429 Tafa2 RGSC 3.4 7 63388665 63566226 + LOC680647Tn(sb-T2/Bart3)2.184Mcwi;Fam19a2Tn(sb-T2/Bart3)2.184Mcwi
2290098 Fam19a2Tn(sb-T2/Bart3)2.184Mcwi similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. 2008-02-26 2008-02-26 1589429 Tafa2 Rnor_5.0 7 66221368 66695803 - LOC680647Tn(sb-T2/Bart3)2.184Mcwi;Fam19a2Tn(sb-T2/Bart3)2.184Mcwi
2290098 Fam19a2Tn(sb-T2/Bart3)2.184Mcwi similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. 2008-02-26 2008-02-26 1589429 Tafa2 Rnor_6.0 7 66017066 66496690 - LOC680647Tn(sb-T2/Bart3)2.184Mcwi;Fam19a2Tn(sb-T2/Bart3)2.184Mcwi
2299101 Tasp1Tn(sb-T2/Bart3)2.219Mcwi taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene 2008-08-12 2008-08-12 1308591 Tasp1 RGSC 3.4 3 128002479 128228127 - Tasp1Tn(sb-T2/Bart3)2.219Mcwi
2299101 Tasp1Tn(sb-T2/Bart3)2.219Mcwi taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene 2008-08-12 2008-08-12 1308591 Tasp1 Rnor_5.0 3 139347611 139588372 - Tasp1Tn(sb-T2/Bart3)2.219Mcwi
2299101 Tasp1Tn(sb-T2/Bart3)2.219Mcwi taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene 2008-08-12 2008-08-12 1308591 Tasp1 Rnor_6.0 3 132888785 133131213 - Tasp1Tn(sb-T2/Bart3)2.219Mcwi
150521709 Tbc1d1Tn(sb)1Fkh TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley. 2021-11-16 2021-11-16 1304562 Tbc1d1 RGSC 3.4 14 46594874 46781813 -
150521709 Tbc1d1Tn(sb)1Fkh TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley. 2021-11-16 2021-11-16 1304562 Tbc1d1 Rnor_5.0 14 45404208 45603325 -
150521709 Tbc1d1Tn(sb)1Fkh TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley. 2021-11-16 2021-11-16 1304562 Tbc1d1 Rnor_6.0 14 45598753 45797650 -
38596330 Tbc1d4em1 TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1, A 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) in the rat Tbc1d4 gene was created in outbred Wistar zygotes with CRISPR/Cas9 system. 2020-09-03 2020-09-03 1561609 Tbc1d4 RGSC 3.4 15 85359159 85561229 - Tbc1d4em1M
38596330 Tbc1d4em1 TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1, A 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) in the rat Tbc1d4 gene was created in outbred Wistar zygotes with CRISPR/Cas9 system. 2020-09-03 2020-09-03 1561609 Tbc1d4 Rnor_5.0 15 89695614 89871879 - Tbc1d4em1M
38596330 Tbc1d4em1 TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1, A 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) in the rat Tbc1d4 gene was created in outbred Wistar zygotes with CRISPR/Cas9 system. 2020-09-03 2020-09-03 1561609 Tbc1d4 Rnor_6.0 15 85927978 86105829 - Tbc1d4em1M
626471108 Tbx21em1Sage T-box transcription factor 21; ZFN induced mutant 1, Sage This allele is created using ZFN technology targeting Tbx21 exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). 2025-09-18 2025-09-18 1308264 Tbx21 RGSC 3.4 10 85817743 85834178 -
626471108 Tbx21em1Sage T-box transcription factor 21; ZFN induced mutant 1, Sage This allele is created using ZFN technology targeting Tbx21 exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). 2025-09-18 2025-09-18 1308264 Tbx21 Rnor_5.0 10 84822665 84839295 -
626471108 Tbx21em1Sage T-box transcription factor 21; ZFN induced mutant 1, Sage This allele is created using ZFN technology targeting Tbx21 exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). 2025-09-18 2025-09-18 1308264 Tbx21 Rnor_6.0 10 85032799 85049331 -
5509981 Tcf7l2em1Mcwi transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457) 2011-11-16 2011-11-16 1583621 Tcf7l2 RGSC 3.4 1 262031823 262226710 + Tcf7l2em1Mcwi
5509981 Tcf7l2em1Mcwi transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457) 2011-11-16 2011-11-16 1583621 Tcf7l2 Rnor_5.0 1 284077353 284118928 + Tcf7l2em1Mcwi
5509981 Tcf7l2em1Mcwi transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457) 2011-11-16 2011-11-16 1583621 Tcf7l2 Rnor_5.0 1 283387566 283412364 - Tcf7l2em1Mcwi
5509981 Tcf7l2em1Mcwi transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457) 2011-11-16 2011-11-16 1583621 Tcf7l2 Rnor_6.0 1 276686911 276730517 + Tcf7l2em1Mcwi
12790955 Tertem2Mcwi telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Tert gene. 2017-02-22 2017-02-22 70494 Tert RGSC 3.4 1 30445180 30465942 - Tertem2Mcwi
12790955 Tertem2Mcwi telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Tert gene. 2017-02-22 2017-02-22 70494 Tert Rnor_5.0 1 33675744 33697542 - Tertem2Mcwi
12790955 Tertem2Mcwi telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Tert gene. 2017-02-22 2017-02-22 70494 Tert Rnor_6.0 1 32250876 32275330 - Tertem2Mcwi
151665773 Tfap2cem1(tdTomato)Nips transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. 2022-04-01 2022-04-01 1303185 Tfap2c RGSC 3.4 3 163459283 163467166 +
151665773 Tfap2cem1(tdTomato)Nips transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. 2022-04-01 2022-04-01 1303185 Tfap2c Rnor_5.0 3 176625472 176633355 +
151665773 Tfap2cem1(tdTomato)Nips transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. 2022-04-01 2022-04-01 1303185 Tfap2c Rnor_6.0 3 170550314 170558197 +
626469802 Tfap2cem1Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c RGSC 3.4 3 163459283 163467166 +
626469802 Tfap2cem1Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c Rnor_5.0 3 176625472 176633355 +
626469802 Tfap2cem1Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c Rnor_6.0 3 170550314 170558197 +
626469803 Tfap2cem2Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c RGSC 3.4 3 163459283 163467166 + transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar;Tfap2cem3Soar
626469803 Tfap2cem2Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c Rnor_5.0 3 176625472 176633355 + transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar;Tfap2cem3Soar
626469803 Tfap2cem2Soar transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene 2025-09-17 2025-09-17 1303185 Tfap2c Rnor_6.0 3 170550314 170558197 + transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar;Tfap2cem3Soar
5508332 Tfdp2em2Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 6 (del 620-632) 2011-10-13 2011-10-13 1305814 Tfdp2 RGSC 3.4 8 101256112 101392512 + Tfdp2em2Mcwi
5508332 Tfdp2em2Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 6 (del 620-632) 2011-10-13 2011-10-13 1305814 Tfdp2 Rnor_5.0 8 103489105 103629520 + Tfdp2em2Mcwi
5508332 Tfdp2em2Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 6 (del 620-632) 2011-10-13 2011-10-13 1305814 Tfdp2 Rnor_6.0 8 104040795 104181228 + Tfdp2em2Mcwi
5508334 Tfdp2em5Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 618-633) 2011-10-13 2011-10-13 1305814 Tfdp2 RGSC 3.4 8 101256112 101392512 + Tfdp2em5Mcwi
5508334 Tfdp2em5Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 618-633) 2011-10-13 2011-10-13 1305814 Tfdp2 Rnor_5.0 8 103489105 103629520 + Tfdp2em5Mcwi
5508334 Tfdp2em5Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 618-633) 2011-10-13 2011-10-13 1305814 Tfdp2 Rnor_6.0 8 104040795 104181228 + Tfdp2em5Mcwi
6893417 Tfdp2em6Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 6 (del 614-627) 2012-08-28 2012-08-28 1305814 Tfdp2 RGSC 3.4 8 101256112 101392512 + Tfdp2em6Mcwi
6893417 Tfdp2em6Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 6 (del 614-627) 2012-08-28 2012-08-28 1305814 Tfdp2 Rnor_5.0 8 103489105 103629520 + Tfdp2em6Mcwi
6893417 Tfdp2em6Mcwi transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 6 (del 614-627) 2012-08-28 2012-08-28 1305814 Tfdp2 Rnor_6.0 8 104040795 104181228 + Tfdp2em6Mcwi
12879860 Tgrdw thyroglobulin; rdw mutant This allele has a spontaneous missense mutation, G2320R, in the thyroglobul gene and this mutation is responsible for the congenital dwarfism in the WIC-TgrdwKts rat strain. 2017-04-27 2017-04-27 3848 Tg RGSC 3.4 7 104035776 104220754 + Tgrdw
12879860 Tgrdw thyroglobulin; rdw mutant This allele has a spontaneous missense mutation, G2320R, in the thyroglobul gene and this mutation is responsible for the congenital dwarfism in the WIC-TgrdwKts rat strain. 2017-04-27 2017-04-27 3848 Tg Rnor_5.0 7 107399165 107602400 + Tgrdw
12879860 Tgrdw thyroglobulin; rdw mutant This allele has a spontaneous missense mutation, G2320R, in the thyroglobul gene and this mutation is responsible for the congenital dwarfism in the WIC-TgrdwKts rat strain. 2017-04-27 2017-04-27 3848 Tg Rnor_6.0 7 107467260 107652897 + Tgrdw
5131986 Tgfb1em1Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 12-bp frameshift deletion in exon 3 (del 193-204). 2011-05-17 2011-05-17 69051 Tgfb1 RGSC 3.4 1 80894705 80911020 + Tgfb1em1Mcwi
5131986 Tgfb1em1Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 12-bp frameshift deletion in exon 3 (del 193-204). 2011-05-17 2011-05-17 69051 Tgfb1 Rnor_5.0 1 83742151 83758472 + Tgfb1em1Mcwi
5131986 Tgfb1em1Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 12-bp frameshift deletion in exon 3 (del 193-204). 2011-05-17 2011-05-17 69051 Tgfb1 Rnor_6.0 1 82480875 82497196 + Tgfb1em1Mcwi
5131980 Tgfb1em3Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 22-bp frameshift deletion in exon 3 (del 191-212). 2011-05-17 2011-05-17 69051 Tgfb1 RGSC 3.4 1 80894705 80911020 + Tgfb1em3Mcwi
5131980 Tgfb1em3Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 22-bp frameshift deletion in exon 3 (del 191-212). 2011-05-17 2011-05-17 69051 Tgfb1 Rnor_5.0 1 83742151 83758472 + Tgfb1em3Mcwi
5131980 Tgfb1em3Mcwi transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 22-bp frameshift deletion in exon 3 (del 191-212). 2011-05-17 2011-05-17 69051 Tgfb1 Rnor_6.0 1 82480875 82497196 + Tgfb1em3Mcwi
1578800 Tgfbr2m1Mcwi transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T289M mutation is generated from the codon change ACG/ATG 2006-05-02 2006-05-02 69651 Tgfbr2 RGSC 3.4 8 120593595 120680453 - Tgfbr2m1Mcwi
1578800 Tgfbr2m1Mcwi transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T289M mutation is generated from the codon change ACG/ATG 2006-05-02 2006-05-02 69651 Tgfbr2 Rnor_5.0 8 123585765 123671209 - Tgfbr2m1Mcwi
1578800 Tgfbr2m1Mcwi transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); T289M mutation is generated from the codon change ACG/ATG 2006-05-02 2006-05-02 69651 Tgfbr2 Rnor_6.0 8 124310288 124399345 - Tgfbr2m1Mcwi
1578782 Tgfbr2m2Mcwi transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E311K mutation is generated from the codon change GAG/AAG 2006-05-02 2006-05-02 69651 Tgfbr2 RGSC 3.4 8 120593595 120680453 - Tgfbr2m2Mcwi
1578782 Tgfbr2m2Mcwi transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E311K mutation is generated from the codon change GAG/AAG 2006-05-02 2006-05-02 69651 Tgfbr2 Rnor_5.0 8 123585765 123671209 - Tgfbr2m2Mcwi
1578782 Tgfbr2m2Mcwi transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); E311K mutation is generated from the codon change GAG/AAG 2006-05-02 2006-05-02 69651 Tgfbr2 Rnor_6.0 8 124310288 124399345 - Tgfbr2m2Mcwi
1642182 Thbdm1Mcwi thrombomodulin; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N256K mutation is generated from the codon change AAC/AAA 2007-09-06 2007-09-06 621299 Thbd RGSC 3.4 3 137158955 137162607 - Thbdm1Mcwi
1642182 Thbdm1Mcwi thrombomodulin; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N256K mutation is generated from the codon change AAC/AAA 2007-09-06 2007-09-06 621299 Thbd Rnor_5.0 3 149159895 149163547 - Thbdm1Mcwi
1642182 Thbdm1Mcwi thrombomodulin; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); N256K mutation is generated from the codon change AAC/AAA 2007-09-06 2007-09-06 621299 Thbd Rnor_6.0 3 142748673 142752325 - Thbdm1Mcwi
626469576 Thbdem1Soar thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar 1316 bp deletion of the coding region of the Thbd gene 2025-09-16 2025-09-16 621299 Thbd RGSC 3.4 3 137158955 137162607 -
626469576 Thbdem1Soar thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar 1316 bp deletion of the coding region of the Thbd gene 2025-09-16 2025-09-16 621299 Thbd Rnor_5.0 3 149159895 149163547 -
626469576 Thbdem1Soar thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar 1316 bp deletion of the coding region of the Thbd gene 2025-09-16 2025-09-16 621299 Thbd Rnor_6.0 3 142748673 142752325 -
730454553 Thbs4em1Luozd thrombospondin 4;CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce loxP sites flanking exon 9 of the Thbs4 gene of rat embryos. 2026-05-26 2026-05-26 62046 Thbs4 RGSC 3.4 2 23010823 23053527 -
730454553 Thbs4em1Luozd thrombospondin 4;CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce loxP sites flanking exon 9 of the Thbs4 gene of rat embryos. 2026-05-26 2026-05-26 62046 Thbs4 Rnor_5.0 2 41549115 41591101 -
730454553 Thbs4em1Luozd thrombospondin 4;CRISPR/Cas9 induced mutant 1, Luozd The CRISPR system was used to introduce loxP sites flanking exon 9 of the Thbs4 gene of rat embryos. 2026-05-26 2026-05-26 62046 Thbs4 Rnor_6.0 2 22343727 22385855 -
38599156 Themism1Adej thymocyte selection associated; mutant1, Adej This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption. 2020-09-11 2020-09-11 1560849 Themis RGSC 3.4 1 17032677 17226924 -
38599156 Themism1Adej thymocyte selection associated; mutant1, Adej This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption. 2020-09-11 2020-09-11 1560849 Themis Rnor_5.0 1 18308043 18532366 -
38599156 Themism1Adej thymocyte selection associated; mutant1, Adej This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption. 2020-09-11 2020-09-11 1560849 Themis Rnor_6.0 1 17152973 17378225 -
1578785 Tlr4m1Mcwi toll-like receptor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V489A mutation is generated 2006-05-02 2006-05-02 3870 Tlr4 RGSC 3.4 5 83564100 83577735 + Tlr4m1Mcwi
1578785 Tlr4m1Mcwi toll-like receptor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V489A mutation is generated 2006-05-02 2006-05-02 3870 Tlr4 Rnor_5.0 5 86690670 86704302 + Tlr4m1Mcwi
1578785 Tlr4m1Mcwi toll-like receptor 4; mutation 1, Medical College of Wisconsin mutation generated by ENU (N-ethyl-N-nitrourea); V489A mutation is generated 2006-05-02 2006-05-02 3870 Tlr4 Rnor_6.0 5 82587424 82601056 + Tlr4m1Mcwi
7257661 Tlr4em1Geh toll-like receptor 4; mutation 1, Gregg E. Homanics TALEN (Transcription activator-like effector nuclease) mediated 13 bp deletion in Exon 1 2013-08-28 2013-08-28 3870 Tlr4 RGSC 3.4 5 83564100 83577735 + Tlr4em1Geh
7257661 Tlr4em1Geh toll-like receptor 4; mutation 1, Gregg E. Homanics TALEN (Transcription activator-like effector nuclease) mediated 13 bp deletion in Exon 1 2013-08-28 2013-08-28 3870 Tlr4 Rnor_5.0 5 86690670 86704302 + Tlr4em1Geh
7257661 Tlr4em1Geh toll-like receptor 4; mutation 1, Gregg E. Homanics TALEN (Transcription activator-like effector nuclease) mediated 13 bp deletion in Exon 1 2013-08-28 2013-08-28 3870 Tlr4 Rnor_6.0 5 82587424 82601056 + Tlr4em1Geh
13793373 Tlr4em1Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. 2018-10-03 2018-10-03 3870 Tlr4 RGSC 3.4 5 83564100 83577735 +
13793373 Tlr4em1Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. 2018-10-03 2018-10-03 3870 Tlr4 Rnor_5.0 5 86690670 86704302 +
13793373 Tlr4em1Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. 2018-10-03 2018-10-03 3870 Tlr4 Rnor_6.0 5 82587424 82601056 +
14394509 Tlr4em5Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos 2019-03-25 2019-03-25 3870 Tlr4 RGSC 3.4 5 83564100 83577735 +
14394509 Tlr4em5Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos 2019-03-25 2019-03-25 3870 Tlr4 Rnor_5.0 5 86690670 86704302 +
14394509 Tlr4em5Mcwi toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos 2019-03-25 2019-03-25 3870 Tlr4 Rnor_6.0 5 82587424 82601056 +
2290156 Tmco1Tn(sb-T2/Bart3)2.135Mcwi transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene 2008-02-26 2008-02-26 1359178 Tmco1 RGSC 3.4 13 82971926 82995262 + Tmco1Tn(sb-T2/Bart3)2.135Mcwi
2290156 Tmco1Tn(sb-T2/Bart3)2.135Mcwi transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene 2008-02-26 2008-02-26 1359178 Tmco1 Rnor_5.0 13 90201608 90202246 + Tmco1Tn(sb-T2/Bart3)2.135Mcwi
2290156 Tmco1Tn(sb-T2/Bart3)2.135Mcwi transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene 2008-02-26 2008-02-26 1359178 Tmco1 Rnor_5.0 13 90108152 90131984 + Tmco1Tn(sb-T2/Bart3)2.135Mcwi
2290156 Tmco1Tn(sb-T2/Bart3)2.135Mcwi transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene 2008-02-26 2008-02-26 1359178 Tmco1 Rnor_6.0 13 85465015 85559113 + Tmco1Tn(sb-T2/Bart3)2.135Mcwi
626419687 Tmem130em1Taoki transmembrane protein 130; endonuclease induced mutant 1, Taoki This allele was generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG 2025-09-05 2025-09-05 1563248 Tmem130 RGSC 3.4 12 10153114 10177002 +
626419687 Tmem130em1Taoki transmembrane protein 130; endonuclease induced mutant 1, Taoki This allele was generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG 2025-09-05 2025-09-05 1563248 Tmem130 Rnor_5.0 12 13876610 13900957 +
626419687 Tmem130em1Taoki transmembrane protein 130; endonuclease induced mutant 1, Taoki This allele was generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG 2025-09-05 2025-09-05 1563248 Tmem130 Rnor_6.0 12 11814071 11840100 +
14995943 Tmem67wpk transmembrane protein 67; wpk mutant A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. 2019-11-01 2019-11-21 1586167 Tmem67 RGSC 3.4 5 26324625 26377531 -
14995943 Tmem67wpk transmembrane protein 67; wpk mutant A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. 2019-11-01 2019-11-21 1586167 Tmem67 Rnor_5.0 5 30371964 30424943 -
14995943 Tmem67wpk transmembrane protein 67; wpk mutant A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. 2019-11-01 2019-11-21 1586167 Tmem67 Rnor_6.0 5 25666138 25721056 -
2302646 Tmtc2Tn(sb-T2/Bart3)2.276Mcwi transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene 2009-01-06 2009-01-06 1309848 Tmtc2 RGSC 3.4 7 43667983 44133854 - Tmtc2Tn(sb-T2/Bart3)2.276Mcwi
2302646 Tmtc2Tn(sb-T2/Bart3)2.276Mcwi transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene 2009-01-06 2009-01-06 1309848 Tmtc2 Rnor_5.0 7 47197110 47603261 - Tmtc2Tn(sb-T2/Bart3)2.276Mcwi
2302646 Tmtc2Tn(sb-T2/Bart3)2.276Mcwi transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene 2009-01-06 2009-01-06 1309848 Tmtc2 Rnor_6.0 7 47179596 47586777 - Tmtc2Tn(sb-T2/Bart3)2.276Mcwi
12904898 Tp53em1Sage tumor protein p53; ZFN induced mutant 1, Sage This ZFN allele exhibits a 11 base pair deletion in the rat Tp53 gene. 2017-05-24 2017-05-24 3889 Tp53 RGSC 3.4 10 56399721 56411150 + Tp53 tm1sage;tumor protein p53; endonuclease induced mutant 1, Sage;Tp53em1Sage
12904898 Tp53em1Sage tumor protein p53; ZFN induced mutant 1, Sage This ZFN allele exhibits a 11 base pair deletion in the rat Tp53 gene. 2017-05-24 2017-05-24 3889 Tp53 Rnor_5.0 10 55932658 55944087 + Tp53 tm1sage;tumor protein p53; endonuclease induced mutant 1, Sage;Tp53em1Sage
12904898 Tp53em1Sage tumor protein p53; ZFN induced mutant 1, Sage This ZFN allele exhibits a 11 base pair deletion in the rat Tp53 gene. 2017-05-24 2017-05-24 3889 Tp53 Rnor_6.0 10 56186299 56198449 + Tp53 tm1sage;tumor protein p53; endonuclease induced mutant 1, Sage;Tp53em1Sage
11553885 Tp53em3Mcwi tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. 2016-10-17 2016-10-17 3889 Tp53 RGSC 3.4 10 56399721 56411150 + tumor protein p53;Tp53em3Mcwi
11553885 Tp53em3Mcwi tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. 2016-10-17 2016-10-17 3889 Tp53 Rnor_5.0 10 55932658 55944087 + tumor protein p53;Tp53em3Mcwi
11553885 Tp53em3Mcwi tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. 2016-10-17 2016-10-17 3889 Tp53 Rnor_6.0 10 56186299 56198449 + tumor protein p53;Tp53em3Mcwi
12792955 Tp53m1Kyo tumor protein p53; ENU induced mutant1, Kyo, A missense mutation R271C in the rat Tp53 was induced by ethylnitrosourea (ENU) mutagenesis in F344/Nslc. 2017-03-16 2017-03-16 3889 Tp53 RGSC 3.4 10 56399721 56411150 + Tp53 missense;Tp53m1Kyo
12792955 Tp53m1Kyo tumor protein p53; ENU induced mutant1, Kyo, A missense mutation R271C in the rat Tp53 was induced by ethylnitrosourea (ENU) mutagenesis in F344/Nslc. 2017-03-16 2017-03-16 3889 Tp53 Rnor_5.0 10 55932658 55944087 + Tp53 missense;Tp53m1Kyo
12792955 Tp53m1Kyo tumor protein p53; ENU induced mutant1, Kyo, A missense mutation R271C in the rat Tp53 was induced by ethylnitrosourea (ENU) mutagenesis in F344/Nslc. 2017-03-16 2017-03-16 3889 Tp53 Rnor_6.0 10 56186299 56198449 + Tp53 missense;Tp53m1Kyo
12792957 Tp53tm1(EGFP-Pac)Qly tumor protein p53; tm1, EGFP-Pac, Qly This allele was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5' and 1.6- kb 3' homology arms and a CAG-EGFP-IRES-Pac cassette. Absence of Tp53 protein was confirmed by western blot in homozygous animals. 2017-03-16 2017-03-16 3889 Tp53 RGSC 3.4 10 56399721 56411150 + Tp53tm1(EGFP-Pac)Qly
12792957 Tp53tm1(EGFP-Pac)Qly tumor protein p53; tm1, EGFP-Pac, Qly This allele was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5' and 1.6- kb 3' homology arms and a CAG-EGFP-IRES-Pac cassette. Absence of Tp53 protein was confirmed by western blot in homozygous animals. 2017-03-16 2017-03-16 3889 Tp53 Rnor_5.0 10 55932658 55944087 + Tp53tm1(EGFP-Pac)Qly
12792957 Tp53tm1(EGFP-Pac)Qly tumor protein p53; tm1, EGFP-Pac, Qly This allele was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5' and 1.6- kb 3' homology arms and a CAG-EGFP-IRES-Pac cassette. Absence of Tp53 protein was confirmed by western blot in homozygous animals. 2017-03-16 2017-03-16 3889 Tp53 Rnor_6.0 10 56186299 56198449 + Tp53tm1(EGFP-Pac)Qly
11553893 Tpcn2em1Mcwi two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. 2016-10-17 2016-10-17 1311779 Tpcn2 RGSC 3.4 1 205702971 205732664 - two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Tpcn2em1Mcwi
11553893 Tpcn2em1Mcwi two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. 2016-10-17 2016-10-17 1311779 Tpcn2 Rnor_5.0 1 225286480 225316685 - two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Tpcn2em1Mcwi
11553893 Tpcn2em1Mcwi two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin This allele was made by ZFN system. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. 2016-10-17 2016-10-17 1311779 Tpcn2 Rnor_6.0 1 218419182 218448902 - two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Tpcn2em1Mcwi
13208230 Tph1em1Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 RGSC 3.4 1 97186071 97207551 - Tph1em1Mcwi
13208230 Tph1em1Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 Rnor_5.0 1 103746878 103774100 - Tph1em1Mcwi
13208230 Tph1em1Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 Rnor_6.0 1 102669868 102699442 - Tph1em1Mcwi
13208232 Tph1em3Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 RGSC 3.4 1 97186071 97207551 - Tph1em3Mcwi
13208232 Tph1em3Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 Rnor_5.0 1 103746878 103774100 - Tph1em3Mcwi
13208232 Tph1em3Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. 2017-08-08 2017-08-08 3895 Tph1 Rnor_6.0 1 102669868 102699442 - Tph1em3Mcwi
13793375 Tph1em4Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. 2018-10-03 2018-10-03 3895 Tph1 RGSC 3.4 1 97186071 97207551 -
13793375 Tph1em4Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. 2018-10-03 2018-10-03 3895 Tph1 Rnor_5.0 1 103746878 103774100 -
13793375 Tph1em4Mcwi tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. 2018-10-03 2018-10-03 3895 Tph1 Rnor_6.0 1 102669868 102699442 -
10402817 Tph2em2Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1027-1036) 2015-10-30 2015-10-30 631332 Tph2 RGSC 3.4 7 54321033 54430706 - Tph2em2Mcwi
10402817 Tph2em2Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1027-1036) 2015-10-30 2015-10-30 631332 Tph2 Rnor_5.0 7 58053268 58157949 - Tph2em2Mcwi
10402817 Tph2em2Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1027-1036) 2015-10-30 2015-10-30 631332 Tph2 Rnor_6.0 7 58042279 58149220 - Tph2em2Mcwi
10402820 Tph2em3Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 11-bp frameshift deletion in exon 7 (del 1027-1037) 2015-10-30 2015-10-30 631332 Tph2 RGSC 3.4 7 54321033 54430706 - Tph2em3Mcwi
10402820 Tph2em3Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 11-bp frameshift deletion in exon 7 (del 1027-1037) 2015-10-30 2015-10-30 631332 Tph2 Rnor_5.0 7 58053268 58157949 - Tph2em3Mcwi
10402820 Tph2em3Mcwi tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 11-bp frameshift deletion in exon 7 (del 1027-1037) 2015-10-30 2015-10-30 631332 Tph2 Rnor_6.0 7 58042279 58149220 - Tph2em3Mcwi
5508352 Trafd1em1Mcwi TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 5 (del 440-452) 2011-10-13 2011-10-13 620171 Trafd1 RGSC 3.4 12 36301824 36315741 + Trafd1em1Mcwi
5508352 Trafd1em1Mcwi TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 5 (del 440-452) 2011-10-13 2011-10-13 620171 Trafd1 Rnor_5.0 12 42562635 42576553 + Trafd1em1Mcwi
5508352 Trafd1em1Mcwi TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 5 (del 440-452) 2011-10-13 2011-10-13 620171 Trafd1 Rnor_6.0 12 40695520 40709438 + Trafd1em1Mcwi
2299099 TrdnTn(sb-T2/Bart3)2.238Mcwi triadin; transposon insertion 2.238, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene 2008-08-12 2008-08-12 619856 Trdn RGSC 3.4 1 24514752 24925948 - TrdnTn(sb-T2/Bart3)2.238Mcwi
2299099 TrdnTn(sb-T2/Bart3)2.238Mcwi triadin; transposon insertion 2.238, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene 2008-08-12 2008-08-12 619856 Trdn Rnor_5.0 1 26865461 27248423 - TrdnTn(sb-T2/Bart3)2.238Mcwi
2299099 TrdnTn(sb-T2/Bart3)2.238Mcwi triadin; transposon insertion 2.238, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene 2008-08-12 2008-08-12 619856 Trdn Rnor_6.0 1 25403390 25787664 - TrdnTn(sb-T2/Bart3)2.238Mcwi
14696789 Trim63em1(hiLuc) tripartite motif containing 63; ZFN targeted mutation 1 The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, 2019-07-25 2019-07-25 619964 Trim63 RGSC 3.4 5 153059573 153073907 +
14696789 Trim63em1(hiLuc) tripartite motif containing 63; ZFN targeted mutation 1 The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, 2019-07-25 2019-07-25 619964 Trim63 Rnor_5.0 5 156292566 156306092 +
14696789 Trim63em1(hiLuc) tripartite motif containing 63; ZFN targeted mutation 1 The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, 2019-07-25 2019-07-25 619964 Trim63 Rnor_6.0 5 152533362 152547138 +
127285812 Trpa1em1Gne transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne This Trpa1-deleted allele was generated by using CRISPR/Cas9. It has a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901. 2021-07-01 2021-07-01 1303284 Trpa1 RGSC 3.4 5 3531163 3584401 +
127285812 Trpa1em1Gne transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne This Trpa1-deleted allele was generated by using CRISPR/Cas9. It has a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901. 2021-07-01 2021-07-01 1303284 Trpa1 Rnor_5.0 5 3764339 3818781 +
127285812 Trpa1em1Gne transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne This Trpa1-deleted allele was generated by using CRISPR/Cas9. It has a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901. 2021-07-01 2021-07-01 1303284 Trpa1 Rnor_6.0 5 3783247 3836485 +
38676449 Trpa1em1Kcrd transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. 2020-09-17 2020-09-17 1303284 Trpa1 RGSC 3.4 5 3531163 3584401 +
38676449 Trpa1em1Kcrd transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. 2020-09-17 2020-09-17 1303284 Trpa1 Rnor_5.0 5 3764339 3818781 +
38676449 Trpa1em1Kcrd transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. 2020-09-17 2020-09-17 1303284 Trpa1 Rnor_6.0 5 3783247 3836485 +
11553891 Trpc3em1Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 RGSC 3.4 2 123117180 123184016 - Trpc3em1Mcwi
11553891 Trpc3em1Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 Rnor_5.0 2 142945309 143022844 - Trpc3em1Mcwi
11553891 Trpc3em1Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 Rnor_6.0 2 123329954 123467574 - Trpc3em1Mcwi
11553887 Trpc3em2Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 RGSC 3.4 2 123117180 123184016 - transient receptor potential cation channel, subfamily C, member 3;CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin;Trpc3em2Mcwi
11553887 Trpc3em2Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 Rnor_5.0 2 142945309 143022844 - transient receptor potential cation channel, subfamily C, member 3;CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin;Trpc3em2Mcwi
11553887 Trpc3em2Mcwi transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. 2016-10-17 2016-10-17 61973 Trpc3 Rnor_6.0 2 123329954 123467574 - transient receptor potential cation channel, subfamily C, member 3;CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin;Trpc3em2Mcwi
126848808 Trpc4Tn(sb)Tngen transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. This insertion resulted in knockout of Trpc4. 2021-05-04 2021-05-04 621276 Trpc4 RGSC 3.4 2 143350286 143485716 +
126848808 Trpc4Tn(sb)Tngen transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. This insertion resulted in knockout of Trpc4. 2021-05-04 2021-05-04 621276 Trpc4 Rnor_5.0 2 163115873 163282223 +
126848808 Trpc4Tn(sb)Tngen transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. This insertion resulted in knockout of Trpc4. 2021-05-04 2021-05-04 621276 Trpc4 Rnor_6.0 2 143433102 143605757 +
2290060 Trpc4Tn(sb-T2/Bart3)2.192Mcwi transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene 2008-02-26 2008-02-26 621276 Trpc4 RGSC 3.4 2 143350286 143485716 + Trpc4Tn(sb-T2/Bart3)2.192Mcwi
2290060 Trpc4Tn(sb-T2/Bart3)2.192Mcwi transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene 2008-02-26 2008-02-26 621276 Trpc4 Rnor_5.0 2 163115873 163282223 + Trpc4Tn(sb-T2/Bart3)2.192Mcwi
2290060 Trpc4Tn(sb-T2/Bart3)2.192Mcwi transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene 2008-02-26 2008-02-26 621276 Trpc4 Rnor_6.0 2 143433102 143605757 + Trpc4Tn(sb-T2/Bart3)2.192Mcwi
11553911 Trpc6em1Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 RGSC 3.4 8 5472515 5577537 + Trpc6em1Mcwi
11553911 Trpc6em1Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_5.0 8 6799564 6904623 + Trpc6em1Mcwi
11553911 Trpc6em1Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_6.0 8 6811543 6917534 + Trpc6em1Mcwi
11553901 Trpc6em3Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 RGSC 3.4 8 5472515 5577537 + Trpc6em3Mcwi
11553901 Trpc6em3Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_5.0 8 6799564 6904623 + Trpc6em3Mcwi
11553901 Trpc6em3Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_6.0 8 6811543 6917534 + Trpc6em3Mcwi
11553907 Trpc6em4Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 RGSC 3.4 8 5472515 5577537 + Trpc6 CRISPR/Cas9 induced mutant 1 (P112Q);Trpc6em1(P112Q)Mcwi;Trpc6em4Mcwi
11553907 Trpc6em4Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_5.0 8 6799564 6904623 + Trpc6 CRISPR/Cas9 induced mutant 1 (P112Q);Trpc6em1(P112Q)Mcwi;Trpc6em4Mcwi
11553907 Trpc6em4Mcwi transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. 2016-10-17 2016-10-17 619788 Trpc6 Rnor_6.0 8 6811543 6917534 + Trpc6 CRISPR/Cas9 induced mutant 1 (P112Q);Trpc6em1(P112Q)Mcwi;Trpc6em4Mcwi
13792702 Trpv1em1Sage transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage The ZFN mutation was produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. 2018-09-21 2018-09-21 628841 Trpv1 RGSC 3.4 10 60109656 60134939 +
13792702 Trpv1em1Sage transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage The ZFN mutation was produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. 2018-09-21 2018-09-21 628841 Trpv1 Rnor_5.0 10 59538296 59563441 +
13792702 Trpv1em1Sage transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage The ZFN mutation was produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. 2018-09-21 2018-09-21 628841 Trpv1 Rnor_6.0 10 59799123 59824208 +
11553898 Trpv2em1Mcwi transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. 2016-10-17 2016-10-17 3965 Trpv2 RGSC 3.4 10 48764894 48786150 + Trpv2em1Mcwi
11553898 Trpv2em1Mcwi transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. 2016-10-17 2016-10-17 3965 Trpv2 Rnor_5.0 10 48686500 48707996 + Trpv2em1Mcwi
11553898 Trpv2em1Mcwi transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. 2016-10-17 2016-10-17 3965 Trpv2 Rnor_6.0 10 48903540 48925036 + Trpv2em1Mcwi
39456109 Trpv4em1Sage transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage This Trpv4 allele has a 899-bp deletion which completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . 2020-10-02 2020-10-02 69337 Trpv4 RGSC 3.4 12 43226933 43265889 +
39456109 Trpv4em1Sage transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage This Trpv4 allele has a 899-bp deletion which completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . 2020-10-02 2020-10-02 69337 Trpv4 Rnor_5.0 12 49492064 49529956 +
39456109 Trpv4em1Sage transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage This Trpv4 allele has a 899-bp deletion which completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . 2020-10-02 2020-10-02 69337 Trpv4 Rnor_6.0 12 47698915 47737902 +
11553851 Trpv4em4Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 RGSC 3.4 12 43226933 43265889 + Trpv4em4Mcwi
11553851 Trpv4em4Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 Rnor_5.0 12 49492064 49529956 + Trpv4em4Mcwi
11553851 Trpv4em4Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 Rnor_6.0 12 47698915 47737902 + Trpv4em4Mcwi
11553847 Trpv4em5Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 RGSC 3.4 12 43226933 43265889 + two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Trpv4em5Mcwi
11553847 Trpv4em5Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 Rnor_5.0 12 49492064 49529956 + two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Trpv4em5Mcwi
11553847 Trpv4em5Mcwi transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene 2016-10-14 2016-10-14 69337 Trpv4 Rnor_6.0 12 47698915 47737902 + two pore segment channel 2;ZFN induced mutant5, Medical College of Wisconsin;Trpv4em5Mcwi
12791989 Tsc2Eker tuberous sclerosis 2;Eker renal cell carcinoma This allele is a spontaneously nonsense mutant found in a renal cell carcinoma diseased Long-Evans rat. The mutation was genome insertion that creates a premature stop coden in the protein sequence. 2017-03-07 2017-03-07 3908 Tsc2 RGSC 3.4 10 13848210 13883189 - Tsc2Eker
12791989 Tsc2Eker tuberous sclerosis 2;Eker renal cell carcinoma This allele is a spontaneously nonsense mutant found in a renal cell carcinoma diseased Long-Evans rat. The mutation was genome insertion that creates a premature stop coden in the protein sequence. 2017-03-07 2017-03-07 3908 Tsc2 Rnor_5.0 10 13778990 13813725 - Tsc2Eker
12791989 Tsc2Eker tuberous sclerosis 2;Eker renal cell carcinoma This allele is a spontaneously nonsense mutant found in a renal cell carcinoma diseased Long-Evans rat. The mutation was genome insertion that creates a premature stop coden in the protein sequence. 2017-03-07 2017-03-07 3908 Tsc2 Rnor_6.0 10 13962006 13996684 - Tsc2Eker
150521600 Tshrem1Mlit thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478). 2021-11-11 2021-11-11 3911 Tshr RGSC 3.4 6 115024999 115162531 +
150521600 Tshrem1Mlit thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478). 2021-11-11 2021-11-11 3911 Tshr Rnor_5.0 6 124509406 124561916 +
150521600 Tshrem1Mlit thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478). 2021-11-11 2021-11-11 3911 Tshr Rnor_6.0 6 115170290 115306871 +
150429831 Tspoem1Vpl translocator protein; ZFN induced mutant1, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion). 2021-10-01 2021-10-01 2228 Tspo RGSC 3.4 7 121597084 121599342 +
150429831 Tspoem1Vpl translocator protein; ZFN induced mutant1, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion). 2021-10-01 2021-10-01 2228 Tspo Rnor_5.0 7 124449361 124459090 +
150429831 Tspoem1Vpl translocator protein; ZFN induced mutant1, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion). 2021-10-01 2021-10-01 2228 Tspo Rnor_6.0 7 124460358 124470610 +
150429832 Tspoem2Vpl translocator protein; ZFN induced mutant2, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion). 2021-10-01 2021-10-01 2228 Tspo RGSC 3.4 7 121597084 121599342 +
150429832 Tspoem2Vpl translocator protein; ZFN induced mutant2, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion). 2021-10-01 2021-10-01 2228 Tspo Rnor_5.0 7 124449361 124459090 +
150429832 Tspoem2Vpl translocator protein; ZFN induced mutant2, Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion). 2021-10-01 2021-10-01 2228 Tspo Rnor_6.0 7 124460358 124470610 +
11565825 Ttnem1Sage Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence. 2016-11-28 2016-11-28 621114 Ttn RGSC 3.4 3 59404023 59665308 - Titin; zinc finger nuclease induced mutant1,Sigma Advanced Genetic Engineering Labs;TTNtvA;Ttnem1Sage
11565825 Ttnem1Sage Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence. 2016-11-28 2016-11-28 621114 Ttn Rnor_5.0 3 70138896 70408647 - Titin; zinc finger nuclease induced mutant1,Sigma Advanced Genetic Engineering Labs;TTNtvA;Ttnem1Sage
11565825 Ttnem1Sage Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence. 2016-11-28 2016-11-28 621114 Ttn Rnor_6.0 3 63565160 63837815 - Titin; zinc finger nuclease induced mutant1,Sigma Advanced Genetic Engineering Labs;TTNtvA;Ttnem1Sage
11565827 Ttnem2Sage Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0). 2016-11-28 2016-11-28 621114 Ttn RGSC 3.4 3 59404023 59665308 - TTNtvZ;Titin; zinc finger nuclease induced mutant2,Sigma Advanced Genetic Engineering Labs;Ttnem2Sage
11565827 Ttnem2Sage Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0). 2016-11-28 2016-11-28 621114 Ttn Rnor_5.0 3 70138896 70408647 - TTNtvZ;Titin; zinc finger nuclease induced mutant2,Sigma Advanced Genetic Engineering Labs;Ttnem2Sage
11565827 Ttnem2Sage Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0). 2016-11-28 2016-11-28 621114 Ttn Rnor_6.0 3 63565160 63837815 - TTNtvZ;Titin; zinc finger nuclease induced mutant2,Sigma Advanced Genetic Engineering Labs;Ttnem2Sage
12792972 Tyrem1Kyo tyrosinase; TALEN induced mutant1, Kyo The TALEN system caused a 29-bp deletion in the Tyr gene. 2017-03-17 2017-03-17 1589755 Tyr RGSC 3.4 1 143641257 143746315 - Tyrem1Kyo
12792972 Tyrem1Kyo tyrosinase; TALEN induced mutant1, Kyo The TALEN system caused a 29-bp deletion in the Tyr gene. 2017-03-17 2017-03-17 1589755 Tyr Rnor_5.0 1 157322968 157416594 - Tyrem1Kyo
12792972 Tyrem1Kyo tyrosinase; TALEN induced mutant1, Kyo The TALEN system caused a 29-bp deletion in the Tyr gene. 2017-03-17 2017-03-17 1589755 Tyr Rnor_6.0 1 151012598 151106802 - Tyrem1Kyo
13207345 TyrsiaKyo tyrosinase; sia mutant A spontaneous missense mutation in exon 1 of the tyrosinase gene, S79P, was responsible for siamese phenotype in American fancy rat colony. 2017-07-26 2017-07-26 1589755 Tyr RGSC 3.4 1 143641257 143746315 - TyrsiaKyo
13207345 TyrsiaKyo tyrosinase; sia mutant A spontaneous missense mutation in exon 1 of the tyrosinase gene, S79P, was responsible for siamese phenotype in American fancy rat colony. 2017-07-26 2017-07-26 1589755 Tyr Rnor_5.0 1 157322968 157416594 - TyrsiaKyo
13207345 TyrsiaKyo tyrosinase; sia mutant A spontaneous missense mutation in exon 1 of the tyrosinase gene, S79P, was responsible for siamese phenotype in American fancy rat colony. 2017-07-26 2017-07-26 1589755 Tyr Rnor_6.0 1 151012598 151106802 - TyrsiaKyo
126925166 Ubdem1 ubiquitin D; CRISPR/Cas9 induced mutant1 This Ubd knockout rat allele was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. 2021-05-13 2021-05-13 69418 Ubd RGSC 3.4 20 1475944 1477895 -
126925166 Ubdem1 ubiquitin D; CRISPR/Cas9 induced mutant1 This Ubd knockout rat allele was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. 2021-05-13 2021-05-13 69418 Ubd Rnor_5.0 20 3917777 3919728 -
126925166 Ubdem1 ubiquitin D; CRISPR/Cas9 induced mutant1 This Ubd knockout rat allele was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. 2021-05-13 2021-05-13 69418 Ubd Rnor_6.0 20 1876175 1878126 -
5509987 Ube2q2em3Mcwi ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 7. 2011-11-16 2011-11-16 1307680 Ube2q2 RGSC 3.4 8 58688257 58749088 + Ube2q2em3Mcwi
5509987 Ube2q2em3Mcwi ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 7. 2011-11-16 2011-11-16 1307680 Ube2q2 Rnor_5.0 8 58292660 58349722 + Ube2q2em3Mcwi
5509987 Ube2q2em3Mcwi ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 7. 2011-11-16 2011-11-16 1307680 Ube2q2 Rnor_6.0 8 59709972 59754102 + Ube2q2em3Mcwi
126790465 Ube3aem1Jue ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos to induce 90kb deletion in rat Ube3a gene 2021-04-22 2021-04-22 1306361 Ube3a RGSC 3.4 1 110729142 110816491 +
126790465 Ube3aem1Jue ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos to induce 90kb deletion in rat Ube3a gene 2021-04-22 2021-04-22 1306361 Ube3a Rnor_5.0 1 117745283 117834011 +
126790465 Ube3aem1Jue ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos to induce 90kb deletion in rat Ube3a gene 2021-04-22 2021-04-22 1306361 Ube3a Rnor_6.0 1 116586901 116678161 +
2299109 Ubqln4Tn(sb-T2/Bart3)2.230Mcwi ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene 2008-08-12 2008-08-12 1308273 Ubqln4 RGSC 3.4 2 180669525 180684724 + Ubqln4Tn(sb-T2/Bart3)2.230Mcwi
2299109 Ubqln4Tn(sb-T2/Bart3)2.230Mcwi ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene 2008-08-12 2008-08-12 1308273 Ubqln4 Rnor_5.0 2 207318101 207333435 + Ubqln4Tn(sb-T2/Bart3)2.230Mcwi
2299109 Ubqln4Tn(sb-T2/Bart3)2.230Mcwi ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene 2008-08-12 2008-08-12 1308273 Ubqln4 Rnor_6.0 2 187915701 187931035 + Ubqln4Tn(sb-T2/Bart3)2.230Mcwi
151665326 Ucp2em1Mcwi uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989) 2022-03-18 2022-03-18 3932 Ucp2 RGSC 3.4 1 157925514 157928222 +
151665326 Ucp2em1Mcwi uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989) 2022-03-18 2022-03-18 3932 Ucp2 Rnor_5.0 1 171707625 171713991 +
151665326 Ucp2em1Mcwi uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989) 2022-03-18 2022-03-18 3932 Ucp2 Rnor_6.0 1 165506375 165512744 +
13432064 Ugt1a1j UDP glucuronosyltransferase family 1 member A1, jaundice mutant A single guanosine (G) base deletion within the UGT1A1 gene causes the absence of hepatic UDP-glucuronosyltransferase (UDPGT) activity toward bilirubin in a spontaneous mutant strain of Wistar rats. 2017-09-18 2017-09-18 3935 Ugt1a1 RGSC 3.4 9 87091241 87098362 + Ugt1a1j
13432064 Ugt1a1j UDP glucuronosyltransferase family 1 member A1, jaundice mutant A single guanosine (G) base deletion within the UGT1A1 gene causes the absence of hepatic UDP-glucuronosyltransferase (UDPGT) activity toward bilirubin in a spontaneous mutant strain of Wistar rats. 2017-09-18 2017-09-18 3935 Ugt1a1 Rnor_5.0 9 94982916 94990037 + Ugt1a1j
13432064 Ugt1a1j UDP glucuronosyltransferase family 1 member A1, jaundice mutant A single guanosine (G) base deletion within the UGT1A1 gene causes the absence of hepatic UDP-glucuronosyltransferase (UDPGT) activity toward bilirubin in a spontaneous mutant strain of Wistar rats. 2017-09-18 2017-09-18 3935 Ugt1a1 Rnor_6.0 9 95295701 95302822 + Ugt1a1j
5143968 Ulk3em1Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 546-555) 2011-07-27 2011-07-27 1587417 Ulk3 RGSC 3.4 8 61343722 61348824 + Ulk3em1Mcwi
5143968 Ulk3em1Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 546-555) 2011-07-27 2011-07-27 1587417 Ulk3 Rnor_5.0 8 62146130 62152150 + Ulk3em1Mcwi
5143968 Ulk3em1Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 546-555) 2011-07-27 2011-07-27 1587417 Ulk3 Rnor_6.0 8 62368548 62375229 + Ulk3em1Mcwi
5143971 Ulk3em4Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 88-bp frameshift deletion in exon 5 (del 476-563) 2011-07-27 2011-07-27 1587417 Ulk3 RGSC 3.4 8 61343722 61348824 + Ulk3em4Mcwi;unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5143971 Ulk3em4Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 88-bp frameshift deletion in exon 5 (del 476-563) 2011-07-27 2011-07-27 1587417 Ulk3 Rnor_5.0 8 62146130 62152150 + Ulk3em4Mcwi;unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5143971 Ulk3em4Mcwi unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is an 88-bp frameshift deletion in exon 5 (del 476-563) 2011-07-27 2011-07-27 1587417 Ulk3 Rnor_6.0 8 62368548 62375229 + Ulk3em4Mcwi;unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin
5508340 Ulk4em3Mcwi unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 (del 126242938 126242951) 2011-10-13 2011-10-13 1565726 Ulk4 RGSC 3.4 8 125992455 126284263 - Ulk4em3Mcwi
5508340 Ulk4em3Mcwi unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 (del 126242938 126242951) 2011-10-13 2011-10-13 1565726 Ulk4 Rnor_5.0 8 128829597 129125286 - Ulk4em3Mcwi
5508340 Ulk4em3Mcwi unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 (del 126242938 126242951) 2011-10-13 2011-10-13 1565726 Ulk4 Rnor_6.0 8 129631003 129919080 - Ulk4em3Mcwi
5687697 Umodem1Mcwi uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 104-bp frameshift deletion in exon 2 (del 294-397) 2012-02-09 2012-02-09 3940 Umod RGSC 3.4 1 177729212 177742552 - Umodem1Mcwi
5687697 Umodem1Mcwi uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 104-bp frameshift deletion in exon 2 (del 294-397) 2012-02-09 2012-02-09 3940 Umod Rnor_5.0 1 196127939 196141822 - Umodem1Mcwi
5687697 Umodem1Mcwi uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 104-bp frameshift deletion in exon 2 (del 294-397) 2012-02-09 2012-02-09 3940 Umod Rnor_6.0 1 189186027 189199939 - Umodem1Mcwi
12802355 Unc5ccvd unc-5 netrin receptor C; cerebellar vermis defect In homozygous cvd/cvd (cerebellar vermis defect), conversion of G to T was found at nucleotide 1501 resulting in a premature termination at codon 451 of the UNC5c protein. 2017-04-05 2017-04-05 735109 Unc5c RGSC 3.4 2 239365109 239721231 + Unc5ccvd
12802355 Unc5ccvd unc-5 netrin receptor C; cerebellar vermis defect In homozygous cvd/cvd (cerebellar vermis defect), conversion of G to T was found at nucleotide 1501 resulting in a premature termination at codon 451 of the UNC5c protein. 2017-04-05 2017-04-05 735109 Unc5c Rnor_5.0 2 265573406 265926229 + Unc5ccvd
12802355 Unc5ccvd unc-5 netrin receptor C; cerebellar vermis defect In homozygous cvd/cvd (cerebellar vermis defect), conversion of G to T was found at nucleotide 1501 resulting in a premature termination at codon 451 of the UNC5c protein. 2017-04-05 2017-04-05 735109 Unc5c Rnor_6.0 2 247045813 247397483 + Unc5ccvd
12802353 Unc5chob unc-5 netrin receptor C; hobble mutant The hobble (HOB) rat has been discovered in a colony of F344/Snk rat with the hobbling gait. A 2-bp insertion was found at nucleotide 1085 resulting in frame shift from codon 312 and a premature termination at codon 385. 2017-04-05 2017-04-05 735109 Unc5c RGSC 3.4 2 239365109 239721231 + Unc5chob
12802353 Unc5chob unc-5 netrin receptor C; hobble mutant The hobble (HOB) rat has been discovered in a colony of F344/Snk rat with the hobbling gait. A 2-bp insertion was found at nucleotide 1085 resulting in frame shift from codon 312 and a premature termination at codon 385. 2017-04-05 2017-04-05 735109 Unc5c Rnor_5.0 2 265573406 265926229 + Unc5chob
12802353 Unc5chob unc-5 netrin receptor C; hobble mutant The hobble (HOB) rat has been discovered in a colony of F344/Snk rat with the hobbling gait. A 2-bp insertion was found at nucleotide 1085 resulting in frame shift from codon 312 and a premature termination at codon 385. 2017-04-05 2017-04-05 735109 Unc5c Rnor_6.0 2 247045813 247397483 + Unc5chob
150521540 Uoxem1Cya urate oxidase; CRISPR/Cas9 induced mutant1, Cya The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4. 2021-11-09 2021-11-09 621369 Uox RGSC 3.4 2 244795552 244832143 +
150521540 Uoxem1Cya urate oxidase; CRISPR/Cas9 induced mutant1, Cya The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4. 2021-11-09 2021-11-09 621369 Uox Rnor_5.0 2 270978811 271015097 +
150521540 Uoxem1Cya urate oxidase; CRISPR/Cas9 induced mutant1, Cya The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4. 2021-11-09 2021-11-09 621369 Uox Rnor_6.0 2 252452282 252488497 +
730454717 Vapbem1Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 1 The C-T base substitution in Exon 2 together with flanking loxP sites was introduced to F344 rat Vapb gene creating P56S mutation in F344. 2026-06-01 2026-06-01 68326 Vapb RGSC 3.4 3 164632388 164669187 +
730454717 Vapbem1Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 1 The C-T base substitution in Exon 2 together with flanking loxP sites was introduced to F344 rat Vapb gene creating P56S mutation in F344. 2026-06-01 2026-06-01 68326 Vapb Rnor_5.0 3 177890856 177931543 +
730454717 Vapbem1Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 1 The C-T base substitution in Exon 2 together with flanking loxP sites was introduced to F344 rat Vapb gene creating P56S mutation in F344. 2026-06-01 2026-06-01 68326 Vapb Rnor_6.0 3 171832558 171871042 +
730454718 Vapbem2Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 2 This knock out mutation rat strain was produced by deleting 210–211 bp between the gRNA-targeted sites, effectively removing Exon 2 of the rat Vapb gene. 2026-06-01 2026-06-01 68326 Vapb RGSC 3.4 3 164632388 164669187 + Vapbem2Edin-/-
730454718 Vapbem2Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 2 This knock out mutation rat strain was produced by deleting 210–211 bp between the gRNA-targeted sites, effectively removing Exon 2 of the rat Vapb gene. 2026-06-01 2026-06-01 68326 Vapb Rnor_5.0 3 177890856 177931543 + Vapbem2Edin-/-
730454718 Vapbem2Edin VAMP associated protein B and C; CRISPR/Cas9 induced mutant 2 This knock out mutation rat strain was produced by deleting 210–211 bp between the gRNA-targeted sites, effectively removing Exon 2 of the rat Vapb gene. 2026-06-01 2026-06-01 68326 Vapb Rnor_6.0 3 171832558 171871042 + Vapbem2Edin-/-
10054274 Vcpem1Ionsz valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Vcp gene that made the 155th amino acid Arg into His 2015-08-03 2015-08-03 621595 Vcp RGSC 3.4 5 59472100 59491508 - Vcpem1Ionsz;Vcp em1(R155H)Ionsz
10054274 Vcpem1Ionsz valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Vcp gene that made the 155th amino acid Arg into His 2015-08-03 2015-08-03 621595 Vcp Rnor_5.0 5 62951999 62971402 - Vcpem1Ionsz;Vcp em1(R155H)Ionsz
10054274 Vcpem1Ionsz valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences mutation induced by CRISPR/Cas9 system in the Vcp gene that made the 155th amino acid Arg into His 2015-08-03 2015-08-03 621595 Vcp Rnor_6.0 5 58426548 58445953 - Vcpem1Ionsz;Vcp em1(R155H)Ionsz
408364972 Vdrem1Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the Vdr gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt----- GAGTGTGTGGAGACCGAGCCAC 2024-11-06 2024-11-06 3959 Vdr RGSC 3.4 7 136567614 136617280 -
408364972 Vdrem1Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the Vdr gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt----- GAGTGTGTGGAGACCGAGCCAC 2024-11-06 2024-11-06 3959 Vdr Rnor_5.0 7 139536241 139585928 -
408364972 Vdrem1Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the Vdr gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt----- GAGTGTGTGGAGACCGAGCCAC 2024-11-06 2024-11-06 3959 Vdr Rnor_6.0 7 139344452 139394138 -
124713547 Vdrem1Thka vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr RGSC 3.4 7 136567614 136617280 -
124713547 Vdrem1Thka vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr Rnor_5.0 7 139536241 139585928 -
124713547 Vdrem1Thka vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr Rnor_6.0 7 139344452 139394138 -
124713550 Vdrem2Thka vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr RGSC 3.4 7 136567614 136617280 -
124713550 Vdrem2Thka vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr Rnor_5.0 7 139536241 139585928 -
124713550 Vdrem2Thka vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. 2021-03-19 2021-03-19 3959 Vdr Rnor_6.0 7 139344452 139394138 -
408364962 Vdrem3Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd This mutant allele carries 5-bp deletion (CCCCG) in exon 3 of Vdr gene induced by CRISPR/Cas9 system in the embryos of F344-ApcPirc/Uwm rats (RGD:1641862). 2024-11-05 2024-11-05 3959 Vdr RGSC 3.4 7 136567614 136617280 -
408364962 Vdrem3Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd This mutant allele carries 5-bp deletion (CCCCG) in exon 3 of Vdr gene induced by CRISPR/Cas9 system in the embryos of F344-ApcPirc/Uwm rats (RGD:1641862). 2024-11-05 2024-11-05 3959 Vdr Rnor_5.0 7 139536241 139585928 -
408364962 Vdrem3Hfd vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd This mutant allele carries 5-bp deletion (CCCCG) in exon 3 of Vdr gene induced by CRISPR/Cas9 system in the embryos of F344-ApcPirc/Uwm rats (RGD:1641862). 2024-11-05 2024-11-05 3959 Vdr Rnor_6.0 7 139344452 139394138 -
645122507 Vkorc1Wr vitamin K epoxide reductase complex, subunit 1; warfarin-resistant This allele has a non-synonymous mutation in the Vkorc1 gene from A to G, resulting in the tyrosine to cysteine (Y-C) amino-acid change at position 139 in exon 3. This amino-acid change results in a 47% reduction of the basal in vitro Vkorc1 activity. 2026-04-06 2026-04-06 1303107 Vkorc1 RGSC 3.4 1 187176745 187179266 -
645122507 Vkorc1Wr vitamin K epoxide reductase complex, subunit 1; warfarin-resistant This allele has a non-synonymous mutation in the Vkorc1 gene from A to G, resulting in the tyrosine to cysteine (Y-C) amino-acid change at position 139 in exon 3. This amino-acid change results in a 47% reduction of the basal in vitro Vkorc1 activity. 2026-04-06 2026-04-06 1303107 Vkorc1 Rnor_5.0 1 206361380 206363901 -
645122507 Vkorc1Wr vitamin K epoxide reductase complex, subunit 1; warfarin-resistant This allele has a non-synonymous mutation in the Vkorc1 gene from A to G, resulting in the tyrosine to cysteine (Y-C) amino-acid change at position 139 in exon 3. This amino-acid change results in a 47% reduction of the basal in vitro Vkorc1 activity. 2026-04-06 2026-04-06 1303107 Vkorc1 Rnor_6.0 1 199338785 199341306 -
11553856 Vnn1em1Mcwi vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in Exon 3 of the Vnn1 gene 2016-10-14 2016-10-14 1310075 Vnn1 RGSC 3.4 1 22087290 22097592 - Vnn1em1Mcwi
11553856 Vnn1em1Mcwi vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in Exon 3 of the Vnn1 gene 2016-10-14 2016-10-14 1310075 Vnn1 Rnor_5.0 1 24089365 24099667 - Vnn1em1Mcwi
11553856 Vnn1em1Mcwi vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in Exon 3 of the Vnn1 gene 2016-10-14 2016-10-14 1310075 Vnn1 Rnor_6.0 1 22614832 22625134 - Vnn1em1Mcwi
11553853 Vnn1em2Mcwi vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos. 2016-10-14 2016-10-14 1310075 Vnn1 RGSC 3.4 1 22087290 22097592 - Vnn1em1(N131S)Mcwi;Vnn1tm1(N131S)Mcwi;vanin 1; CRISPR/Cas9 induced mutant 1 (N131S), Medical College of Wisconsin;Vnn1em2Mcwi
11553853 Vnn1em2Mcwi vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos. 2016-10-14 2016-10-14 1310075 Vnn1 Rnor_5.0 1 24089365 24099667 - Vnn1em1(N131S)Mcwi;Vnn1tm1(N131S)Mcwi;vanin 1; CRISPR/Cas9 induced mutant 1 (N131S), Medical College of Wisconsin;Vnn1em2Mcwi
11553853 Vnn1em2Mcwi vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos. 2016-10-14 2016-10-14 1310075 Vnn1 Rnor_6.0 1 22614832 22625134 - Vnn1em1(N131S)Mcwi;Vnn1tm1(N131S)Mcwi;vanin 1; CRISPR/Cas9 induced mutant 1 (N131S), Medical College of Wisconsin;Vnn1em2Mcwi
39457948 Vwfem1Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon in the Sprague Dawley embryos . 2020-10-09 2020-10-09 621759 Vwf RGSC 3.4 4 161723415 161854766 +
39457948 Vwfem1Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon in the Sprague Dawley embryos . 2020-10-09 2020-10-09 621759 Vwf Rnor_5.0 4 225098521 225229257 +
39457948 Vwfem1Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon in the Sprague Dawley embryos . 2020-10-09 2020-10-09 621759 Vwf Rnor_6.0 4 158085059 158219525 +
18182945 Vwfem2Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf RGSC 3.4 4 161723415 161854766 +
18182945 Vwfem2Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf Rnor_5.0 4 225098521 225229257 +
18182945 Vwfem2Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf Rnor_6.0 4 158085059 158219525 +
18182947 Vwfem3Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf RGSC 3.4 4 161723415 161854766 +
18182947 Vwfem3Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf Rnor_5.0 4 225098521 225229257 +
18182947 Vwfem3Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 2020-01-14 2020-01-14 621759 Vwf Rnor_6.0 4 158085059 158219525 +
150429599 Vwfem4Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi The deletion allele was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting mutation is a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. 2021-09-08 2021-09-08 621759 Vwf RGSC 3.4 4 161723415 161854766 +
150429599 Vwfem4Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi The deletion allele was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting mutation is a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. 2021-09-08 2021-09-08 621759 Vwf Rnor_5.0 4 225098521 225229257 +
150429599 Vwfem4Mcwi von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi The deletion allele was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting mutation is a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. 2021-09-08 2021-09-08 621759 Vwf Rnor_6.0 4 158085059 158219525 +
5508327 Wdr72em1Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 (del 78900101 78900113) 2011-10-13 2011-10-13 1563550 Wdr72 RGSC 3.4 8 78891358 79050751 + Wdr72em1Mcwi
5508327 Wdr72em1Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 (del 78900101 78900113) 2011-10-13 2011-10-13 1563550 Wdr72 Rnor_5.0 8 80586841 80744090 + Wdr72em1Mcwi
5508327 Wdr72em1Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 (del 78900101 78900113) 2011-10-13 2011-10-13 1563550 Wdr72 Rnor_6.0 8 80965734 81125710 + Wdr72em1Mcwi
5131978 Wdr72em2Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 3 (del 329-336). 2011-05-17 2011-05-17 1563550 Wdr72 RGSC 3.4 8 78891358 79050751 + Wdr72em2Mcwi
5131978 Wdr72em2Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 3 (del 329-336). 2011-05-17 2011-05-17 1563550 Wdr72 Rnor_5.0 8 80586841 80744090 + Wdr72em2Mcwi
5131978 Wdr72em2Mcwi WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 3 (del 329-336). 2011-05-17 2011-05-17 1563550 Wdr72 Rnor_6.0 8 80965734 81125710 + Wdr72em2Mcwi
149735335 Wfs1em1Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 1 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 RGSC 3.4 14 79379680 79404003 + Wfs1em1
149735335 Wfs1em1Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 1 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_5.0 14 78606172 78630689 + Wfs1em1
149735335 Wfs1em1Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 1 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_6.0 14 78640707 78665224 + Wfs1em1
149735337 Wfs1em2Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 2 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 RGSC 3.4 14 79379680 79404003 + Wfs1em2
149735337 Wfs1em2Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 2 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_5.0 14 78606172 78630689 + Wfs1em2
149735337 Wfs1em2Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 2 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_6.0 14 78640707 78665224 + Wfs1em2
149735339 Wfs1em3Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 3 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). This allele carrys a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein. 2021-07-15 2021-07-15 68954 Wfs1 RGSC 3.4 14 79379680 79404003 + Wfs1em3
149735339 Wfs1em3Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 3 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). This allele carrys a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_5.0 14 78606172 78630689 + Wfs1em3
149735339 Wfs1em3Ptsn wolframin ER transmembrane glycoprotein; ZFN induced mutant 3 This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). This allele carrys a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein. 2021-07-15 2021-07-15 68954 Wfs1 Rnor_6.0 14 78640707 78665224 + Wfs1em3
150429961 Wwoxlde WW domain-containing oxidoreductase; lde mutant This spontaneous lethal dwarfism with epilepsy (LDE) allele carries a 13-bp deletion in exon 9 of rat Wwox gene . This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal. 2021-10-07 2021-10-07 1309927 Wwox RGSC 3.4 19 44516391 44829849 +
150429961 Wwoxlde WW domain-containing oxidoreductase; lde mutant This spontaneous lethal dwarfism with epilepsy (LDE) allele carries a 13-bp deletion in exon 9 of rat Wwox gene . This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal. 2021-10-07 2021-10-07 1309927 Wwox Rnor_5.0 19 57582172 58503008 +
150429961 Wwoxlde WW domain-containing oxidoreductase; lde mutant This spontaneous lethal dwarfism with epilepsy (LDE) allele carries a 13-bp deletion in exon 9 of rat Wwox gene . This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal. 2021-10-07 2021-10-07 1309927 Wwox Rnor_6.0 19 46761353 47695247 +
14398480 Xdhem1Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh RGSC 3.4 6 21417685 21590015 +
14398480 Xdhem1Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh Rnor_5.0 6 34996983 35059195 -
14398480 Xdhem1Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh Rnor_6.0 6 25149570 25211273 -
14398482 Xdhem2Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh RGSC 3.4 6 21417685 21590015 +
14398482 Xdhem2Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh Rnor_5.0 6 34996983 35059195 -
14398482 Xdhem2Mcwi xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 2019-04-19 2019-04-19 62043 Xdh Rnor_6.0 6 25149570 25211273 -
12910834 Zbtb16Lx zinc finger and BTB domain containing 16, Lx mutant A spontaneous 2964 bp deletion mutation was identified in the intron 2 of Zbtb16 gene of SHR-Lx PD5(SHR.PD-(D8Rat42-D8Arb23)/Cub) rats. 2017-06-26 2017-06-26 727921 Zbtb16 RGSC 3.4 8 51931530 52094813 - Zbtb16Lx
12910834 Zbtb16Lx zinc finger and BTB domain containing 16, Lx mutant A spontaneous 2964 bp deletion mutation was identified in the intron 2 of Zbtb16 gene of SHR-Lx PD5(SHR.PD-(D8Rat42-D8Arb23)/Cub) rats. 2017-06-26 2017-06-26 727921 Zbtb16 Rnor_5.0 8 51573252 51740759 - Zbtb16Lx
12910834 Zbtb16Lx zinc finger and BTB domain containing 16, Lx mutant A spontaneous 2964 bp deletion mutation was identified in the intron 2 of Zbtb16 gene of SHR-Lx PD5(SHR.PD-(D8Rat42-D8Arb23)/Cub) rats. 2017-06-26 2017-06-26 727921 Zbtb16 Rnor_6.0 8 52980226 53146765 - Zbtb16Lx
150340624 Zbtb16em1Ipcv zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. 2021-08-20 2021-08-20 727921 Zbtb16 RGSC 3.4 8 51931530 52094813 -
150340624 Zbtb16em1Ipcv zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. 2021-08-20 2021-08-20 727921 Zbtb16 Rnor_5.0 8 51573252 51740759 -
150340624 Zbtb16em1Ipcv zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. 2021-08-20 2021-08-20 727921 Zbtb16 Rnor_6.0 8 52980226 53146765 -
11561972 Zbtb20Tn(pb-Bhr7)1Wmukf zinc finger and BTB domain containing 20;Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the Intron 3 of Zbtb20 gene. 2016-11-15 2017-07-21 1560387 Zbtb20 RGSC 3.4 11 58662837 59399213 - Zbtb20Tn(pb-Bhr7)1Wmukf
11561972 Zbtb20Tn(pb-Bhr7)1Wmukf zinc finger and BTB domain containing 20;Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the Intron 3 of Zbtb20 gene. 2016-11-15 2017-07-21 1560387 Zbtb20 Rnor_5.0 11 61127464 61865305 - Zbtb20Tn(pb-Bhr7)1Wmukf
11561972 Zbtb20Tn(pb-Bhr7)1Wmukf zinc finger and BTB domain containing 20;Bhr7 transposon insertion 1, Wmukf Transposon "Bhr7" was inserted into the Intron 3 of Zbtb20 gene. 2016-11-15 2017-07-21 1560387 Zbtb20 Rnor_6.0 11 62014925 62561113 - Zbtb20Tn(pb-Bhr7)1Wmukf